sort by

27 publications mentioning bta-mir-30d

Open access articles that are associated with the species Bos taurus and mention the gene name mir-30d. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 229
As shown in Figure 6D,E, the expression levels of Trim55(exon9+) and INSR(exon11+) in C2C12 cells transfected with miR-30-5p were obviously lower than that in control C2C12 cells, indicating that miR-30-5p could regulate the alternative splicing of the target genes of MBNL1, providing more evidence that miR-30-5p could repress MBNL1 protein expression. [score:8]
The co-transfection experiment of miR-30-5p and the non -transfected experiment showed a negative correlation between the miR-30-5p expression levels and MBNL2 and MBNL3 expression (Figure 4F,I, Figures S2 and S3), suggesting that miR-30-5p could be likely to regulate the expression of MBNL2 and MBNL3. [score:8]
miR-30a-5p, miR-30b-5p and miR-30e-5p were respectively transfected into HEK293T cells with the luciferase reporter constructs harbouring potential binding sites of miR-30-5p (MBNL1-WT) or the luciferase reporter constructs harbouring mutant potential binding sites of miR-30-5p (MBNL1-Mut); (F– H) miR-30-5p directly targets MBNL2; (I– K) miR-30-5p directly targets MBNL3. [score:7]
The expression level was normalized to U6 and relative to miR-30e-5p expression in muscle of adult cattle; (D) The differences of miR-30-5p expression in skeletal muscle among fetal, calf and adult cattle. [score:7]
The co-transfection experiment of miR-30-5p and the non -transfected experiment showed that there was a negative correlation between the miR-30-5p expression levels and MBNL1 (Figure 4A and Figure S1), suggesting that miR-30-5p could likely regulate MBNL1 expression. [score:6]
The prediction of TargetScan6.2 showed that the MBNL family of genes are the potential direct targets of miR-30-5p, and our data verified the prediction. [score:6]
Also, point mutation analyses showed that the miR-30-5p seed sites had no capability of targeting the mutated target sites of the 3′ UTRs (Figure 4H,K). [score:6]
Point mutation analyses showed that the miR-30-5p seed sites had no ability to target the mutated target sites of 3′ UTRs, with the exception miR-30e-5p (Figure 4E). [score:6]
Based on our RNAi experiments and previous study on the roles of MBNL1 and MBNL3 in muscle differentiation [25, 49], we concleded that miR-30-5p regulates muscle differentiation through directly targeting the MBNL genes. [score:5]
To study the possible function of miR-30-5p in myogenesis, we first overexpressed miR-30a-5p, miR-30b-5p and miR-30e-5p in C2C12 cells and detected the mature miR-30-5p expression level by RT-qPCR. [score:5]
We concluded that miR-30-5p directly targets MBNLs, through muscle signaling pathways, to regulate muscle differentiation. [score:5]
To obtain further information on how miR-30-5p downregulates the MBNL1 level, we determined the splice pattern of Trim55 and INSR (Figure 6A,B), which are regulated by MBNL1. [score:5]
Thus, the expression data of myogenic markers indicated that miR-30-5p could suppress the differentiation of C2C12 myoblasts. [score:5]
MBNL2 and MBNL3 were also predicted to be target genes for bovine miR-30-5p, according to TargetScan6.2. [score:5]
TargetScan6.2 was used to predict the target genes for bovine miR-30-5p. [score:5]
Therefore, we reasonably concluded that miR-30-5p directly targets MBNL for regulating muscle differentiation through muscle signaling pathways. [score:5]
In summary, we observed that miR-30-5p affects muscle differentiation and that MBNL1 promotes muscle differentiation, which demonstrated that the MBNL family members are the direct target genes of miR-30-5p, and confirmed that miR-30-5p could regulate alternative splicing of the INSR and Trim55 genes. [score:5]
2.3.2. miR-30-5p Directly Targets MBNL2 and MBNL3. [score:4]
