sort by

14 publications mentioning mmu-mir-711

Open access articles that are associated with the species Mus musculus and mention the gene name mir-711. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 211
Other miRNAs from this paper: hsa-mir-711
In inflamed C2C12 myotubes, overexpression of miR-711 downregulated IL-1β mRNA levels, while miR-711 silencing upregulated these levels. [score:9]
Overexpression of miR-711 downregulated the expression of these 5 genes (Fig. 5A). [score:8]
In skeletal muscle, ApN clearly upregulates miR-711, which in turn downregulates several components of the TLR4 pathway (and possibly of other pathways). [score:7]
As in mouse, ApN is able to upregulate by 50% the expression of human miR-711 (hsa-miR-711) (Fig. 8). [score:6]
As expected, blockade of miR-711 induced an opposite effect to the mimic and up-regulated the expression of all the 5 genes (Fig. 5B). [score:6]
When compared to WT controls, transgenic mice overexpressing adiponectin (ApN-Overex mice) displayed a ~47% increase of miR-711 expression, while ApN- KO mice presented a reverse pattern with a ~60% decrease of expression (Fig. 3A). [score:6]
Given the description of these target genes, we then hypothesized that miR-711 directly reduced the transcriptional activity of NF-κB, thereby repressing the expression of pro-inflammatory cytokines. [score:6]
The attenuation of TNFα could be ascribed to either NF-κB inhibition or direct suppression by the miR-711, as seen above. [score:6]
In order to get more insight into the role of miR-711, we identified its predicted target genes and focused on those belonging to the TLR4 signaling pathway as mice were challenged by LPS and the innate immune system plays a crucial pathogenic role in inflammatory muscle disease. [score:5]
Involvement of target genes of miR-711 in the TLR4 pathway in vitroTarget genes of miR-711, belonging to the TLR4 pathway, were then further validated in vitro. [score:5]
Only the expression of miR-711 was significantly modified by ApN gene electrotransfer and showed a ~50% upregulation, when compared to the empty plasmid electrotransfer (Fig. 2B). [score:5]
Thus, ApN- KO mice showed decreased muscular expression of miR-711 together with enhanced inflammation and oxidative stress markers, while mice overexpressing ApN showed increased miR-711 levels (Fig. 3). [score:5]
Only 5 out of the 8 predicted target genes turned out to be targets of miR-711 and are illustrated in Fig. 4: TOLLIP, FADD, TAB1, PI3Kδ and TNFα. [score:5]
Except for TNFα, the predicted target genes of hsa-miR-711, identified by HumanTargetScan algorithm, were similar to those described in mice. [score:5]
Potential miR-711 target genes were predicted using TargetScan algorithms (version 6.2, http://www. [score:5]
In order to get some insights into the potential role of miR-711, we identified its predicted target genes using TargetScan algorithm. [score:5]
ApN treatment also upregulated miR-711 in these cells by ~3- (with LPS) to ~8-fold (without LPS) (Fig. 3B). [score:4]
Our data may be extended to humans because of the high similarity of miR-711 between human and rodent species and because ApN also upregulated miR-711 levels in human primary myotubes. [score:4]
In conclusion, we have identified miR-711 as a microRNA upregulated by ApN in skeletal muscle. [score:4]
MiR-711 expression in mice overexpressing ApN and in murine myotubes treated by the hormone. [score:4]
Electrotransfer of the ApN gene in muscle of ApN- KO mice upregulated miR-711 while reducing inflammation and oxidative stress. [score:4]
Adiponectin enhances miR-711 expression in human myotubes in vitro Finally, we tested the direct effect of ApN in primary cultures of human myotubes. [score:4]
We thus found that the 4 genes regulated by miR-711 in mouse were also on the list of potential target genes for human TLR4 signaling. [score:4]
