sort by

5 publications mentioning rno-mir-379

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-379. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 22
These were rno-miR-30d-5p and rno-miR-125b-5p which were expressed abundantly and rno-miR-379-5p which was expressed at modest copy number. [score:5]
The 8 rare diff-reg miRNAs, and the modestly expressed rno-miR-379-5p, had only 3 verified mRNA targets among them, none that hinted at a role in pain physiology. [score:5]
Only 3 miRNAs that were expressed abundantly (rno-miR-30d-5p, rno-miR-125b-5p) or at moderate levels (rno-miR-379-5p) were differentially regulated. [score:4]
An additional one was expressed at modest abundance (rno-miR-379-5p, RPM ~ 200) and the remaining 4 were rare (RPM < 15). [score:3]
The target miRNAs (and corresponding assay numbers) were: rno-miR-23a (000399), rno-miR-26b (000407), rno-miR-30-5p (000420), rno-miR-101b (002531), rno-miR-125b-5p (000449), rno-miR-379 (001138) and rno-miR-431 (001979). [score:2]
The few miRNAs that were differentially regulated (diff-reg) are indicated by yellow triangles (rno-miR-30d-5p, rno-miR-125b-5p and rno-miR-379-5p) or large blue dots. [score:2]
We conclude that rno-miR-30d-5p, rno-miR-125b-5p, and perhaps rno-miR-379-5p are fundamental to the contrasting neuropathic pain phenotype in HA vs. [score:1]
[1 to 20 of 7 sentences]
2
[+] score: 17
Other miRNAs from this paper: mmu-mir-1a-1, mmu-mir-127, mmu-mir-134, mmu-mir-136, mmu-mir-154, mmu-mir-181a-2, mmu-mir-143, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-21a, rno-mir-329, mmu-mir-329, mmu-mir-1a-2, mmu-mir-181a-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-375, mmu-mir-379, mmu-mir-181b-2, rno-mir-21, rno-mir-127, rno-mir-134, rno-mir-136, rno-mir-143, rno-mir-154, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-196a, rno-mir-181a-1, mmu-mir-196b, rno-mir-196b-1, mmu-mir-412, mmu-mir-370, oar-mir-431, oar-mir-127, oar-mir-432, oar-mir-136, mmu-mir-431, mmu-mir-433, rno-mir-431, rno-mir-433, ssc-mir-181b-2, ssc-mir-181c, ssc-mir-136, ssc-mir-196a-2, ssc-mir-21, rno-mir-370, rno-mir-412, rno-mir-1, mmu-mir-485, mmu-mir-541, rno-mir-541, rno-mir-493, rno-mir-485, mmu-mir-668, bta-mir-21, bta-mir-181a-2, bta-mir-127, bta-mir-181b-2, bta-mir-181c, mmu-mir-181d, mmu-mir-493, rno-mir-181d, rno-mir-196c, rno-mir-375, mmu-mir-1b, bta-mir-1-2, bta-mir-1-1, bta-mir-134, bta-mir-136, bta-mir-143, bta-mir-154a, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-329a, bta-mir-329b, bta-mir-370, bta-mir-375, bta-mir-379, bta-mir-412, bta-mir-431, bta-mir-432, bta-mir-433, bta-mir-485, bta-mir-493, bta-mir-541, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-1, ssc-mir-181a-1, mmu-mir-432, rno-mir-668, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-196b-1, ssc-mir-127, ssc-mir-432, oar-mir-21, oar-mir-181a-1, oar-mir-493, oar-mir-433, oar-mir-370, oar-mir-379, oar-mir-329b, oar-mir-329a, oar-mir-134, oar-mir-668, oar-mir-485, oar-mir-154a, oar-mir-154b, oar-mir-541, oar-mir-412, mmu-mir-21b, mmu-mir-21c, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-370, ssc-mir-493, bta-mir-154c, bta-mir-154b, oar-mir-143, oar-mir-181a-2, chi-mir-1, chi-mir-127, chi-mir-134, chi-mir-136, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-181b, chi-mir-181c, chi-mir-181d, chi-mir-196a, chi-mir-196b, chi-mir-21, chi-mir-329a, chi-mir-329b, chi-mir-379, chi-mir-412, chi-mir-432, chi-mir-433, chi-mir-485, chi-mir-493, rno-mir-196b-2, bta-mir-668, ssc-mir-375
In rats, miR-379 is specifically expressed in the brain where it is thought to regulate the transcription of miRNA genes [31]. [score:4]
We found that it was highly expressed in the skin of goat, indicating that the miR-379 family may play an important role in the transcriptional regulation of skin hair follicle genes. [score:4]
The largest number of sequences (14,461) in our goat dataset belonged to the miR-379 family which was one of the 21 co-expressed miRNAs families. [score:3]