2.3. miR-30-5p Directly Targets MBNL Family. [score:4]
These results verified that MBNL1 was the target gene regulated by miR-30-5p. [score:4]
We observed that the C2C12 cells transfected with miR-30-5p had a reduced mRNA expression of IR-B, confirming that miR-30-5p regulates the alternative splicing of INSR, which suggests that miR-30-5p may control muscle differentiation through the PI3K/AKT and ERK pathway. [score:4]
Primers listed in the Table S1 for miR-30-5p and reference gene U6 were designed based on Bos taurus sequences using Beacon Designer 7.9. miRNA constructs that express miR-30-5p including miR-30a-5p, miR-30b-5p and miR-30e-5p were conducted, using the overexpression vector pcDNA3.1(+). [score:4]
The expression profiling analysis showed evidence that miR-30-5p might play a crucial role in muscle development. [score:4]
Thus, because the expression profile suggested that miR-30-5p might have an important role in muscle development, it was selected as the candidate miRNA for further research about muscle differentiation. [score:4]
2.3.1. miR-30-5p Directly Targets MBNL1. [score:4]
To obtain direct evidence that MBNL1 3′ UTRs are targets of miR-30-5p, we cloned the 3′ UTRs of the MBNL1 gene, including the miR-30-5p recognition sites, and inserted them downstream of the luciferase gene in the pGL3-control luciferase reporter vector. [score:4]
We tested the hypothesis that members of the miR-30-5p family regulate myogenesis by targeting members of the MBNL family and, thus, facilitate alternative splicing of muscle-related genes. [score:4]
As expected, the mRNA expression of Trim55 including exon9 decreased in this study, suggesting that miR-30-5p is likely to regulate more muscle-related genes like Trim55 to act on muscle differentiation. [score:4]
Moreover, overlap PCR was carried out to generate the mutations in target sites of MBNL 3′ UTRs recognized by miR-30-5p, using two pairs of primers, two of them harboring the mutations (Primers listed in Table S3). [score:3]
High expression of mature miR-30-5p was found in heart and lung tissue (Figure 2A–C). [score:3]
Figure 2Expression profile of miR-30-5p in tissues of different stage. [score:3]
To address the function of bovine miR-30-5p, we first detected the expression patterns in different tissues of fetal, calf, and adult Qinchuan cattle by RT-qPCR analysis. [score:3]
RT-qPCR detection of mature miR-30-5p, using RNA prepared from C2C12 cells transfected with the expression constructs of miR-30-5p during the differentiation, confirming proper processing of miR-30-5p. [score:3]
2.2. miR-30-5p Inhibits Myogenic Differentiation. [score:3]
During the previous research about high-throughput sequencing on miRNA in skeletal muscle of Chinese cattle, the miRNA family miR-30-5p (miR-30a-5p, miR-30b-5p and miR-30e-5p) was detected and was predicted to target MBNL mRNA and, thus, to play a role in myogenesis [41]. [score:3]
miR-30-5p was confirmed to repress both the mRNA and protein expression of MHC and MyoG, which provided evidence that miR-30-5p repressed muscle differentiation. [score:3]
These previous studies strongly suggested that all three members of miR-30-5p jointly participate in the auto-regulation and cross-regulation of MBNL1 and MBNL2, which means that miR-30-5p may serve an important role in the accurate modulation of MBNL1 and MBNL2 function. [score:3]
According to our previous research on its expression in muscle tissue, miR-30-5p (miR-30a-5p, miR-30b-5p and miR-30e-5p) is a muscle-related miRNA [41]. [score:3]
The mRNA expression analysis showed that there was a lower level of MyoG and MHC in the C2C12 co -transfected with miR-30-5p than in the control C2C12 at six days of differentiation (Figure 3D). [score:3]
The Expression Profile of miR-30-5p in Different Tissues. [score:3]