We have previously shown that ApN exerts its beneficial effects on muscle via a signaling pathway involving AMPK (5′ adenosine monophosphate-activated protein kinase), a deacetylase Sirtuin (SIRT) 1, and the peroxisome proliferator-activated receptor-γ (PPARγ) coactivator-1α (PGC-1α) 8. The exact mechanisms by which ApN upregulates miR-711 are still unsettled. [score:4]
Thus, both ApN and miR-711 mimic inhibited NF-κB activity, whereas blockade of miR-711 induced an opposite effect and further abolished the beneficial effect of ApN (Fig. 6B). [score:3]
To this end, we used a gain- or loss-of function approach in LPS-inflamed C2C12 myotubes transfected with miR-711 mimic or inhibitor (anti-miR), while being treated or not by ApN. [score:3]
Adiponectin enhances miR-711 expression in human myotubes in vitro. [score:3]
In these conditions, NF-κB activity displayed responses to miR-711 and to ApN roughly similar to those of IL-1β and the predicted target genes. [score:3]
Target genes of miR-711, belonging to the TLR4 pathway, were then further validated in vitro. [score:3]
Localisation of target genes of miR-711 in the TLR4 signaling pathway. [score:3]
Differentiated myotubes were treated or not with 5 μg/ml ApN for 24 h. Expression of human miR-711 was quantified by RT-qPCR. [score:3]
Effects of adiponectin on miR-711 expression on human myotubes. [score:3]
Involvement of target genes of miR-711 in the TLR4 pathway in vitro. [score:3]
In silico functional analysis of potential miR-711 target genes. [score:3]
In silico functional profiling of miR-711 target genes. [score:3]
Transfection of miR-711 mimic or inhibitor in C2C12 cells. [score:3]
Five target genes of miR-711, which were predicted by computational analysis were then validated in vitro: TOLLIP, FADD, PI3Kδ, TAB1, and TNFα (Fig. 4). [score:3]
The expression of miRNA-711 seems therefore to be dependent on the presence of ApN. [score:3]
TNFα is also one of the 5 target genes repressed by miR-711 mimic. [score:3]
We found that both ApN and miR-711 mimic actually inhibited NF-κB activity. [score:3]
The Supplementary Fig. 1. shows predicted base complementarities of miR-711 to the TLR4 target genes: only genes, which were next validated in vitro (see below) are represented. [score:3]
The influence of ApN and that of LPS on miR-711 expression were assessed by two-way ANOVA with F test, followed by post-hoc two by two comparisons with Bonferroni correction for multiple comparisons (Prism 6). [score:3]
Synthetic double-stranded oligonucleotide mimicking mature endogenous miR-711 (miR-711 mimic, 5 nM), miR -mimic negative control (AllStars Negative Control, ctrl+, 5 nM), Anti-miR-711 single-stranded oligonucleotide (Anti-miR, 50 nM) or Anti-miR negative control (miScript Inhibitor Negative Control, ctrl-, 50 nM) (all from Qiagen) were delivered into mature myotubes (day 5). [score:3]
Eventually, miR-711 overexpression recapitulated the anti-inflammatory effects of ApN both in vitro and in vivo, while miR-711 blockade had opposite effects. [score:3]
Only the 5 genes that turned out to be regulated by miR-711 are shown. [score:2]
One tibialis anterior muscle was injected and electroporated with a plasmid coding for the ApN gene (p-ApN) or for the pre-miR-711 (p-miR-711), while the contralateral one received its respective control plasmid (p-ctrl). [score:1]
In vivo experiments using muscle electrotransfer of pre-miR-711 recapitulated the anti-inflammatory effects observed in vitro. [score:1]
Moreover, miR-711 mimic showed anti-inflammatory effects similar to those of ApN. [score:1]
Genomic location of miR-711. [score:1]
Cells were challenged by LPS and transfected with miR-711 mimic or anti-miR-711 and their respective controls (ctrl+ and−) (first 2 pairs of columns) and treated or not with ApN (last two pairs of columns). [score:1]
