sort by

35 publications mentioning bta-mir-125b-2

Open access articles that are associated with the species Bos taurus and mention the gene name mir-125b-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 74
This promotes the PI3K-AKT-mTORC1 pathway enhancing the expression of survivin, which is a negative regulator of caspase 3. Furthermore, milk miRNAs via attenuation of p53 and FOXO1 expression enhance AR signaling with subsequent upregulation of miRNA-125b. [score:9]
Remarkably, androgen stimulation of PCa cells via AR up-regulates the expression of miRNA-125b (Fig. 2), thus reduces the expression of these pro-apoptotic proteins [160, 161]. [score:8]
AR expression is negatively regulated by p53 resulting in decreased AR -mediated expression of miRNA-125b, which targets the pro-apoptotic proteins Bak and p53 at the mitochondrial membrane. [score:8]
Increased miRNA-125b expression via AR signaling and milk miRNA-125b uptake down-regulate Bak-p53-interaction suppressing the intrinsic pathway of apoptosis. [score:8]
miRNA-125b -mediated down-regulation of p53 is strictly dependent on the binding of miRNA-125b to a miRNA response element in the 3′-untranslated region (3′ UTR) of TP53 mRNA (Table 1). [score:6]
It has recently been shown that miRNA-125b directly represses 20 novel targets in the vast p53 network including both apoptosis regulators like BAK1, IGFBP3, ITCH, PUMA, PRKRA, TP53INP1, TP53, ZAC1, and also cell-cycle regulators like cyclin C, CDC25C, CDKN2C, EDN1, PPP1CA, SEL1L, respectively [32]. [score:6]
Therefore, downregulation of BAK1 by miRNA-125b may contribute to disease progression and resistance to treatment in PCa [160, 161]. [score:6]
miRNA-125b directly targets three key pro-apoptotic genes: TP53, BBC3 (Puma), and BAK1. [score:4]
Most clinical PCa specimens overexpress miRNA-125b, which is regarded as an oncogene of PCa [160, 161]. [score:3]
Milk consumption during antiandrogen therapy of PCa via transfer of milk-derived miRNA-125b may counteract antiandrogen -induced suppression of miRNA-125b thereby reducing the level of PCa cell apoptosis. [score:3]
Le et al. [32] demonstrated that miRNA-125b is a bona fide negative regulator of p53 in both zebrafish and humans. [score:2]
Notably, miRNA-125b regulation of p53 is conserved at the network level in all vertebrates [33]. [score:2]
Milk-derived miRNA-125b and androgen-stimulated miRNA-125b thus operate synergistically as a natural doping system. [score:1]
Increasing the abundance of miRNA-125b results in a dramatic decrease in the levels of these apoptosis effectors in PCa cells [162]. [score:1]
− − 83,84,100–103 IL-6 + + + 141,144–146 miRNA-125b + ? [score:1]
Milk-miRNA-125b counteracts antiandrogen therapy of prostate cancer. [score:1]
org) Remarkably, the mature and seed sequences of human and bovine miRNA-125b, miRNA-25, as well as miRNA-30d are identical (Table 1). [score:1]
Milk contains abundant miRNA-125b, which has been demonstrated in human [34], bovine [18, 35], and porcine milk exosomes [36], respectively. [score:1]
miRNA-125b was found to have the ability of rendering LNCaP cells resistant to androgen withdrawal [161]. [score:1]
However, it is of critical concern, that today’s milk contains and transfers oncogenic miRNAs involved in the cancerogenesis of PCa such as miRNA-21, miRNA-25, and miRNA-125b [180]. [score:1]
org) Remarkably, the mature and seed sequences of human and bovine miRNA-125b, miRNA-25, as well as miRNA-30d are identical (Table 1). [score:1]
[1 to 20 of 21 sentences]
2
[+] score: 30