As shown in Figure 3B, at six days of differentiation, the MHC and MyoG protein expression levels in C2C12 cells transfected with pcDNA3.1(+) harboring pre-miR-30-5p were significantly lower than in the control C2C12 cells. [score:3]
To confirm the effect of miR-30-5p on muscle differentiation, the mixture with an equivalent amount of constructs expressing miR-30a-5p, miR-30b-5p and miR-30e-5p would be transfected into the C2C12 cells cultured in the 6-well plates. [score:3]
Additionally, exon5 and exon7 of MBNL1 are mainly distributed in early differentiation stages [53, 54], which suggests that miR-30-5p regulates muscle differentiation possibly by regulating alternative splicing transcripts of MBNL1 and MBNL2. [score:3]
RT-qPCR detection of mature miR-30-5p, using RNA prepared from HEK293T cells transfected with the expression constructs of miR-30-5p, confirming proper processing of miR-30-5p. [score:3]
MBNLs play important roles for muscle differentiation in these cells as well [25], and our present study, focusing on the role of a family of microRNAs (miR-30-5p) on alternative splicing by MBML proteins in cattle, provides novel insights into the fine-tuning of MBML activity during normal muscle tissue development (i. e., in the absence of DM). [score:2]
However, the mechanism of how miR-30-5p regulates myogenic process is not clear. [score:2]
Besides this, we also found that the members of miR-30-5p showed differences in regulating the MBNL members. [score:2]
The cells transfected with pcDNA3.1(+) as the control; (C) Western blot analysis of MBNL1 protein levels regulated by miR-30-5p in the HEK293T cells respectively transfected with miR-30a-5p, miR-30b-5p and miR-30e-5p. [score:2]
2.5. miR-30-5p Regulates the Alternative Splicing of Trim55 and INSR by MBNL1. [score:2]
Hence, we can conclude that miR-30-5p regulates muscle differentiation through MBNL1 repression. [score:2]
The stars stand for conservatism among different sequences; (F) The similarity analysis of miR-30-5p in human, cattle and mouse. [score:1]
Western blot analysis confirmed that the endogenous MBNL1 proteins in HEK293T cells were particularly and significantly attenuated by miR-30-5p (Figure 4C). [score:1]
The sequences underlined represent the seed sequence of miR-30-5p. [score:1]
β-Tubulin was used as the loading control; (D) Sequence alignment of potential binding site of miR-30-5p in the 3′ UTR of MBNL1, MBNL2 and MBNL3. [score:1]
Aside from these findings, research about the function of miR-30 in skeletal muscles has rarely been carried out. [score:1]
In this study, we first confirmed the effect of miR-30-5p on skeletal muscle differentiation. [score:1]
The advantage of these constructs is the stability of processing mature miR-30-5p. [score:1]
The potential binding sites and the seed sequences of miR-30-5p were showed with potential binding sites underlined. [score:1]
The fragments containing the pre-miR-30-5p were then digested by HindIII and KpnI restriction enzyme (TakaRa; Tokyo, Japan) and inserted into the pcDNA3.1(+) vector with T4 DNA ligase (TakaRa; Japan), and confirmed by sequencing. [score:1]
Significant difference was observed between C2C12 cells transfected with pcDNA3.1(+) containing pre-miR-30-5p fragments and cells with empty pcDNA3.1(+) (Figure 3A), indicating that the constructs successfully generated the mature miR-30-5p. [score:1]
The prediction results revealed MBNL1 to have potential sites recognized by 7~8 mer seed sequences of miR-30-5p (miR-30a-5p, miR-30b-5p and miR-30e-5p) (Figure 4D), and that the potential sites were conservative in the 3′ UTRs of mammalian MBNL1 (Figure 4D). [score:1]
Because mature miR-30-5p sequences between bovine and murine are so highly conserved (Figure 1F), we chose mouse C2C12 cells as the experimental mo del. [score:1]
