sort by

25 publications mentioning hsa-mir-762

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-762. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 237
Other miRNAs from this paper: hsa-let-7b, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-92b, hsa-mir-1207
Using a mo del of corneal epithelial cells exposed to natural human tear fluid, we showed that; 1) tear fluid treatment followed by bacterial antigens upregulates miR-762 and miR-1207, and down-regulates miR-92 and let-7b compared to bacterial antigens alone, 2) miR-762 negatively regulates the expression of genes encoding the antimicrobial RNase7, the immunomodulator ST2, and the RhoGTP -binding protein Rab5a, but not the defensins hBD-2 or hBD-3, 3) over -expression of miR-762 suppresses RNase7 and ST2 mRNA levels, and increases bacterial internalization, and 4) tear fluid alone induces miR-762 expression, which negatively regulates genes encoding RNase7 and ST2. [score:16]
Since expression of these two factors, which inhibit bacterial internalization, is also upregulated by tears, the data suggest that other tear -induced mechanisms must antagonize the inhibitory effects of miR-762 in regulating epithelial resistance to bacterial challenge. [score:11]
This study focused on miR-762, the microRNA that showed the greatest change (either up- or down-regulated) in the microarray analysis (> 3-fold upregulation when verified by RT-PCR), and which was upregulated ∼ 4-fold by tear fluid alone. [score:10]
Suppression of RNase7 and ST2 expression, by over -expressing miR-762 with a microRNA mimic, corresponded with increased bacterial internalization (> 3-fold). [score:7]
Accordingly, Antago-762 increased expression of Rab5a mRNA, a predicted target of miR-762 (based upon analysis of predicted targets for miR-762 using microRNA. [score:7]
Over -expression of miR-762 suppressed Rab5a mRNA expression by ∼35% although this was not statistically significant (Fig. 3 b, p > 0.05, t-Test). [score:7]
a Transfection of human corneal epithelial cells with an antagomir of miR-762 (antago-762) decreased the expression of miR-762 relative to a control (scrambled) antagomir, and b increased the expression of Rab5a mRNA, a predicted target of miR-762. [score:7]
Since both RNase7 and ST2 can protect against bacterial invasion [9], and like miR-762, are upregulated by tear fluid, these data suggest that tear induction of miR-762 helps counter over -expression of specific innate immune factors, and that other tear -induced factors antagonize or counteract miR-762 in regulating epithelial cell defenses against bacterial challenge. [score:7]
Having shown tear-antigen upregulation of miR-762, and miR-762 negative regulation of genes encoding RNase7 and ST2 without tears, we next used a miR-762 antagomir to test the relationship between tear exposure, miR-762 induction, and RNase7 and ST2 mRNA expression. [score:7]
MiR-762 and miR-1207 were both significantly upregulated; miR-92 and let-7b were both significantly downregulated. [score:7]
a Transfection of human corneal epithelial cells with a mimic of miR-762 increased the expression of miR-762 relative to a control (scrambled) mimic, b decreased Rab5a mRNA expression (although that difference was not significant), c significantly decreased mRNA expression of RNase7 and ST-2, but not that of hBD-2 or hBD-3, and d increased P. aeruginosa invasion (* p  =  0.044, t-Test). [score:7]
The results showed a selective and specific up- and down-regulation of four types of miR in tear fluid treated cells, of which miR-762 showed the greatest upregulation. [score:7]
Interestingly, Antago-762 also increased gene expression of RNase7 (by ∼80%) and ST-2 (by ∼58%) (Fig. 2 c, p < 0.05, t-Test for each), suggesting that miR-762 negatively regulates the expression of genes encoding these innate defense factors. [score:6]