Furthermore, ApN pretreatment attenuated LPS -induced stimulation of all these mRNAs, whereas anti-miR-711 reversed this preventive effect (Fig. 5C,D). [score:1]
In vivo effects of pre-miR-711 electrotransfer on different markers of inflammation and oxidative stress in muscles of ApN- KO mice. [score:1]
However, according to UCSC Genome database (see methods), the miR-711 precursor is located across exon-intron junction of the collagen type VII alpha 1 (COL7A1) gene and is therefore likely to use the transcriptional machinery of the host gene. [score:1]
By screening arrays, we found miR-711 as a strong candidate for mediating the anti-inflammatory action of ApN. [score:1]
Taken together, our data indicate that miR-711 mediates ApN action on muscle. [score:1]
The plasmid containing the precursor miRNA for Mus musculus miR-711 stem-loop with Enhanced Green Fluorescent Protein (EGFP) reporter gene (p-miR-711) as well as its negative control were purchased (GeneCopoeia, Rockville, USA). [score:1]
One tibialis anterior muscle of ApN- KO mice was injected and electroporated with pre-miR-711-containing plasmid (p-miR-711), whereas the contralateral muscle was injected and electroporated with a control plasmid (p-ctrl). [score:1]
This suggests that hsa-miR-711 may be also involved in the anti-inflammatory effects of ApN in human skeletal muscle. [score:1]
Out of these, only miR-711 was found to be significantly modified by ApN electrotransfer. [score:1]
Conversely, miR-711 blockade induced opposite effects and abolished the anti-inflammatory action of ApN in vitro. [score:1]
So far, there are only very few reports about the role of miR-711. [score:1]
To this end, one tibialis anterior muscle was injected with a pre-miR-711 plasmid (p-miR-711) and the contralateral muscle with an empty control plasmid (p-ctrl); muscles were then electroporated. [score:1]
Moreover, cardiac ischemic preconditioning in mice, which provides cardioprotection against a subsequent ischemia/reperfusion injury, resulted in modulation of miR-711 levels, in a NF-кB -dependent manner 25. [score:1]
Muscular electrotransfer of ApN gene or pre-miR-711 into muscle. [score:1]
We next studied whether miR-711 was also effective in vivo. [score:1]
C2C12 myotubes were either transfected with miR-711 mimic or its control (ctrl+) (A) or treated with ApN (C) for 24 h. Cells were also transfected with anti-miR-711 or its relative control (ctrl−) for 28 h (B), while ApN was added or not during the last 24 h (D). [score:1]
MiR-711 as an anti-inflammatory agent of muscle inflammation in vivoWe next studied whether miR-711 was also effective in vivo. [score:1]
This could link ApN to PGC-1α/AP-1 and ultimately to miR-711. [score:1]
[1 to 20 of 68 sentences]
2
[+] score: 164
Other miRNAs from this paper: hsa-mir-711
Although Nlrp3 is not a target gene of miR-711, miR-711 indirectly represses NLRP3 through two mechanisms: (1) by inhibiting NF-κb (see Fig. 1), which is involved in NLRP3 priming as shown in macrophages [22, 23], and (2) by inhibiting its target gene FADD ([11] and this paper), which is also known to promote priming and activation of NLRP3 ([12] and our own data). [score:10]
When compared to NLRP3, miR-711 levels exhibited a reverse pattern of expression: a downregulation in mdx mice, in line with the decrease in circulating ApN, while an upregulation was observed in mdx-ApN animals. [score:8]
Like the miR-711 mimic, ApN downregulated gene expression of NLRP3 (columns 5 vs 3), an inhibition which was reversed by miR-711 silencing (last pair of columns). [score:8]
Changes of TNFα were rather similar to those of NLRP3: downregulation by miR-711 and ApN, upregulation by miR-711 blockade and attenuation of ApN anti-inflammatory effect by this blockade (Fig. 10b). [score:7]