Before conducting the following experiments, we had proven the ability of the miR-30-5p constructs to generate mature miRNA in HEK293T cells (Figure 4B). [score:1]
Proteins were extracted from the HEK293T transfected with the mixture of equivalent amount of miR-30-5p constructs, using RIPA buffer (Solarbio; Beijing, China) containing 1 mM PMSF (Solarbio; Beijing, China). [score:1]
Figure 3Effect of miR-30-5p on differentiation of C2C12 myoblasts. [score:1]
Several studies on miR-30 have been reported recently. [score:1]
When 90% of the area of the bottom of the 6 cm culture dish was covered, the cells were seeded in 6-well plates and grown for 24 h. Then, HEK293T cells were transfected with 2.0 μg of pcDNA3.1(+) containing pre-miR-30-5p constructs at a confluence of 90% using Lipofectamine 2000 (Invitrogen; Grand Island, NY, USA) according to the manufacturer’s protocol. [score:1]
The cultures were changed for serum-free medium prior to transfection with mixed vectors composed of 200 ng Firefly Luciferase reporter combinational constructs, 50 ng Ranilla Luciferase reporter vectors and 2.5 μg pcDNA3.1(+) containing pre-miR-30-5p constructs, using Lipofectamine 2000 (Invitrogen; Grand Island, NY, USA) according to manufacturer’s protocol. [score:1]
The mature cattle miR-30-5p (miR-30a-5p, miR-30b-5p and miR-30e-5p) from 5′ arm of of the hairpin precursors are labeled in pink; (E) Alignment of mature miR-30-5p, it showed the conserved match to the mature sequences. [score:1]
The red font stands for the mutated bases in the potential binding site; (E) Luciferase assays for the direct evidence of miR-30-5p targeing MBNL1. [score:1]
control represents the C2C12 cells not transfected by miR-30-5p. [score:1]
As a control, the empty luciferase reporter vector (control) was co -transfected into HEK293T cells with miR-30-5p. [score:1]
To test whether the miR-30-5p constructs could generate mature miRNA, we transfected the recombinational vectors pcDNA3.1(+) containing pre-miR-30-5p in HEK293T cells. [score:1]
DM six day control represents the C2C12 cells not transfected by miR-30-5p. [score:1]
Figure 1The analysis of miR-30-5p. [score:1]
The prediction results revealed MBNL2 and MBNL3 have potential sites recognized by 7~8 mer seed sequences of miR-30-5p (Figure 4G,J), and that the potential sites were conservative in 3′ UTRs of MBNL2 in mammal (Figure 4G), but not in MBNL3 (Figure 4J). [score:1]
[1 to 20 of 76 sentences]
2
[+] score: 16
miRNA-25 and miRNA-30d directly target the 3′-UTR of TP53 to down-regulate p53 protein levels and to reduce the expression of genes that are transcriptionally activated by p53 [37]. [score:9]
Further TP53 targeting miRNAs are miRNA-30d, miRNA-25, and miRNA-504 [37]. [score:3]
miRNA-30d has also been found in porcine milk exosomes and in human milk [35, 39, 40]. [score:1]
org) Remarkably, the mature and seed sequences of human and bovine miRNA-125b, miRNA-25, as well as miRNA-30d are identical (Table 1). [score:1]
org) Remarkably, the mature and seed sequences of human and bovine miRNA-125b, miRNA-25, as well as miRNA-30d are identical (Table 1). [score:1]
Notably, miRNA-30d has been detected as a major signature miRNA of mature raw and commercial milk of dairy cows [38]. [score:1]
[1 to 20 of 6 sentences]
3
[+] score: 12
confirmed the down-regulation of 8 miRNAs (novel-miR-51, novel-miR-99, miR-30d, miR-574, miR-222, miR-196a, miR-3613a, and miR-27a-5p) and the up-regulation of 4 miRNAs (novel-miR-75, miR-1246, miR-2478, and miR-2904) in infected MDBK cells compared with the uninfected (Figure 4A). [score:6]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
[1 to 20 of 3 sentences]
4
[+] score: 12