Most reads (highest expression) were from the miR-379 family; next was miR-127 family with 5,235 reads. [score:3]
By comparing with sheep miRNA sequences, we found that 5 miRNA families containing miR-127, miR-136, miR-154, miR-229 and miR-379, were conserved in all these species It is, therefore, tempting to speculated that these 5 miRNA families are critical in mammal development. [score:2]
The largest miRNA family was the miR-154 family with 18 family members, next was the miR-379 family with six family members, then the miR-368 family with five family members, and finally the miR-329 family with four family members; other families had only one family member). [score:1]
[1 to 20 of 6 sentences]
3
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
Among the miRNAs examined, 79 miRNAs (24%) responded to the hyperandrogenic condition and interestingly, 80% of which were upregulated compared to the control group supporting the notion that hyperandrogenic condition down-regulates androgen receptors in the granulosa cells [35] which could be mediated by these upregulated miRNAs (rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p). [score:9]
A list of differentially expressed miRNAs (Fold change ≥ 2 and their corresponding P value) is presented in Figure  4. Beside this group, miRNAs which were also highly abundant in DHT -treated ovaries are rno-miR-221, rno-miR-222, rno-miR-25, rno-miR-26b, rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p. [score:3]
[1 to 20 of 2 sentences]
4
[+] score: 4
miR-379, miR-410, and 16 other miRNAs from this subcluster were among the 2-week-specific miRNAs in our study and were present in k-means clusters 2 or 3. Their association with neonatal energy homeostasis is consistent with their expression at 2 weeks of age, when animals are transitioning from maternal energy sources to independent feeding. [score:3]
A subset of miRNAs within the Dlk1-Dio3 miRNA cluster, called the miR-379/410 cluster (containing 38 miRNAs), has been shown to be essential for neonatal liver energy homeostasis (hepatic glucose and lipid metabolism) in mice [68]. [score:1]
[1 to 20 of 2 sentences]
5
[+] score: 2
Name Sequence miR-125b-5p-F ACTGATAAATCCCTGAGACCCTAAC miR-125b-5p-R TATGGTTTTGACGACTGTGTGAT U6-F ATTGGAACGATACAGAGAAGATT U6-R GGAACGCTTCACGAATTTG BDNF-F GCGCGAATGTGTTAGTGGTTACCT BDNF-R AACGGCACAAAACAATCTAGGCTAC GAPDH-F GCCCATCACCATCTTCCAGGAG GAPDH-R GAAGGGGCGGAGATGATGAC mGluR6-F GTGCTAGGTCAACCCTCAAA mGluR6-R CTAGAAGAGATCCCAGAGGAGAA miR-9a-3p-F GGCGCGGAAATAAAGCTAGATA miR-9a-3p-R TATGGTTGTTCACGACTCCTTCAC miR-124-5p-F ACTTTCAACGTGTTCACAGCG miR-124-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-134-5p-F CCTCTATTCTGTGACTGGTTGACC miR-134-5p-R AAAGGTTGATCTCGTGACTCTGTT miR-219a-5p-F CTGATTCCCTGATTGTCCAAAC miR-219a-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-379-5p-F GCGGCGGGTGGTAGACTATG miR-379-5p-R GTGCAGGGTCCGAGGT In situ hybridization and immunostaining In situ RNA hybridization was performed using Basescope technology (Advanced Cell Diagnostics, Hayward, California) following the manufacturer’s protocol with minor modifications. [score:1]
Name Sequence miR-125b-5p-F ACTGATAAATCCCTGAGACCCTAAC miR-125b-5p-R TATGGTTTTGACGACTGTGTGAT U6-F ATTGGAACGATACAGAGAAGATT U6-R GGAACGCTTCACGAATTTG BDNF-F GCGCGAATGTGTTAGTGGTTACCT BDNF-R AACGGCACAAAACAATCTAGGCTAC GAPDH-F GCCCATCACCATCTTCCAGGAG GAPDH-R GAAGGGGCGGAGATGATGAC mGluR6-F GTGCTAGGTCAACCCTCAAA mGluR6-R CTAGAAGAGATCCCAGAGGAGAA miR-9a-3p-F GGCGCGGAAATAAAGCTAGATA miR-9a-3p-R TATGGTTGTTCACGACTCCTTCAC miR-124-5p-F ACTTTCAACGTGTTCACAGCG miR-124-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-134-5p-F CCTCTATTCTGTGACTGGTTGACC miR-134-5p-R AAAGGTTGATCTCGTGACTCTGTT miR-219a-5p-F CTGATTCCCTGATTGTCCAAAC miR-219a-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-379-5p-F GCGGCGGGTGGTAGACTATG miR-379-5p-R GTGCAGGGTCCGAGGT In situ RNA hybridization was performed using Basescope technology (Advanced Cell Diagnostics, Hayward, California) following the manufacturer’s protocol with minor modifications. [score:1]
[1 to 20 of 2 sentences]