We find that NLRP3 is expressed in skeletal muscle and show that ApN downregulates NLRP3 via its anti-inflammatory mediator, miR-711. [score:6]
Thus, ApN downregulates NLRP3 expression likely via miR-711 in dystrophic mice. [score:6]
Since ApN exerts anti-inflammatory effects on muscle via miR-711 and because miR-711 inhibits target genes that could lead to the inflammasome pathway [11], we explored whether NLRP3 could be regulated by ApN and its miRNA mediator in muscle. [score:6]
Overexpression of miR-711 downregulated NLRP3 mRNAs (compare the first pair of columns; Fig. 10b), while the anti-miR tended to induce an opposite effect (second pair of columns; Fig. 10b). [score:6]
Both ApN and miR-711 mimic actually inhibited NLRP3 expression in C2C12 myocytes, while miR-711 blockade had opposite effects and reversed the anti-inflammatory action of ApN. [score:5]
Interestingly, gene expression of miR-711, the mediator of ApN, was strongly decreased in mdx mice, while it was increased in mdx mice overexpressing ApN (Fig. 5c). [score:5]
miR-711 levels showed a reverse pattern of expression: a 40% decrease in DMD myotubes compared to control ones, while ApN treatment upregulated these levels, thereby leading to their normalization in DMD (Fig. 10a). [score:5]
Taken together, our data indicate that miR-711 mediates the ApN -induced inhibition of NLRP3 expression and thus NLRP3 transcriptional priming. [score:5]
Taken together, these data suggest that NLRP3 is implicated in muscle inflammation and is downregulated by ApN through miR-711. [score:4]
NLRP3 is present in skeletal myofibres, where it is downregulated by ApN and its anti-inflammatory mediator, miR-711. [score:4]
NLRP3 expression is regulated by ApN and miR-711 as well as by FADD in murine myotubes. [score:4]
Thus, ApN upregulated miR-711 in muscle, which in turn repressed genes belonging to inflammation/immunity signalling cascades [11] (these genes are indicated in bold in Fig. 1). [score:4]
a Differentiated myotubes were treated or not with 5 μg/ml ApN for 24 h. Gene expression of human NLRP3 and miR-711 was next quantified, normalized to TATA-box -binding protein (TBP), and the subsequent ratios were presented as relative expression compared to control conditions. [score:4]
Muscle electrotransfer of either ApN complementary DNA (cDNA) or pre-miR-711 prevents LPS upregulation of NLRP3 in mice. [score:4]
Eventually, as in C2C12 cells, we confirmed that TOLLIP and FADD were also two target genes of miR-711 in both human C and DMD cells (Additional file 2: Figure S2) and could thus be early steps leading to activation of the inflammasome complex. [score:3]
Fig. 5Effects of long-term ApN overexpression on NLRP3 and miR-711 levels in muscles of dystrophic mice. [score:3]
Both ApN treatment and miR-711 transfection reversed this stimulation of Nlrp3 expression (first two pairs of histograms: compare grey/black vs white column). [score:3]
This overexpression was attenuated by ApN or miR-711 mimic treatments. [score:3]
Transfection of miR-711 mimic, miR-711 inhibitor or FADD siRNA in C2C12 cells and/or human myotubes. [score:3]
Conversely, miR-711 silencing further augmented Nlrp3 expression (histograms, 3rd pair of columns). [score:3]
Synthetic double-stranded oligonucleotide mimicking mature endogenous mouse or human miR-711 (miR-711 mimic, 5 nM), miR -mimic negative control (AllStars Negative Control, ctrl+, 5 nM), Anti-miR-711 mouse or human single-stranded oligonucleotide (Anti-miR, 50 nM) or Anti-miR negative control (miScript Inhibitor Negative Control, Ctrl–, 50 nM) (all from Qiagen) were delivered into respective species of mature myotubes. [score:3]
Fig. 3Effects of ApN, miR-711 (a) and FADD (b) on NLRP3 expression in vitro. [score:3]