In the presence of antagomir, tear fluid induced an even greater expression of RNase7 or ST2 mRNA than that found in the presence of scrambled controls (Fig. 4 b, p < 0.05, t-Test, for each comparison) confirming that miR-762 serves to negatively regulate the expression of these tear -induced innate defense genes. [score:6]
Tear fluid alone upregulated the expression of miR-762 (∼ 4-fold), which was partially reduced by the miR-762 antagomir (Fig. 4 a). [score:6]
Since miR-762 was the most profoundly upregulated microRNA by bacterial antigens in tear fluid treated cells (Fig. 1), we tested if miR-762 could influence epithelial expression of genes encoding RNase7 and/or ST-2, and/or affect bacterial internalization. [score:6]
Further studies are needed to determine the how tear fluid upregulates miR-762, the influence of microbial antigens in that regard, and if negative regulation of RNase7 and ST2 genes involves direct effects or an intermediate factor(s). [score:6]
However, miR-762 suppression of RNase7 (by ∼30%) and ST-2 (by ∼47%) mRNA expression was significant (Fig. 3 c, p < 0.05, t-Test, for each versus respective controls). [score:5]
b The antagomir of miR-762 enhanced tear -induced expression of RNase7 and ST2 mRNA compared to control (scrambled) antagomir suggesting that tear -induced miR-762 expression negatively regulates these innate defense genes. [score:5]
Corneal epithelial cells were transfected with an antagomir to miR-762 (Antago-762) for 48 h under baseline conditions, i. e. without tear fluid or bacterial antigen exposure, to reduce miR-762 expression, and in turn, affect mRNA levels of genes targeted by this microRNA. [score:5]
0057850.g001 Figure 1Upregulation of miR-762 in human corneal epithelial cells in response to human tear fluid and P. aeruginosa antigens. [score:4]
c Antago-762 also increased the expression of RNase7 and ST-2 mRNA suggesting that miR-762 negatively regulates these innate defense genes. [score:4]
Upregulation of miR-762 in human corneal epithelial cells in response to human tear fluid and P. aeruginosa antigens. [score:4]
While little is known about miR-762, it is upregulated in animal mo dels of diabetic nephropathy [34] and oral carcinoma [35]. [score:4]
org did not predict that RNase7 or ST2 would be direct targets of miR-762. [score:4]
A combination of antagomir [28] and microRNA mimic was then used to show that tear -induced miR-762 negatively regulates RNase7 and ST2 gene expression in corneal epithelial cells. [score:4]
PA  =  P. aeruginosa antigens, Media  =  High Calcium KGM-2. Eight wells of hTCEpi (grown in 96-well plates) were pooled to obtain sufficient RNA for each treatment group, b Real-time PCR confirmed a ∼3-fold upregulation of miR-762 in tear -treated epithelial cells in response to antigenic challenge (* Significant difference vs. [score:4]
Tear fluid induction of miR-762 negatively regulates RNase7 and ST2 gene expression. [score:4]
Moreover, it is very likely that miR-762 regulates the expression of numerous other genes some of which might also impact bacterial internalization. [score:4]
The reduction in tear -induced miR-762 upregulation in antagomir treated cells versus scrambled controls was significant (p < 0.05, t-Test). [score:4]
a Tear fluid induction of miR-762 expression in corneal epithelial cells was reduced by the antagomir of miR-762. [score:3]
A mimic of miR-762 reduces expression of genes encoding RNase7 and ST-2, and increases epithelial susceptibility to bacterial invasion. [score:3]
However, in the present study, reduced bacterial internalization did not occur when expression of RNase7 and ST2 was enhanced with a miR-762 antagomir. [score:3]
Therefore, we over-expressed miR-762 by transfection with a miR-762 mimic, and compared mRNA levels of target genes and bacterial internalization compared to a scrambled control. [score:3]
An Antagomir to miR-762 enhances mRNA expression of Rab5a, RNase7, and ST-2, but does not influence bacterial internalization. [score:3]