Moreover, the expression of miR-125b in jejunum and miR-141 in mammary gland were impacted by the diet (Table S7), suggesting that nutritional changes could influence the expression of those miRNAs which could regulate milk initiation as reported as well as feed efficiency, and N efficiency as observed in this study. [score:6]
When cows were fed RS diet, the expression of two ruminal miRNAs including miR-101, -361, six jejunal miRNAs including miR-125b, -199c, -221, -2285c, -324, -33b, and two hepatic miRNAs including miR-219-5p, -3613, was positively correlated with feed (R ranged from 0.81 ~ 0.96, P < 0.05) and N efficiency (R ranged from 0.81 ~ 0.97, P < 0.05), whereas the expression of jejunal miR-378b, three hepatic miRNAs including miR-154b, -2403, -493, and three mammary gland miRNAs including miR-192, -29d, -411c-3p was negatively correlated with feed (R ranged from −0.81 ~ −0.93, P < 0.05) and N efficiency (R ranged from −0.83 ~ −0.97, P < 0.05) (Table S7). [score:5]
When cows were fed AL diet, expression of three ruminal miRNAs including miR-125-5p, -130a, -2376, three duodenal miRNAs including miR-2483-5p, -2286l, -2336, two hepatic miRNAs including miR-199a-3p, -2399-5p and fourteen mammary gland miRNAs such as miR-196a, -205 was positively correlated with feed (R ranged from 0.81 ~ 0.99, P < 0.05) and N efficiency (R ranged from 0.81 ~ 0.98, P < 0.05), whereas the expression ruminal miR-1296, duodenal miR-6123, two jejunal miRNAs including miR-30b-3p, -652, five hepatic miRNAs including miR-1, -2285e, -421, -455-3p, -671, and mammary gland miR-99b was negatively correlated with feed (R ranged from −0.82 ~ −0.94, P < 0.05) and N efficiency (R ranged from −0.84 ~ −0.92, P < 0.05) (Table S6). [score:5]
MiR-125b were previously reported to regulate cellular proliferation 49, so the expression change of this miRNA may impact the proliferation rates of the duodenum and jejunum epithelium and further regulate nutrients utilization. [score:5]
For example, under RS diet, the expression of miR-125b was positively associated with feed efficiency in duodenum and jejunum (Table S7). [score:3]
For example, miR-125b, miR-141 and miR-181a have been associated with milk lipid synthesis in mammary gland of lactating cows 31, and the expression of miR-221 and miR-205 is correlated with lactating initiation 32. [score:3]
In our study, the expression of miR-125b, miR-141, miR-181a, miR-221 and miR-15b were detected in all five tissues (Table S2) and they were associated with feed or N efficiency under different diets (Table 2 and Table S7). [score:3]
[1 to 20 of 7 sentences]
3
[+] score: 29
Additionally, findings about miR-132 and miR-125b-5p are of high interest because their aberrant expression is involved in neurodegenerative diseases such as Alzheimer's disease (AD) [37– 39] and Huntingtong's diseases [40, 41]. [score:9]
The highest expression occurs in miR-125b-5p, while miR-331-3p has the lowest expression. [score:5]
Previous studies of miRNA expression profiles have reported enrichment of several miRNAs including miR-125b, miR-132-3p, miR-331, and miR-338-3p in mammalian brains [30, 31]. [score:3]
Similarly, the four miRNAs and miR-145-5p, particularly miR-125b-5p, miR-338-3p, and miR-145-5p, were confirmed to have high expression levels in both cattle and buffalo obex tissues (Figure 6A). [score:3]
Moreover, the AG insertion allele of buffalo PRNP 3′UTR (g. 1088-1089) was predicted to create a new target site for miR-125b-5p and miR-331-3p, which is also absent in the corresponding cattle sequence when stringent settings are applied. [score:3]
Additionally, the buffalo-specific AG insertion and g. 1346 T→A mutation provide binding sites for miR-125b-5p and miR-331-3p, and miR-132-3p, respectively (Table 1). [score:2]