The target genes of miR-711 are indicated in bold and outlined in black. [score:3]
Reduced ApN production may in turn explain the lower expression of miR-711 [11]. [score:3]
In the muscle injected with the target plasmid, the expression of miR-711, which was measured by reverse transcription polymerase chain reaction (RT-PCR), was about four orders of magnitude higher than in the control muscle. [score:3]
FADD and TOLLIP are target genes of miR-711 in human DMD and C myotubes. [score:3]
Fas -associated protein with death domain (FADD) is indeed one of the target genes of miR-711, and this protein serves as an apical mediator of both priming and activation of NLRP3 inflammasome through the activation of caspase-8 [12, 13]. [score:3]
The aims of this work were first to study whether NLRP3 was present in skeletal muscle, more specifically within myofibres, and second to test whether it was regulated by ApN through the miR-711. [score:2]
MiR-711 levels exhibited a reverse pattern of expression. [score:2]
Adiponectin miR-711 NLRP3 inflammasome Skeletal muscle Inflammation Duchenne muscular dystrophy Chronic muscle inflammation may be present as either a low-grade or a severe form. [score:1]
Fig. 1Inflammation/immune signalling pathways repressed by miR-711 in muscle. [score:1]
Briefly, one tibialis anterior muscle was injected with a plasmid containing the ApN sequence (p-ApN) or the pre-miR-711 (p-miR-711), while the contralateral one received an empty plasmid; the muscles were then electroporated. [score:1]
One tibialis anterior muscle was injected with 30 μl of a plasmid solution (1.5 μg/μl) coding for the ApN gene (p-ApN) or for the pre-miR-711 (p-miR-711), while the contralateral one received its respective control plasmid (p-ctrl). [score:1]
b, c Differentiated myotubes from C or DMD subjects were challenged by an inflammatory stimulus (a combination of TNFα and interferon gamma (IFNγ)), then transfected or not with miR-711 mimic or anti-miR-711 (or their respective controls: Ctrl+ or Ctrl–), while being treated or not by ApN. [score:1]
a C2C12 myotubes were either treated or not with ApN or transfected with miR-711 mimic or its control (Ctrl+) for 24 h. Cells were also transfected with anti-miR-711 or its relative control (Ctrl–) for 28 h, while ApN was added during the last 24 h. All conditions presented herein were obtained in C2C12 challenged by LPS except for the basal condition (no LPS, no transfection or any other treatments) represented by the dotted line. [score:1]
Values are means ± SEM for five to six independent cultures (i. e. run at different times and, for each time, from a new vial of cryopreserved myoblasts) from five (NLRP3) or three (miR-711) different subjects in each C and DMD group. [score:1]
Fig. 4Effects of ApN cDNA and pre-miR-711 electrotransfer on NLRP3 in skeletal muscles of ApN- KO mice. [score:1]
These cells were then transfected with miR-711 mimic or anti-miR-711 (and their respective controls: Ctrl+ and –) and treated or not with ApN. [score:1]
Muscular electrotransfer of ApN gene or pre-miR-711 into muscle. [score:1]
To this end, we took advantage of our previous mo del, in which local administration of ApN or miR-711 was able to protect muscles of ApN- KO mice against LPS -induced inflammation [11]. [score:1]
These results suggest that NLRP3, which is inversely related to miR-711 and ApN, could be involved in the pathogenesis of DMD. [score:1]
The plasmid containing the precursor miRNA for Mus musculus miR-711 stem-loop with enhanced green fluorescent protein (EGFP) reporter gene (p-miR-711) as well as its negative control were purchased (GeneCopoeia, Rockville, MD, USA). [score:1]
One tibialis anterior muscle of ApN- KO mice was injected and electroporated with ApN cDNA-containing plasmid (p-ApN) or with pre-miR-711-containing plasmid (p-miR-711), whereas the contralateral muscle was injected and electroporated with the respective control plasmid (p-ctrl). [score:1]
