sort by

16 publications mentioning bta-mir-205

Open access articles that are associated with the species Bos taurus and mention the gene name mir-205. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 26
The expression of miR-223, miR-184, miR-132, miR-1246 and miR-130b were up-regulated while miR-196a, miR-205, miR-200b, miR-31 and miR-145 were down-regulated, which was in agreement with the high-throughput sequencing results (Figure 4). [score:9]
In our study, the expression of miR-31 (log2 = −1.52) and miR-205 (log2 = −1.36) in breast mammary gland tissue infected with S. aureus appeared to be significantly down-regulated relative to the control, which is similar to the trend observed in breast cancer. [score:6]
Among these miRNA, miR-31 and miR-205 have been recognized as closely related to breast cancer [25] with relatively abundant expression levels in tumor tissues and relatively low expression in healthy tissues. [score:5]
miRNA Target Genes miR-1246 ATP2B4, MAP3K1, ADCK3, PSD2, SLC5A1 miR-130b EXOC3L1, TIE1, BAZ2B, C3, GRAMD1C miR-145 HSD3B7, SLCO4A1, PDIA4, ACADL, PTPN11, KRT9, RASSF6, RNF43, LAMC2 miR-196a ADAP1, GPR97, POMT1 miR-200b ARID3A, MLXIP, GPR110 miR-205 IL13RA2, COL5A2, ADM, CXCR2, XPO6, SPSB1, FMO5, PSMF1 miR-31 MEX3D, PFKFB3, ST3GAL3, IL2RB, ANKRD32, MGST1 miR-184 HSPA1L, SLC25A15, HEG1, MAPRE2, ACP6, SYNE2 miR-223 TMEM165 miR-132 IQCA1 Figure 5 Gene ontology statistics. [score:3]
miRNA Target Genes miR-1246 ATP2B4, MAP3K1, ADCK3, PSD2, SLC5A1 miR-130b EXOC3L1, TIE1, BAZ2B, C3, GRAMD1C miR-145 HSD3B7, SLCO4A1, PDIA4, ACADL, PTPN11, KRT9, RASSF6, RNF43, LAMC2 miR-196a ADAP1, GPR97, POMT1 miR-200b ARID3A, MLXIP, GPR110 miR-205 IL13RA2, COL5A2, ADM, CXCR2, XPO6, SPSB1, FMO5, PSMF1 miR-31 MEX3D, PFKFB3, ST3GAL3, IL2RB, ANKRD32, MGST1 miR-184 HSPA1L, SLC25A15, HEG1, MAPRE2, ACP6, SYNE2 miR-223 TMEM165 miR-132 IQCA1 Figure 5 Gene ontology statistics. [score:3]
[1 to 20 of 5 sentences]
2
[+] score: 19
miR-205, which expression level is upregulated upon NF-kB activation, reduces COMMD1 expression level. [score:8]
Six miRNA (miR-21, miR-122, miR-125b, miR-205, miR-222, and miR-383) were significantly upregulated and two miRNA (miR-26b and miR-29b) were significantly downregulated in milk from mastitis-affected cows, as compared with that from normal cows (Fig 1, S3A and S3B Table). [score:6]
Among these miRNA, miR-26b, miR-29b, miR-122, and miR-205 were differentially expressed in the serum of cow with metritis [39]. [score:3]
S3 Table (A) CT values of miR-26b, miR-29b, miR-92a, miR-122, miR-125b, miR-222, miR-204, miR-205 and miR-383 in normal and mastitis cows. [score:1]
The miR-205-COMMD1-NF-κB axis enhances inflammatory response [34]. [score:1]
[1 to 20 of 5 sentences]
3
[+] score: 17
However, these differences in miRNA abundance appeared to be independent of infection status, as the seronegative animals had a similar expression pattern: miR-92b was upregulated at the early interval and remained increased in the late interval together with miR-205 and miR-29a (Table 3). [score:6]
These two miRNAs were also significantly increased at the late interval (43, 46 and 49 months amalgamated) and accompanied by miR-205 upregulation (Table 3). [score:4]
We recently reported miR-205 and miR-92b increases in the sera of healthy MAP-free calves after six months of development [18] and in this study, both these miRNAs had almost identical patterns of expression at the six month interval. [score:4]
For the majority of the intervals, there were similar expression patterns between the seropositive and seronegative groups for miR-29a, miR-101, miR-205, miR-92b, miR-345-3p and miR-1468. [score:3]
[1 to 20 of 4 sentences]
4
[+] score: 16
In addition, expression profiles suggested that, for all miRNAs except miR-143 and miR-205, blood cells are a significant source of plasma levels, consistent with roles in immuno-regulation as suggested above. [score:4]
In mammals, miR-205 was reportedly expressed in a range of tissues including the thymus, mammary gland, early embryo, digestive tissue and skin [57– 59, 55], however, different studies highlighted the importance of miR-205 in regulating keratinocyte function [60, 61], which is consistent with our results. [score:4]
Finally, miR-101, miR-205 and miR-26a are known regulators of angiogenesis [51– 54], a key process during development of foeto-placental and maternal tissues during pregnancy. [score:3]