The seeds of two miRNAs, miR-125b-5p and miR-331-3p, were predicted to bind to the UTR-2 at the CAGGGAG location, but cattle have no miRNA -binding site due to the deletion of AG at g. 1068 site (Figure 5A, Supplementary Table 2). [score:1]
The regulatory differences between cattle and buffalo sequences were further confirmed by in vitro assays in miR-338-3p (ΔΔG=10.2 kcal/mol), miR-145-5p (ΔΔG=8.0 kcal/mol), miR-125b-5p (ΔΔG=6.8 kcal/mol), miR-331-3p (ΔΔG=4.7 kcal/mol), and miR-132-3p (ΔΔG=1.8 kcal/mol). [score:1]
As shown in Figure 5C, the luciferase activity of psi-CHECK2-UTR-2 is significantly decreased by miR-125b-5p (p=0.005) and miR-331-3p (p=0.007), and psi-CHECK2-UTR-3 by miR-132-3p (p=0.034), respectively. [score:1]
Relatively high ΔΔG values were detected in miR-338-3p (10.2), miR-668-5p (8.1), miR-145-5p (8.0), miR-204-3p (7.7), and miR-125b-5p (6.8), suggesting that buffalo sequences have increased binding potential to most of the miRNAs. [score:1]
[1 to 20 of 10 sentences]
4
[+] score: 25
In biological verification the trend of the upregulated miRNAs (bta-miR-25, -miR-106b, miR-93, -let 7i) was confirmed while downregulated miRNAs did not exhibit the same trend (bta-miR-2898, bta-miR-193-5p, bta-miR-125b, bta-miR-200b and bta-miR-200c) (Table 4). [score:7]
The closely-related miRNA miR-125b, which is encoded in a cluster with miR-100 which is also down-regulated at day 18 of pregnancy, has been shown to be differentially expressed in the endometrium and placenta and may also be involved in the endometrial immune response [60, 67, 69, 71]. [score:6]
Additionaly, bta-miR-125b was found to be down-regulated in bovine plasma in a recent study by Ioannidis et al. between day 24 pregnant and non-pregnant heifers [72]. [score:4]
While the trends of regulation are clearly visible in technical validation, significances shown in NGS could only be confirmed for four miRNAs, which were either significantly regulated between pregnancy and oestrous cycle on day 4 (bta-miR-29b) or from day 4 to 18 between cycle and pregnancy (bta-miR-221, bta-miR-125b and bta-miR-200b). [score:3]
13 miRNAs (bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i (MC); bta-miR-20a, bta-miR-29b, bta-miR-92 (SM)) which were found to be regulated during early pregnancy using NGS resutling, in case of MC miRNAs, in separation of cyclic and pregnant animals in PCA, were validated with RT-qPCR. [score:2]
Consequently, Day 18/Day 4 ratios of cyclic (18c/4c) and pregnant animals (18p/4p) of a set of miRNAs (bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i) were used in a PCA. [score:1]
Using day 18 to day 4 ratio in MC sequencing data of a set of ten miRNAs (bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i) discrimination between pregnant and cyclic animals was achieved in a PCA. [score:1]
C) PCA of log2 fold-change of the miRNAs: bta-miR-25, bta-miR-93, bta-miR-106b, bta-miR-125b, bta-miR-193a-5p, bta-miR-200b, bta-miR-200c, bta-miR-221, bta-miR-2898, bta-let-7i between days 4 and 18 (Day 18/Day 4) showing the separation of cyclic and pregnant animals. [score:1]
[1 to 20 of 8 sentences]
5
[+] score: 24
Moreover, the 4 miRNAs identified in our study to be differentially expressed during the oestrous cycle (let-7f, miR-125b, miR-99a-5p and miR-145; Fig 5) are indeed expressed naturally not only in the ovary but also (at lower levels) in many other tissues [55, 56], the relative contribution of which to circulating levels is not known. [score:5]
In support of this, all 4 miRNAs that were expressed at higher levels on Day 0 than Day 8 of the oestrus cycle (let-7f, miR-125b, miR-99a-5p and miR-145) are also known to be expressed at higher levels in pre-ovulatory follicles than in corpora lutea of ruminant ovaries, consistent with their role in the follicle-to-luteal transition [21]. [score:5]