MiR-762 showed greatest upregulation in tear and bacterial antigen treated cells, which was confirmed by RT-PCR (> 3-fold, Fig. 1 b, p < 0.05, t-Test). [score:3]
Whatever is the explanation for these internalization results, the data suggest that tear-induction of miR-762 does not mediate tear suppression of bacterial internalization, and that other tear -induced corneal epithelial factors (microRNA or otherwise) are responsible for that previously reported observation [9]. [score:3]
The effect of a miR-762 mimic on gene expression in human corneal epithelial cells and on P. aeruginosa invasion. [score:3]
The effect of a miR-762 antagomir on gene expression in human corneal epithelial cells and on P. aeruginosa invasion. [score:3]
This might relate to the fact that antagonizing miR-762 also enhanced expression of Rab5a, known to be important for mammalian cell endocytosis and intracellular trafficking [38]. [score:3]
Transfection with an antagomir of miR-762 did not reduce bacterial internalization, even though the suppression of miR-762 increased RNase7 and ST-2 mRNA levels. [score:3]
Corneal epithelial cells were transfected with Antago-762 or an irrelevant antagomir (control), then exposed to cell culture media or tear fluid for 16 h and tested for the expression of endogenous miR-762. [score:3]
As expected, Antago-762 effectively reduced epithelial expression of miR-762 at 48 h by ∼50% relative to a scrambled control (Fig. 2 a, p < 0.05, t-Test). [score:3]
0057850.g003 Figure 3The effect of a miR-762 mimic on gene expression in human corneal epithelial cells and on P. aeruginosa invasion. [score:3]
0057850.g002 Figure 2The effect of a miR-762 antagomir on gene expression in human corneal epithelial cells and on P. aeruginosa invasion. [score:3]
Tear fluid induction of miR-762 negatively regulates RNase7 and ST2. [score:2]
The miR-762 mimic did not significantly affect mRNA levels of hBD-2 or hBD-3 (Fig. 3 c). [score:1]
The significance of miR-762 in influencing the pathophysiology of ocular (or other) epithelial diseases involving altered exposure to tear (or mucosal) fluid also warrants further investigation. [score:1]
For miR-762, 1 µg of total purified RNA was converted to cDNA using miScript Reverse Transcriptase Mix (Qiagen, Valencia, CA) and miR-762 level determined by real-time PCR and normalized to U6. [score:1]
The miR-762 mimic increased susceptibility to bacterial internalization by ∼3.5-fold (Fig. 3 d, p < 0.05, t-Test). [score:1]
Real-time PCR confirmed successful transfection of miR-762 after 48 h (Fig. 3 a). [score:1]
[1 to 20 of 51 sentences]
2
[+] score: 38
Table 1 Nine miRNAs selected after rescreening miRNA_miRBase-18th Fold change (3/1) Direction hsa-miR-1469 1.262138297 Upregulated hsa-miR-762 1.200592588 Upregulated hsa-miR-338-5p 2.129779884 Upregulated hsa-miR-3173-3p 1.226251386 Upregulated hsa-miR-4467 1.284049958 Upregulated hsa-miR-3940-5p 1.336691618 Upregulated hsa-miR-3195 1.376221162 Upregulated hsa-miR-3621 1.273270254 Upregulated hsa-miR-663a 1.221943009 Upregulated As miR-338-5p demonstrated the highest upregulation by ACBP-3, it was selected for validation by qRT-PCR. [score:32]
The differentially expressed miRNAs detected in two chips did not overlap, so, after multiple rescreening processes, nine miRNAs significantly upregulated by ACBP-3 (P < 0.05) were selected for further analysis: hsa-miR-1469, hsa-miR-762, hsa-miR-338-5p, hsa-miR-3173-3p, hsa-miR-4467, hsa-miR-3940-5p, hsa-miR-3195, hsa-miR-3621, and hsa-miR-663a (Table  1). [score:6]
[1 to 20 of 2 sentences]
3
[+] score: 21
The qRT-PCR results showed that three overexpressed microRNAs(miR-542-5p, miR-424, miR-30a) in hepatic differentiation was also overexpressed in osteogenic differentiation, one underexpressed microRNAs (miR-762)in hepatic differentiation was also underexpressed in osteogenic differentiation. [score:9]