Six miRNAs were expressed at significantly higher levels (up to 6-fold, P < 0.05) on Day 60 compared to Day 0, while miR-205 was significantly lower on Day 60 (1.5-fold, P < 0.05, Fig 2B, Table 6). [score:2]
Whether skin is indeed a significant contributor to circulating levels of miR-205 should be explored in future studies. [score:1]
Specifically, we identify a subset of miRNAs (let-7f, let-7c, miR-30c, miR-101, miR-26a, miR-205 and miR-143), the levels of which increase distinctly in circulation (up to 6-fold) in Day 60 pregnant relative to non-pregnant (Day 0) cows, and which provide novel molecular candidates involved in the establishment of pregnancy in cattle. [score:1]
Interestingly, mean levels of miR-205 were more than 8,000-fold higher in skin than in any other tissue (Fig 3). [score:1]
[1 to 20 of 7 sentences]
5
[+] score: 15
Among these 5 miRNA families, miR-192/215 and miR-194 were highly expressed in the small intestine (mid-jejunum and ileum), while miR-205 was highly expressed in the rumen but not detected in mid-jejunum (Figure 5). [score:5]
MiR-205 was highly expressed in the rumen, while miR-31 was highly expressed in the rumen and mid-jejunum not in the ileum. [score:5]
MiR-205, which was highly expressed in the rumen (Figure 5), may regulate proliferation of cells for the development of rumen during early life. [score:4]
A total of 13 regional and temporal DE miRNAs (regional DE miRNAs: miR-192, miR-194, miR-205, miR-31, and miR-196; temporal DE miRNAs: miR-146b, miR-191, miR-99a, miR-145, miR-211, miR-486, miR-33, miR-7, and miR-196b) that identified from miRNA-seq were selected for validation using stem-loop qRT-PCR. [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 12
In contrast, the ViTa algorithm found that more of these miRNAs could potentially target the genome, adding bta-miR-205, bta-miR-26b, bta-let-7 g, bta-miR-34a, bta-miR-144, bta-miR-181b, and bta-miR-147 to the list. [score:3]
Of the differentially regulated miRNAs, 16 (bta-miR-23b-5p, let-7 g, bta-miR-22-5p, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-455-3p, bta-miR-154a, bta-miR-369-3p, bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, and bta-miR-31) have previously been described to play a role in cellular proliferation or apoptosis (Fig.   6b, orange circle). [score:2]
Eleven of the miRNAs are encoded in intergenic regions, including: bta-miR-1281, bta-miR-150, bta-miR-181b, bta-miR-497, bta-miR-144, bta-miR-34a, bta-miR-154a, bta-miR-146b, bta-miR-17-5p, bta-miR-205, and bta-miR-31. [score:1]
The non-clustered miRNAs included: let-7 g, bta-miR-26b, bta-miR-150, bta-miR-34a, bta-miR-146a, bta-miR-147, bta-miR-205, bta-miR-455-3p, bta-miR-1224, bta-miR-1281, and bta-miR-31. [score:1]
Bta-miR-205 was the strongest induced miRNA during persistent infection. [score:1]
Also notable is that five of the detected miRNAs (bta-miR-1281, bta-miR-369-3p, bta-miR-26b, bta-miR-34a, and bta-miR-205) are involved in adipogenesis or other lipid metabolic pathways (Fig.   6b, green circle). [score:1]
As shown in the top portion of Table  3: bta-miR-22-5p, bta-miR-147, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-154a, bta-miR-17-5p, bta-miR-205, and bta-miR-31, with fold changes of 2.17, 5.28, 5.69, 23.78, 24.62, 24.05, 40.84, 41.22, and 43.37, respectively. [score:1]
The only chromosomes in the Bos taurus genome that were associated with more than one of the identified miRNAs were: chromosome #8 with bta-miR-23b-5p, bta-miR-31, and bta-miR-455-3p; chromosome #16 with bta-miR-34a, bta-miR-181b, and bta-miR-205; chromosome #19 with bta-miR-22-5p, bta-miR-144, and bta-miR-497; and finally chromosome #21 with bta-miR-154a and bta-miR-369-3p. [score:1]
Nine of the miRNAs (bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, bta-miR-31, bta-miR-150, and bta-miR-147), have been ascribed immune modulatory functions (Fig.   6b, blue circle). [score:1]
[1 to 20 of 9 sentences]
7
[+] score: 11
Among the top 20 most highly expressed miRNAs in the five tissues, miR-143 was highly expressed (~16%) in all tissues (Table 1), while the expression of some miRNAs varied between tissues, such as miR-122 and miR-205 (Fig. 2A). [score:7]
For example, miR-125b, miR-141 and miR-181a have been associated with milk lipid synthesis in mammary gland of lactating cows 31, and the expression of miR-221 and miR-205 is correlated with lactating initiation 32. [score:3]