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-101-2, bta-mir-148a, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-142, bta-mir-30e, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-22, bta-mir-30a, bta-mir-150, bta-mir-30c, bta-mir-101-1, bta-mir-141, bta-mir-146a, bta-mir-223, bta-mir-26a-1, bta-mir-30f, bta-mir-181a-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-1388, bta-mir-2898, bta-mir-2904-1, bta-mir-2904-2, bta-mir-2904-3, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-1842, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-148d, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Specifically, the miR-30a-5p and -30d (members of the miR-30 family) are known to be involved in regulation of autophagy in cancer progression and treatment by suppressing the expression of beclin 1 [46] and also cellular invasion and immunosuppression by targeting GalNAc transferase GALNT7 to increase synthesis of the immunosuppressive cytokine interleukin-10 [47]. [score:12]
[1 to 20 of 1 sentences]
5
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
The miR-30(b/c/d/e) family regulates kidney development by targeting the transcription factor Xlim1/Lhx1 in Xenopus[66]. [score:5]
In addition, ssc-moRNA-3, belonging to new type of miRNA termed moRNA, was found at the 5’ end of pre-miR-30. [score:1]
In our study, 8 miRNA families (let-7, mir-1, mir-17, mir-181, mir-148, mir-30, mir-92 and mir-99) were found with at least 3 members among all exosome miRNAs. [score:1]
The let-7 family had 9 members, miR-181 family had 4 members (miR-181a/b/c/d) and miR-30 family had 5 members (miR-30a/b/c/d/e). [score:1]
#: due to miRNAs classification by seed sequence, 3p and 5p of miR-30 represent different miRNAs families. [score:1]
Similarly, miR-30a was the most abundant in the miR-30 family. [score:1]
At the 5’ end of pre-miR-30, a 18 nt RNA sequence was found to be generated from the loop, downstream of ssc-miR-30a-5p (Figure 10C). [score:1]
[1 to 20 of 7 sentences]
6
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, hsa-mir-1246, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
There were eight microRNAs (bta-miR-27b, bta-miR-191, bta-miR-30d, bta-miR-451, bta-miR-25, bta-miR-140, bta-miR-24-3p, and bta-miR-122), that were upregulated in older animals in the present study, and upregulated in fetal muscle tissue of the study. [score:7]
[1 to 20 of 1 sentences]
7
[+] score: 6
All other miRNAs tested (miR-15a, miR-23b-3p, miR-27b, miR-30d-5p, miR-92a, miR-140, miR-197, miR-345-5p, miR-451, miR-885, miR-2284x, miR-2295, miR-2412, and miR-2478) were not differently expressed between the groups (P > 0.10), except that miR-103 content tended to be higher in the grain-fed cattle than in the grazing cattle (P = 0.057). [score:3]
The present results of microarray and qPCR revealed that the grazing JB cattle had a higher plasma content of miR-10b and lower plasma contents of miR-17-5p, miR-23b-3p, miR-28, miR-30b-5p, miR-30d, miR-98, miR-301a, miR-345-5p, miR-374b, miR-425-5p, miR-652, and miR-874 than the grain-fed cattle. [score:1]
We also conducted qPCR of miRNAs that are enriched in muscle or plasma (miR-21-5p, miR-30d-5p, miR-103, miR-206, miR-208b, miR-451, miR-486, miR-499, miR-2412, and miR-2478), some of which are abundant in bovine skeletal muscles [4]. [score:1]
Of those miRNAs, the contents of miR-652, miR-30d, miR-301a, miR-345-5p, miR-374b, miR-425-5p, miR-23b-3p, miR-30b-5p, miR-17-5p, miR-98, miR-28, and miR-874 were lower in the plasma of the grazing cattle than in that of the grain-fed cattle, whereas the contents of miR-10b, miR-2368-3p, miR-885, and miR-2425-3p were higher in the plasma of the grazing cattle. [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 6
GO analysis also revealed potentially novel regulation, such as that of miR-27 in transcriptional and membrane/vesicle -associated processes, miR-30 in immune homeostasis and cellular metabolism and transport, and miR-33 in cardiac development. [score:3]