Six under-expressed microRNAs that were altered at least four fold, including hsa-miR-3646, hsa-miR-17*, hsa-miR-3679-3p, hsa-miR-17, hsa-miR-155, and hsa-miR-146a, (Figure 5A) and ten under-expressed microRNAs that were highly expressed (normalized data ≥6), including hsa-miR-100, hsa-miR-10a, hsa-miR-130b, hsa-miR-146a, hsa-miR-17, hsa-miR-1973, hsa-miR-29a, hsa-miR-31, hsa-miR-31* and hsa-miR-762 (Figure 5B), were selected for further qRT-PCR analyses. [score:7]
However, the expression of other three underexpressed microRNAs including miR-17*, miR-17 and miR-762 during hepatic differentiation in L02 and HepG2 was higher than in hUC-MSCs. [score:5]
[1 to 20 of 3 sentences]
4
[+] score: 16
The other four differentially expressed miRNAs (miRNA-762, miRNA-1202, miRNA-4291 and miRNA-30a*) were not found to have the target genes anticorrelated with their expressions, indicating that they regulated the expression of target genes possibly by translational inhibition. [score:16]
[1 to 20 of 1 sentences]
5
[+] score: 11
miR-672 + + + ND miR-677 + + ND miR-700 + ND miR-707 + ND miR-762 +miR-762 was up-regulated in tumor tissue induced by DMBA [10]. [score:4]
Figure 3 The temporal expression changes of three miR-34 family members and one miR-762 family member as determined by PCR arrays and individual TaqMan assays. [score:2]
TaqMan MicroRNA Assays were used to confirm the temporal expression changes of 3 miR-34 family members, mmu-miR-34a, mmu-miR-34b-5p, and mmu-miR-34c, as well as a miR-762 family member, mmu-miR-762. [score:2]
Confirmation of the temporal expression changes of three miR-34 family miRNAs and one miR-762 family miRNA by individual TaqMan assays. [score:2]
Another miRNA, mmu-miR-762 that is not similar with miR-34 family miRNAs in sequence, were also examined to confirm the array data. [score:1]
[1 to 20 of 5 sentences]
6
[+] score: 10
Mechanistically, FOXP2 translation appears to be actively impaired by two successive waves of dysregulated micro -RNAs: initial MSCs (mesenchymal stem cells) -induced expression of a cluster of microRNAs (miR-199a-214, miR-762) led the activation of a secondary network of microRNAs (miR-1915, let-7b, and miR-34a) which subsequently repressed the expression of FOXP2 [9]. [score:8]
Second, TWIST activates two waves of miRs: the 199a-214 cluster and a set of four other microRNAs (miR-762, miR-1915, let-7b, and miR-34a). [score:1]
These miRs are encoded by loci which are either intragenic (miR-1915 within CASC10 intron) or extragenic (let7b; miR-34A; miR-762 colocalized with BCL7C intron on the reverse strand; miR-199A2 and miR-214 are both colocalized with DNM3OS and miR-199A1 on reverse strand from DNM2). [score:1]
[1 to 20 of 3 sentences]
7
[+] score: 7
hsa-miR-197-5p (MIMAT0022691) CGGGUAGAGAGGGCAGUGGGAGG 2102555 hsa-miR-33b-3p (MIMAT0004811) CAGUGCCUCGGCAGUGCAGCCC 204462 hsa-miR-3960 (MIMAT0019337) GGCGGCGGCGGAGGCGGGGG 2100264 hsa-miR-4443 (MIMAT0018961) UUGGAGGCGUGGGUUUU 2104824 hsa-miR-4455 (MIMAT0018977) AGGGUGUGUGUGUUUUU 2105370 hsa-miR-4515 (MIMAT0019052) AGGACUGGACUCCCGGCAGCCC 2118009 hsa-miR-762 (MIMAT0010313) GGGGCUGGGGCCGGGGCCGAGC 2114944 hsa-miR-940 (MIMAT0004983) AAGGCAGGGCCCCCGCUCCCC 204094 hsa-miR-4530 (MIMAT0019069) CCCAGCAGGACGGGAGCG 2105012 hsa-miR-486-5p (MIMAT0002177) UCCUGUACUGAGCUGCCCCGAG 204001 hsa-miR-630 (MIMAT0003299) AGUAUUCUGUACCAGGGAAGGU 204392 cel-miR-39 (MIMAT0000010) UCACCGGGUGUAAAUCAGCUUG 203952 Using an miRWalk 1.0 online tool, target genes of differentially expressed miRNAs were further co-predicted with miRWalk, Targetscan, miRanda, PICTAR2, and DIANAmT software programs. [score:7]
[1 to 20 of 1 sentences]
8
[+] score: 7
Other miRNAs from this paper: mmu-mir-762, mmu-mir-1962
Since a miRNA of vascular importance would be expected to be reasonably expressed in most if not all tissues, these reports of very low expression in highly restricted tissue cDNAs, compared to other miRNAs, argue against the importance of mir-762 in Canq1. [score:4]