Phosphorylation of AAs (FDR = 1.83E-08, n = 44, such as miR-205) was predicted to be impacted by mammary gland positively correlated miRNAs. [score:1]
[1 to 20 of 3 sentences]
8
[+] score: 10
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
[1 to 20 of 2 sentences]
9
[+] score: 8
All these miRNAs were significantly differentially expressed within the control group but, only miR-205 and miR-432 were identified as significant in the MAP-infected group. [score:3]
Control animals, however, also displayed similar miR-205 increases (2-fold) and miR-432 decreases (2-fold) at the 6 month time-point but were also accompanied by subtle increases (~1.5 fold) in expression for miR-27a, miR-92b, miR-10b, miR-143 and miR-126-5p (Table 3). [score:3]
Comparing the 0 to the six month time-points within each group revealed similar read count profiles for miR-205, miR-10b, miR-92b, miR-432, miR-27a, miR-127, miR-126 and miR-143. [score:1]
Specifically at the latter interval, miR-205 was increased (2-fold) while miR-432 was decreased (2-fold). [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 8
A recent study reported that miR-181a and b, miR-199b, miR-135a and miR-205 targeted endogenous SIRT1 and downregulated its expression in mouse embryonic stem cells [28]. [score:8]
[1 to 20 of 1 sentences]
11
[+] score: 7
Consistent upregulation of the bta-mir-200 family members was detected in CE endometrial samples, including bta-mir-200b, bta-mir-200c and bta-mir-205 (log [2] FC 7.6). [score:4]
Also bta-mir-205 is the most highly differentially expressed with a log [2] FC of 7.8. [score:3]
[1 to 20 of 2 sentences]
12
[+] score: 6
The most up- and down-regulated DE specific miRNAs were miR-2285ad (p-value = 8.29E-05) and miR-205 (p-value = 1.01E-11), miR-339b (p-value = 9.67E-04) and miR-EIA23-25909 (p-value = 3.82E-05), and miR-EIA20-21802 (p-value = 5.33E-04) and miR-2284j (p-value = 3.85E-06) for LAC, GAL and INV stages, respectively (Table 5). [score:4]
MiR-205, the most specific DE miRNA in LAC stage (Table 5) is known to regulate epithelial to mesenchymal transition 62. [score:2]
[1 to 20 of 2 sentences]
13
[+] score: 6
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-151, bta-mir-21, bta-mir-27a, bta-mir-125b-1, bta-mir-27b, bta-mir-193a, bta-mir-98, bta-let-7d, bta-mir-17, bta-mir-200a, bta-mir-200c, bta-mir-210, bta-mir-29b-2, bta-mir-29c, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-15a, bta-mir-100, bta-mir-130a, bta-mir-146a, bta-mir-155, bta-mir-184, bta-mir-219-1, bta-mir-223, bta-mir-28, bta-mir-494, bta-mir-708, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-3596, bta-mir-652, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-664b, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
miR-21 and miR-205, have been shown to have role in cancer, regulating tumour suppressor genes such as VEGF-A and TGFI-R2 [39], [40], [41], [42]. [score:4]
miR-184, for example, has been demonstrated to antagonise miR-205 to maintain SHIP2 levels in epithelia [46]. [score:1]
These miRNAs represent seven different miRNA families; miR-let-7 (bta-let-7i & bta-miR-3596), miR-21 (bta-miR-21), miR-27 (bta-miR-27a & bta-miR-27b), miR-28 (bta-miR-151), miR-184 (bta-miR-184), miR-200 (bta-miR-200a & bta-miR-200b), and miR-205 (bta-miR-205). [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 5
MiR-205 over -expression leads to an expansion of the progenitor-cell population and increased cellular proliferation [26], while miR-27 reduces lipid accumulation by targeting peroxisome proliferator-activated receptor γ (PPARγ) in human adipocyte cells [27], and miR-33 represses sterol transporters in human liver cells [28]. [score:5]
[1 to 20 of 1 sentences]
15
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
Most of the detected top expressed miRNAs are conserved in human, mouse, and bovine, and belong to several miRNA families, vis, miR-31, miR-26a, miR-27a-3p/27b, let-7a-5p/7f/7i, miR-21-5p, miR-22-3p, miR-184, miR-186, miR-191, miR-205 and miR221/222. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
Galio L. Droineau S. Yeboah P. Boudiaf H. Bouet S. Truchet S. Devinoy E. MicroRNA in the ovine mammary gland during early pregnancy: Spatial and temporal expression of miR-21, miR-205, and miR-200Physiol. [score:3]
[1 to 20 of 1 sentences]