Although several roles have been suggested for the miR-30 family, including regulation of adipogenesis, lipid metabolism, cardiovascular disease and cancer [33], this family remains inadequately characterized. [score:2]
By analyzing AGO-bound miRNAs in MDBK cells, we found the abundance profile dominated by members of the miR-30, let-7, miR-17, miR-374, miR-21, miR-27 and miR-15 families together accounting for more than 50% (Supplementary Fig.   S2a) [14]. [score:1]
[1 to 20 of 3 sentences]
9
[+] score: 5
org/), ranging from 3 target genes for miR-2892 and 1262 targets predicted for miR-30a-5p, miR-30b-5p, miR-30c, miR-30d, and miR-30f. [score:5]
[1 to 20 of 1 sentences]
10
[+] score: 4
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Ramachandra et al. (2008) discovered 14 miRNAs in early embryos (5 dpf); among these, miR-21, miR-30d, miR-92a, miR-200, and miR-26 are associated with differentiation and development. [score:2]
The miRNA families miR-181, miR-143, and miR-21 were the most abundant in control groups, while miR-21, miR-181, and miR-30 were the most abundant in animals infected with P. salmonis (Valenzuela-Miranda et al., 2017). [score:1]
Sea louse Caligus rogercresseyi, which affects Chilean aquaculture, were studied during infestation in Atlantic salmon and the most abundant families were mir-10, mir-21, mir-30, mir-181, and let7 in skin, head and kidney (Valenzuela-Muñoz et al., 2017). [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
Even the overexpression of one miRNA (miR-30d) could cause dysregulation of lactation and delay mammary gland involution in mouse [25]. [score:4]
[1 to 20 of 1 sentences]
12
[+] score: 3
Two abundantly expressed miRNAs of miR-30 family, miR-30a and miR-30d, have also been considered as regulators in promoting insulin sensitivity [53]. [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 3
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-99a, bta-mir-145, bta-mir-181a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-181c, bta-mir-191, bta-mir-199b, bta-mir-214, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-34c, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-195, bta-mir-34a, bta-mir-365-1, bta-mir-99b, bta-mir-100, bta-mir-129-1, bta-mir-129-2, bta-mir-130a, bta-mir-130b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-146b, bta-mir-146a, bta-mir-155, bta-mir-181d, bta-mir-182, bta-mir-183, bta-mir-184, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-199a-2, bta-mir-212, bta-mir-26a-1, bta-mir-28, bta-mir-29d, bta-mir-32, bta-mir-335, bta-mir-338, bta-mir-339a, bta-mir-346, bta-mir-365-2, bta-mir-378-1, bta-mir-383, bta-mir-409a, bta-mir-449a, bta-mir-449b, bta-mir-449c, bta-mir-592, bta-mir-708, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-1271, bta-mir-1249, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2332, bta-mir-199c, bta-mir-2389, bta-mir-2285c, bta-mir-2404-1, bta-mir-449d, bta-mir-2411, bta-mir-2446, bta-mir-339b, bta-mir-2404-2, bta-mir-2483, bta-mir-424, bta-mir-378-2, bta-mir-409b, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Similarly, miR-199a-5p along with miR-30d and miR-181a is believed to induce apoptosis by targeting the GRP78 gene [48]. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-20b, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
Interestingly, the expression level of certain miRNA families namely, the let 7 family (let-7a, let-7c, let-7d, let-7d*, let-7e, let-7f, let-7i), miR-181 family (miR-181a, miR-181b), miR-30 family (miR-30b*, miR-30c-2*, miR-30e ), miR-425 family (miR-425, miR-425*), miR-92 family (miR-92a, miR-92a-1*, miR-92b) and miR-196 family (miR-196a, and miR-196b) were repressed in SE animal group. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 3