In-situ hybridization of mir-762 was insufficient to permit structural assignment in the E14.5 mouse transcriptone atlas (http://www. [score:1]
org/ database lists only 3 deep-sequencing reads for miR-762 (1 in testes, 2 in brain). [score:1]
The UCSC database identifies mir-762 at 134.85 and mir-1962 at the extreme 3′ position (142.8 Mb) of Canq1. [score:1]
[1 to 20 of 4 sentences]
9
[+] score: 5
The sequences of targeting motifs used to build the miRNA -inhibitor vectors are listed below: (1) aaagtgccgccatcttttgagt for miR-371b-5p, (2) gcacagcccccgtccctccct for miR-149, (3) cgccgccccgcacctgct for miR-3665, (4) cagagcccgccccaacccac for miR-3940-5p, (5) cccccgcctccgccgccgcc for miR-3960, (6) gcctgccccctccaacagcca for miR-4687-3p, (7) gcggtcccgcggcgccccgcct for miR-663, and (8) gctcggccccggccccagcccc for miR-762. [score:5]
[1 to 20 of 1 sentences]
10
[+] score: 5
Although eight miRNAs (hsa-miR-762, hsa-miR-93-5p, hsa-miR-20a-5p, hsa-miR-3192-5p, hsa-miR-1294, hsa-miR-1972, hsa-miR-106b-5p and hsa-miR-526b-3p) were predicted by all 5 databases, we found that only one gene (TCF3) has a miRNA-target interaction. [score:3]
Whereas among the eight candidate targets of microRNAs, hsa-miR-762 was previously reported to be associated with Pseudomonas aeruginosa infection [8], we did not find any prior investigations with the remaining seven in silico predicted miRNAs and infection. [score:1]
In addition, we found that hsa-miR-762 was associated with pathogen infection [8]. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 5
Considering absolute values of log fold change larger than 1, seven miRNAs (mmu-miR-2137, mmu-miR-204-5p, mmu-miR-762, mmu-miR-146b-5p, mmu-miR-711, mmu-miR-222-3p, mmu-miR-25-5p) were differently expressed after 7 days, while two miRNAs (mmu-miR-3473b, mmu-miR-204-5p) were differently expressed after 3 days of osteogenic differentiation versus basal conditions at the same time points (Supplementary Table 1). [score:5]
[1 to 20 of 1 sentences]
12
[+] score: 5
C and D: Radiation induced increase in miRNA-200b and miRNA-762 (p-values, miRNA-200b:1 Gy- 0.7172, 2 Gy-0.4193, 4 Gy- 0.4231, 6 Gy- 0.0421, 8 Gy- 0.0296; miRNA-762∶1 Gy- 0.4061, 2 Gy- 0.1675, 4 Gy- 0.0324, 6 Gy- 0.3139, 8 Gy- 0.001). [score:1]
C and D: Radiation induced increases in miRNA-200b (p-values 4 Gy- 0.014, 8 Gy- 0.0047, 12 Gy 0.0027) and miRNA-762. [score:1]
However, a decrease in miRNA-762 was observed at 72 hours. [score:1]
Consistent with the response to single acute dose, markers such as miRNA-762 and miRNA-200b exhibited an increase in their serum levels under conditions of fractionated radiation up to 48 hrs. [score:1]
Molecules that exhibited an increase in their serum levels after radiation exposure include miRNA-200b and miRNA-762, and these changes were more pronounced in animals that received higher doses (Figure 5C, 5D). [score:1]
[1 to 20 of 5 sentences]
13
[+] score: 5
It is not known if miR-762 directly regulates RNase 7 expression, but the authors of this study argued this was unlikely based on comparison of the miR-762 seed region and RNASE7 mRNA [31]. [score:5]
[1 to 20 of 1 sentences]
14
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
8 NA miR-673 ↑2.1 NA miR-692 ↑2.1 NA miR-762 ↑2.2Proliferation [94] miR-767 ↓2.3DNA methylation [95]miR-804 [§] ↓2.0Proliferation, Ras inhibition, Intercellular adhesion (Cx43) [6] miR-879 ↑2.2 NA miR-1193 ↑2.1 NA miR-3080 ↑3.5 ↓2.9 NA The numbers indicate the ratio of miRNA expression (fold-variation) between mice bearing either microadenomas and/or adenomas and lesions-free mice NA, not available. [score:5]
[1 to 20 of 1 sentences]
15
[+] score: 4
The results showed that the top six miRNAs were hsa-miR-4763-3p, hsa-miR-149-3p, hsa-miR-762, hsa-miR-5001-5p, hsa-miR-5787, and hsa-miR-6791-5p, while the top six target genes were CPLX2, ZNF385A, NFIX, CNIH2, SOX12, and WDTC1 (Figures 8 and 9). [score:3]