Taken together, our data suggest that NLRP3 and ApN via miR-711 play an important role in pathogenesis of human DMD muscle. [score:1]
Qualitatively similar results were obtained in vivo by using muscle electrotransfer of ApN cDNA or pre-miR-711. [score:1]
These data indicate that in inflamed muscle NLRP3 is attenuated by ApN or miR-711 in vivo. [score:1]
We have also recently shown that the anti-inflammatory action of ApN on skeletal muscle was at least in part mediated by a micro RNA (miRNA), miR-711. [score:1]
ApN- KO mice were submitted to muscle electrotransfer of the ApN gene or the pre-miR-711. [score:1]
Muscle electrotransfer of the ApN gene or pre-miR-711 reduced NLRP3 staining by ~ 25–30% (Fig. 4a, b). [score:1]
[1 to 20 of 53 sentences]
3
[+] score: 85
As shown in Figure 3, the expressions of miR-711, miR-714, miR-744, miR -2137, miR -5130, miR -346, and miR -328 was still upregulated in the I/R group, but the expression of miR-24 and miR-490 were downregulated, compared to the control group grafts. [score:10]
The expressions of miR-711, miR-714, miR-744, miR-2137, miR-5130, miR-1892, miR-328, miR-346, miR-5099, and miR-705 were significantly upregulated in I/R injured heart grafts, while miR-490, miR-491, miR-210, miR-362, miR-24, miR-423, miR-128, miR-328, miR -181, and miR-532 were downregulated. [score:9]
The findings of our study demonstrate that miR-711, miR-2137 miR-705, miR-5130, miR-346, miR-714, and miR-744 were significantly upregulated (>2 fold change) in I/R injured hearts, while miR-210, miR-490, miR-491, miR-425, miR-423-3p, and miR-532-3p were downregulated. [score:7]
Compared with grafts taken out on day 2 post-transplantation, the expression of miR-2137, miR-714, miR-744, miR -2137, miR -5130, miR -346, and miR -328 were slightly decreased, whilst the expression of miR-711 continued its upregulation in the I/R injured grafts. [score:7]
As compared with cells under normxia, miR-711, miR-714, miR-328, miR-346, miR-210, miR-744, miR-5130, miR-181a and miR-2137 were significantly over-expressed in hypoxia/reperfusion treated cardiomyocytes, while the expression of miR-491, miR-211, miR-532, miR-185, miR-425, miR-128, miR-24 was down-regulated (Figure 4B). [score:7]
A more recent study reported that Pioglitazone (an insulin sensitizing drug with cardio protective effect, it attenuates cardiac fibrosis) increased miR-711 levels in myocardial infarction rats and miR-711 directly targeted and downregulated SP1, leading to reduced collagen-I levels [44]. [score:7]
Our data also showed that ANG1 was significantly downregulated in I/R injured hearts and hypoxia -treated cardiomyocytes, suggesting ANG1 might be a target of miR-711. [score:6]
Despite only a few studies of miR-711 have been reported, available data have shown that miR-711 is expressed in many types of cells [36], [37], [38] and is upregulated under different stresses [39], [40]. [score:6]
Predicted by TargetScan and FINDTAR3, Angiopoietin 1 (ANG1) is a putative target of miR-711. [score:5]
In this study, we observed that miR-711 was significantly up-regulated both in I/R injured heart grafts and hypoxia/reperfusion treated primary cardiomyocytes. [score:4]
Supportively, Lee et al [45] demonstrated that ANG1 can exert cardio protective effects by preventing vascular leakage and cardiomyocyte death by inhibiting activities of Caspase 3 and Caspase 9. Further study on miR-711 function will help us understand the regulatory roles of miR-711. [score:4]
A study has also shown that miR-711 was significantly upregulated in the myocardium with acute myocardial infarction on day 14 post ischemia [42]. [score:4]