Other miRNAs from this paper: bta-mir-221, bta-mir-222, bta-mir-30b, bta-mir-10a, bta-mir-30e, bta-mir-10b, bta-mir-30a, bta-mir-30c, bta-mir-331, bta-mir-135a-2, bta-mir-135a-1, bta-mir-188, bta-mir-30f, bta-mir-670, bta-mir-873, bta-mir-1839, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2306, bta-mir-2308, bta-mir-2309, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2366, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2389, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2422, bta-mir-2284r, bta-mir-2284h, bta-mir-2448, bta-mir-2284o, bta-mir-2284e, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-6525, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Thus, Streptococcus agalactiae -induced mastitis of bovine mammary glands resulted in altered expression of thirty five miRNAs including a bta-miR-30 family member, bta-miR-135a, and bta-miR-2284 family members [41]. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
In another study testosterone treatment was reported to alter miR-22, miR-690, miR-122, let-7a, miR-30 and let-7d expression in female rat liver [25]. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
miR-30d blocked transforming growth factor beta1 -induced epithelial-mesenchymal transition by targeting snail in ovarian cancer cells. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 2
Other miRNAs from this paper: bta-mir-30b, bta-mir-30e, bta-mir-30a, bta-mir-30c, bta-mir-30f
To enhance proper processing of short hairpin RNA (shRNA) sequences by Drosha, the myostatin siRNA sequences were modified for cloning by adding microRNA30 (mir30) sequences using methods described by (Paddison et al., 2004) (http://hannonlab. [score:1]
Myostatin shRNA mir30 amplicons were cloned into the 3′ UTR region of the enhanced green fluorescent protein (eGFP) within the PEG vector, as previously described (Golding et al., 2010). [score:1]
[1 to 20 of 2 sentences]
19
[+] score: 2
Top-ranked milk miRNA (ref 9) miRNA% milk miRNAs FC (T0 to T3) let-7b 39.1% -111 let-7a/c 37.0% 5 let-7f 2.8% 14 miR-30a 1.9% -39 miR-21 1.7% 23 miR-99a 1.7% -33 let-7d 1.4% ND (T3) miR-148a 1.2% 32 miR-92a 1.1% 8 miR-30d 1.0% -1144 We attempted to replicate and expand on the report of Baier et al., that milk intake increases presence of bovine miRNAs in human plasma and PBMCs. [score:1]
Top-ranked milk miRNA (ref 9) miRNA% milk miRNAs FC (T0 to T3) let-7b 39.1% -111 let-7a/c 37.0% 5 let-7f 2.8% 14 miR-30a 1.9% -39 miR-21 1.7% 23 miR-99a 1.7% -33 let-7d 1.4% ND (T3) miR-148a 1.2% 32 miR-92a 1.1% 8 miR-30d 1.0% -1144 Total reads in the RNA-seq datasets for plasma at T0, T3, T6, and T9 are shown, along with the number and percentage of reads mapped using miRge, Chimira, or Bowtie. [score:1]
[1 to 20 of 2 sentences]
20
[+] score: 2
Other miRNAs from this paper: bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-151, bta-mir-320a-2, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-34b, bta-mir-107, bta-mir-15b, bta-mir-181b-2, bta-mir-30e, bta-let-7d, bta-mir-124a-1, bta-mir-138-2, bta-mir-181c, bta-mir-214, bta-mir-455, bta-mir-93, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-let-7a-1, bta-mir-487b, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-34a, bta-mir-1-2, bta-mir-1-1, bta-mir-105b, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-138-1, bta-mir-152, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-206, bta-mir-30f, bta-mir-409a, bta-mir-432, bta-mir-486, bta-mir-495, bta-mir-543, bta-mir-9-1, bta-mir-9-2, bta-mir-1185, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2384, bta-mir-2284v, bta-mir-2284q, bta-mir-2404-1, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2424, bta-mir-2284r, bta-mir-2284h, bta-mir-2404-2, bta-mir-2284o, bta-mir-2284e, bta-mir-320a-1, bta-mir-424, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, bta-mir-133c, bta-mir-2284ab, bta-mir-2284ac