As shown in Figures 8 and 9 and Table 1, the top rated six miRNAs from the two analyses were the same, including hsa-miR-4763-3p, hsa-miR-149-3p, hsa-miR-762, hsa-miR-5001-5p, hsa-miR-5787, and hsa-miR-6791-5p. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 3
We performed GO analysis and KEGG pathway analysis on the differentially expressed miRNAs, and the results are shown in Supplementary Figure 1. Ultimately, fifteen potential miRNAs associated with the proliferation of osteosarcoma were selected for microarray validation by quantitative real-time RT-PCR analysis, including miR-1237, miR-550a-5p, miR-365b-5p, miR-135a-3p, miR-933, miR-762, miR-629-3p, miR-542-5p, miR-503, miR-301b, miR-210, miR-374a-5p, miR-199a-5p, miR-199a-3p and miR-195-5p. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
Foxo3P and circ-Foxo3 were highly expressed in noncancerous cells and could function as miRNA sponges for several cancer -associated miRNAs, including miR-22, miR-136, miR-138, miR-149, miR-433, miR-762, miR-3614-5p, and miR-3622b-5p. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
Similarly, the expression of only two miRNAs from the mouse species, mmu-miR-705 and mmu-miR-762, was elevated. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
Eleven miRNAs (miRNA-4530, miRNA-4739, miRNA-762, miRNA-4787-5p, miRNA-940, miRNA-3676-5p, miRNA-6090, miRNA-150-5p, miRNA-4516, miRNA-4284, miRNA-3656) demonstrated a similar expression trend in both the acute and chronic groups. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 2
The start binding positions 304 of hsa-miR-762 and 308 of hsa-miR-3677 were highly conserved among more than five hundred NS1 genes in type 2 while positions 765 of hsa-miR-637 and 773 of hsa-miR-3663-5p were highly conserved among almost three hundred NS1 sequences in dengue type 3. More than two hundred nucleoprotein (NP) genes of rabies virus were predicted with highly conserved start binding positions 122 of hsa-miR-939, 359 of hsa-miR-770-5p, and 820 of hsa-miR-2277-3p and hsa-miR-638. [score:1]
The start binding positions 304 of hsa-miR-762 and 308 of hsa-miR-3677 were highly conserved among more than five hundred NS1 genes in type 2 while positions 765 of hsa-miR-637 and 773 of hsa-miR-3663-5p were highly conserved among almost three hundred NS1 sequences in dengue type 3. More than two hundred nucleoprotein (NP) genes of rabies virus were predicted with highly conserved start binding positions 122 of hsa-miR-939, 359 of hsa-miR-770-5p, and 820 of hsa-miR-2277-3p and hsa-miR-638. [score:1]
[1 to 20 of 2 sentences]
21
[+] score: 1
Circ-Foxo3, originated from one of the forkhead family of transcription factors Foxo3, could both act as miRNA sponges for miR-136, miR-138, miR-433, miR-762, miR-3614-5p and influencing their function [50]. [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
This includes miR-221-5p, miR-762, miR-30b, miR-30c, miR-30d, miR-185, miR-151-5p, miR-130b and miR-149* (Supplementary Table S1). [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
Some miRNAs such as miR-937, miR-1303, miR-1908, miR-1915, miR-762 and miR-379 had only been experimentally validated in previous studies [12] by next-generation sequencing experiments (NGS), while other miRNAs were validated by alternative methods (Table S4). [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
Yang et al. found that the two RNAs can both act as miRNA sponges for miR-22, miR-136*, miR-138, miR-149*, miR-433, miR-762, miR-3614-5p, and miR-3622b-5p, influencing their function by binding to them. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
In addition to this, 25 binding sites were detected in circ-Foxo3 for eight miRs, including miR-22, miR-136, miR-138, miR-149, miR-433, miR-762, miR-3614-5p, and miR-3622b-5p [21]. [score:1]
[1 to 20 of 1 sentences]