We extracted grafts with I/R and with non-I/R at day 7 after transplantation and detected the expression level of miRNAs (miR-711, miR -714, miR-744, miR -2137, miR -5130, miR -346, miR -490, miR -491, miR -24, and miR -328). [score:3]
For example, a chemical palmitate used to induce insulin resistance increases the expression of miR-711 in mouse muscle C2C12 cells [41]. [score:3]
Tranter et al reported shows that cardiac ischemic preconditioning (IPC) of the in vivo mouse heart results in decreased levels of miR-711 which was dependent on NF-kB, and that miR-711 post-transcriptionally suppresses Hsp70.3 [43]. [score:3]
[1 to 20 of 15 sentences]
4
[+] score: 48
For M2-skewed activation, the down-regulation of miRNAs is critical in ‘releasing’ primary microglia from their M0 state, through down regulation of miR-711 and miR-124, and up-regulation of miR-145 may facilitate establishing the M2a-alternatively activated state. [score:8]
Further, our second IPA analysis identified that down-regulation of miR-711 or miR-124 may play a key role in ‘releasing’ microglia from the M0 state, and up-regulation of miR-145 may contribute to establishment of the M2a state. [score:7]
Interestingly, down-regulation of miR-711 or mir-124 are as significant as up-regulation of either miR-145 or miR-449a in establishing the M2a phenotype based on –log(p-value) score (Fig 4D and Table S5). [score:7]
Using the same screening criteria as described above, we performed the second IPA enrichment analysis on four up-regulated miRNAs upon IL-4 stimulation: miR-145, -214, -297b-5p, and -449a and nine are down-regulated miRNAs: miR-711, -124, -2133, -2135, -2132, -2861, - 2138, -762, and -1224. [score:7]
As observed with in M1, down-regulation in miR-124 and miR-711 appears to be important for release from the M0-phenotype and transition to the M2 status. [score:4]
Further, we also have identified significant down-regulation of miR-689 and miR-711 in the M1 or M2a skewed primary microglia, respectively. [score:4]
miR-711 potentially regulates targets associated with a number of pro-inflammatory pathways including AP1, IRF1/2, NF-κB1-RelA, SP3, Krupple-like factor-2 (KLF2) and PPARγ. [score:4]
Specifically, during M2a-skewing down-regulation of miR-711 and miR-124 may work in coordination to release microglia from the resting state. [score:4]
At the M0 state (top), resting microglia function in a surveillance and detection mode, which appears to be regulated by various nuclear receptor pathways and select miRNAs: miR-124, miR-689 and miR-711. [score:2]
miR-711 appears to alter the transcriptional networks of many canonical pro-inflammatory pathways including NF-κB-RelA, IRF1/2, SP1, IκB, and AP1 (Fig 4D and Table S5). [score:1]
[1 to 20 of 10 sentences]
5
[+] score: 14
Among them, mmu-miR-874-5p showed the greatest increase of the up-regulated miRNAs and those of mmu-miR-673-3p, mmu-miR-5112, mmu-miR-711, and mmu-miR-542-3p showed the greatest decrease of the down-regulated miRNAs (Figure  2). [score:7]
Among them, seven miRNAs including three that were down-regulated (mmu-miR-708-5p, mmu-miR-92a-2-5p, and mmu-miR-711) and four that were up-regulated (mmu-miR-714, mmu-miR-134-5p, mmu-let-7a-2-3p, and mmu-miR-27a-5p) were predicted to be involved in cellular response to stimulus. [score:7]
[1 to 20 of 2 sentences]
6
[+] score: 11
By contrast, of the eight upregulated miRNAs in DIO mice, only one (mmu-miR-711) was significantly downregulated in DIO + LFD mice. [score:7]
Furthermore, in this study, eight miRNAs (mmu-miR-711, mmu-miR-712, mmu-miR-713, mmu-miR-714, mmu-miR-715, mmu-miR-716, mmu-miR-717, and mmu-miR-574) were upregulated in DIO mice. [score:4]
[1 to 20 of 2 sentences]
7
[+] score: 7