The largest miRNA family size identified was miR-2284, which consisted of 12 members, and let-7, miR-30, and miR-181/376 possessed 9, 7, and 4 members, respectively; whereas other miRNA families such as miR-1, miR-31, miR-93, and miR-206 had only one member (Additional file 1). [score:1]
This was also the case for some other miRNA families, such as bta-let-7 (from 6 to 1,434,682 reads), bta-miR-30 (from 34 to 12,681 reads) and bta-miR-181 (from 376 to 20,258 reads). [score:1]
[1 to 20 of 2 sentences]
21
[+] score: 1
Although circulation levels of miR-29b, miR-30a, miR-30d, miR-103, miR-126-5p, miR-144, miR-155, miR-425-5p, miR-489, miR-1249, and miR-2888 were also examined, no significant differences in these miRNAs were observed between the cattle groups at any time points or between the time points in either of the cattle groups. [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
113.116590 49 Vilella F, Moreno-Moya JM, Balaguer N, Grasso A, Herrero M, Martinez S et al Hsa-miR-30d, secreted by the human endometrium, is taken up by the pre-implantation embryo and might modify its transcriptome. [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
Other miRNAs from this paper: bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-107, bta-mir-140, bta-mir-30e, bta-let-7d, bta-mir-124a-1, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-let-7g, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-1-2, bta-mir-1-1, bta-mir-101-1, bta-mir-124a-2, bta-mir-124b, bta-mir-133a-2, bta-mir-133a-1, bta-mir-143, bta-mir-152, bta-mir-154a, bta-mir-185, bta-mir-199a-2, bta-mir-206, bta-mir-30f, bta-mir-335, bta-mir-33a, bta-mir-33b, bta-mir-370, bta-mir-378-1, bta-mir-432, bta-mir-9-1, bta-mir-9-2, bta-mir-1224, bta-mir-376b, bta-mir-376d, bta-mir-376c, bta-mir-376a, bta-mir-1839, bta-mir-1185, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-199c, bta-mir-2284p, bta-mir-2284u, bta-mir-2363-1, bta-mir-2363-2, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-320b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-320a-1, bta-mir-378-2, bta-mir-2284w, bta-mir-2284x, bta-mir-3432a-1, bta-mir-3432a-2, bta-mir-3604-1, bta-mir-3604-2, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-376e, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-6526-1, bta-mir-6526-2, bta-mir-503, bta-mir-2284y-7, bta-mir-6526-3, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-6536-1, bta-mir-2284aa-4, bta-mir-6536-2, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-3432b, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
The largest miRNA family size identified was miR-2284, which consisted of 27 members; miR-2285, let-7, miR-30, and miR-376 possessed 22, 8, 6, and 5 members, respectively, whereas other miRNA families such as miR-107, miR-122, miR-140, and miR-1839 had only one member (Table S1). [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
In total, 22 miRNAs (bta-miR-21-5p, -miR-143, -miR-10b, -let-7i, -miR-202, -miR-148a, -let-7f, -miR-3600, -miR-99a55p, -let-7a-5p, -miR-27b, -miT-100, -let7g, -miR-26a, -miR-378, -miR-30d, -miR-125b, -450a, -miR-30e-5p, -let-7b, -miR-199a-3p, and -miR-26c) contributed to the top twenty most abundantly sequenced miRNAs in the bovine CL. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
In particular, the content of miR-148a in bovine milk is elevated during 5 months of lactation [2, 3], whereas those of let-7a, miR-25, miR-30d, miR-182, miR-191, miR-200c, and miR-375 are reduced within the first month of lactation [2]. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
A recent study reported that the fine coordination of Smo activity by the miR-30 family controlled the specification and differentiation of distinct muscle cell types of zebrafish embryos [14]. [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
In mice, miR-146a, miR-16, miR-195, miR-30, and miR-744 have been reported as reference miRNAs in blood [4]. [score:1]
[1 to 20 of 1 sentences]