Another study recently reported differences in plasma miRNA levels (including miR-26b-4p, miR-125b and miR-99a-3p) between naturally cycling heifers and heifers treated with FSH to induce ovarian hyper-stimulation, but did not report differences in plasma miRNA expression during natural oestrous cycles [53]. [score:3]
Finally, identified predicted KEGG pathways simultaneously targeted by two or more of the miRNAs identified in this study (miR-125b, let-7f, miR-99a-5p and miR-145), and those included ECM-receptor interaction, p53 signalling, Hippo signalling, Thyroid hormone and Cell cycle pathways (S5 File). [score:3]
S5 File KEGG pathways enriched among experimentally validated targets of let-7f, miR-125b, miR-99a-5p and miR-145 using miRPath 3.0 and TarBase 7.0. [score:3]
In addition, for miR-125b, although an overall effect of Day of oestrous cycle was not found, expression levels tended to be higher (P = 0.08) during oestrus (Day 0 vs Days 8 and 16 combined). [score:3]
Specifically, we identified an increase (up to 2.2-fold) in the levels of let-7f, miR-125b, miR-99a-5p and miR-145 during oestrus. [score:1]
We selected 8 miRNA candidates identified by sequencing (miR-125b, miR-155, miR-199a-5p, miR-381, miR-99b; Table 2) or PCR array (let-7f, miR-378, miR-455-5p; Table 3) for. [score:1]
[1 to 20 of 8 sentences]
6
[+] score: 21
The study goes on to further investigate the role of miR-125b, demonstrating that miR-125b down-regulates endodermal and mesodermal formation and suppresses cardiomyocyte differentiation by targeting Lin28 [37]. [score:6]
Seven miRNA (five of which were present in our study: let-7a, −7b, miR-125b, −10b, and −26a) have shown differential expression during quail embryonic development and are postulated to function in quail embryo somite development [35]. [score:5]
Furthermore, miR-125b (also highly expressed in our sequencing results) has been shown to regulate p53 in humans [42]. [score:4]
MiR-125b also regulates osteoblast differentiation from mesenchymal stem cells, having higher expression in undifferentiated cells [38]. [score:3]
Notably, miR-125b/let-7a/miR-100 (all highly expressed in our study) are clustered together in the human genome [39]. [score:3]
[1 to 20 of 5 sentences]
7
[+] score: 21
MiR-125b, miR-181a, miR-199b, miR-484 and miR-500 can regulate expression of the HK2 gene according to our network. [score:4]
Mimics of miR-125b, miR-141, miR-181, miR-199a, miR-484 and miR-500 and the antisense inhibitor miR-141 were transfected by Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s protocol. [score:3]
Real-time PCR analysis was performed to analyze the expression levels of miR-141, miR-125b, miR-181a, miR-199b, miR-484 and miR-500 in MG tissues. [score:3]
The interaction network predicted that HK2 is a target of miR-125b, miR-181a, miR-199b, miR-484 and miR-500. [score:3]
In marked contrast, significant reductions in the expression of miR-125b, miR-181a and miR-199b were observed in the non-lactation period (Table 2). [score:3]
Transfection with miR-181a, miR-199b and miR-125b mimics did not significantly change the protein level of HK2 (Figure 11), while miR-484 and miR-500 mimics markedly inhibited the production of HK2 protein. [score:3]
Our data collection and analysis revealed that the 3’UTR of signal transducers and activators of transcription (STAT5, NM_001012673.1) mRNA contains a complementary site for the seed region of bta-miR-141, while the 3’UTR of Hexokinases (HK2, XM_002691189.1) was paired with five miRNAs: bta-miR-500, bta-miR-199a, bta-miR-125b, bta-miR-181a and bta-miR-484 (Figure 8). [score:1]