The ten most up-regulated miRNAs included mmu-miR-205-5p, mmu-miR-222-3p, mmu-miR-205-3p, mmu-miR-146b-5p, mmu-miR-21-5p, mmu-miR-21-3p, mmu-miR-221-3p, mmu-miR-140-3p, mmu-miR-142-5p, and mmu-miR-140-5p and the ten most down-regulated miRNAs comprised mmu-miR-211-5p, mmu-miR-3096-5p, mmu-miR-711, mmu-miR-466h-5p, mmu-miR-130b-3p, mmu-miR-3082-5p, mmu-miR-1199-5p, mmu-miR-669b-5p, mmu-miR-1187, and mmu-miR-1224-5p (Table 1). [score:7]
[1 to 20 of 1 sentences]
8
[+] score: 4
These miRNAs include miR-652, miR-711, miR-744, and miR-762, all of which are downregulated during aging. [score:4]
[1 to 20 of 1 sentences]
9
[+] score: 3
e-miR-711 is the major species mapped to this hairpin in the HL-1 and heart biopsy datasets and may similarly be derived by AGO2 -dependent processing. [score:1]
Position of the major e-miR on the mir-711 hairpin suggests it as a novel case of Ago2 -mediated processing [54]. [score:1]
Interestingly, we found a novel variant on the miR-711 hairpin (Figure 5B), which we termed an extreme isomiR (e-miR-711; see Figure S3 for an explanation of miRNA variant nomenclature used here). [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 3
001 Down 42 TGCATGACGGCCTGC Chrl2 MIMAT0001418 110828676 − 110828689  mmu-miR-466b-3p <0.001 Down 71 TCTTATGTGTGCGTGTA Chr2 MIMAT0004876 10395901 − 10395917 mmu-miR-467 a * <0.001 Down 169 TGTAGGTGTGTGTATGTATA Chr2 MIMAT0002108 10398019 − 10398038  mmu-miR-467b <0.001 Down 227 CATATACATGCAGGCACT Chr2 MIMAT0005448 10402887 − 10402903  mmu-miR-467e <0.001 Down 73 ACATATACATGCTCACACT Chr2 MIMAT0005293 10427362 − 10427379  mmu-miR- 5103 <0.001 Down 59 CCTCAGGGGATCCC Chr1 MIMAT0020610 34490035 + 34490023  mmu-miR- 5117 <0.001 Up 204 TAACTTTATTGATCATCACTAAC Chr1 MIMAT0020625 162967492 − 162967513  mmu-miR-582-5p <0.001 Down 69 AGTAACTGGTTGAACAACTGTA Chrl3 MIMAT0005291 110114949 − 110114969  mmu-miR-711 <0.001 Down 44 CTTACATCTCTCCCCG Chr9 MIMAT0003501 108872022 − 108872036 mmu-miR-99a * <0.001 Down 40 AGACCCATAGAAACGAGC Chrl6 MIMAT0016981 77599226 − 77599242Differentially expressed miRNAs (P < 0.05) between high- (C57L/J) and low-active (C3H/HeJ) mice strains in nucleus accumbens, EDL, and soleus. [score:3]
[1 to 20 of 1 sentences]
11
[+] score: 3
miRNA p-value Fold-Change miR-146a 1.15E-09 −4.82 miR-31 9.66E-08 −4.95 miR-155 1.97E-07 −3.82 miR-2134 2.13E-07 −2.05 miR-711 1.63E-06 −4.10 miR-3473 1.95E-06 −5.62 miR-574-3p 3.32E-06 −2.55 miR-1195 6.59E-06 2.26 miR-27a* 6.89E-06 14.92 miR-27b* 7.35E-06 2.92 miR-34c 1.80E-05 −3.43 miR-1931 3.34E-05 −2.30 miR-874 4.07E-05 −2.01 miR-196b 7.99E-05 2.59 miR-181a-1* 8.02E-05 4.15 miR-187 8.11E-05 2. 02List of miRs whose expression is altered, identified from microarray analysis by comparison of levels in TM [+] and TM [−] DCs which change >2 fold with p<0.0001. [score:3]
[1 to 20 of 1 sentences]
12
[+] score: 2
Thus, to further investigate relationships between increased plasma VEGF levels (Fig. 2) and the thirteen microRNAs (Table 1) that were downregulated following rIPC, expression levels of miR-6366, miR-711, miR-3960, miR-3072-5p, miR-2137, miR-762, miR-5112, and miR-149-3p were investigated in BM cells (Fig. 4). [score:2]
[1 to 20 of 1 sentences]
13
[+] score: 1
Likewise, in naproxen -treated mice exposed to MCS modulation of 3 miRNAs in both lung and blood serum (miR-181b, miR-344d, and miR-708) correlated with protection against pulmonary microadenomas, while one miRNA only (miR-711), correlated with protection against pulmonary adenomas, was modulated in both body compartments. [score:1]
[1 to 20 of 1 sentences]
14
[+] score: 1
Eleven miRNAs were randomly selected for qPCR analysis for each age: GD 17.0 miR-1843-5p, miR-485-3p, miR-711, miR-3962, miR-3067-3p, miR-212-3p, miR-669i, miR-877, miR-26b-3p, miR-465c-3p, let-7b-3p; GD 18.0 miR-1843-5p, miR-485-3p, miR-3473d, miR-132-5p, miR-3074-1-3p, miR-128-2-5p, miR-130b-5p, miR-490-5p, miR-669h-3p, miR-3058-5p, miR-146b. [score:1]
[1 to 20 of 1 sentences]