Using a cell -based mo del, six miRNAs (miR-125b, miR-141, miR-181a, miR-199b, miR-484 and miR-500) were studied to reveal their possible biological significance. [score:1]
[1 to 20 of 8 sentences]
8
[+] score: 20
From this screened target set, we found that let-7b, mir-15b, mir-18a, mir-29a, mir-101, mir-125b, mir-126, mir-143, mir-145, mir-199a and mir-222 to have the highest number and overlapping targets (Figure 6). [score:5]
The expression of all new miRNAs including nine annotated miRNAs (let-7b, mir-15b, mir-18a, mir-29a, mir-125b, mir-126, mir-145, mir-199a and mir-222) in 11 different bovine tissues were analyzed using semi-quantitative RT-PCR (details in Figure 4, Table 2 and Additional file 2). [score:3]
Bta-mir-125b, bta-mir-222, bomir-542, bomir-652, bomir-H0222, bomir-F0522, bomir-C1931 and bomir-A2143 were found to be expressed at very low level or not detected at all in the ovarian cortex. [score:3]
In addition, higher expression of bta-mir-125b, bomir-409, bomir-503 and bomir-F0244 was also observed in the cumulus cells. [score:3]
which are identified by our new screening approach, were already validated in wet lab experiments and reported as targets of multiple miRNAs (miR-145, miR-125b, miR-126 and miR-29) [69- 73]. [score:3]
For example, miR-199a, miR-145, miR-125b and let-7 clusters were found to be the most differentially regulated miRNAs in human ovarian cancer [74, 75]. [score:2]
Five miRNAs (miR-29a, miR-125b, bomir-409, bomir-503 and bomir-F0244) were found to be highly abundant in the cumulus cells and four (bomir-652, bomir-H0222, bomir-C1931 and bomir-A2143) in corpus luteum. [score:1]
[1 to 20 of 7 sentences]
9
[+] score: 16
Six miRNA (miR-21, miR-122, miR-125b, miR-205, miR-222, and miR-383) were significantly upregulated and two miRNA (miR-26b and miR-29b) were significantly downregulated in milk from mastitis-affected cows, as compared with that from normal cows (Fig 1, S3A and S3B Table). [score:6]
miR-125b is down-regulated in bovine CD14+ monocytes stimulated with Staphylococcus aureus enterotoxin B [29] and activate the NF-κB pathway by targeting TNFAIP3 [30]. [score:6]
MicroRNAs miR-125a and miR-125b constitutively activate the NF-kappaB pathway by targeting the tumor necrosis factor alpha -induced protein 3 (TNFAIP3, A20). [score:3]
S3 Table (A) CT values of miR-26b, miR-29b, miR-92a, miR-122, miR-125b, miR-222, miR-204, miR-205 and miR-383 in normal and mastitis cows. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 15
Other miRNAs from this paper: bta-let-7f-2, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-26b, bta-mir-125a, bta-mir-125b-1, bta-mir-128-1, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-140, bta-mir-15b, bta-mir-92a-2, bta-let-7d, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-374a, bta-mir-128-2, bta-mir-146b, bta-mir-152, bta-mir-155, bta-mir-181d, bta-mir-24-1, bta-mir-223, bta-mir-374b, bta-mir-500, bta-mir-708, bta-mir-92a-1, bta-mir-9-1, bta-mir-9-2, bta-mir-1249, bta-mir-181a-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2285c, bta-mir-2478, bta-mir-2898, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Pro-apoptotic BAK1 is a direct target of miR-125b [62] and in our study miR-125b was found to be down-regulated in response to ST12 (Fig. 4). [score:7]
Both strains induced miR-221, ST12 induced miR-30b, miR-223, miR-374b and miR-500 but down-regulated miR-125a and miR-125b, while ST103 induced miR-222, all associated with alternative macrophage activation [34– 37]. [score:4]
It has been shown that miR-155 and miR-125b are involved in regulation of TNF production during mycobacterial infection [55, 56]. [score:2]
66227321:+ chr1_111 475,00 6,00 249,50 mmu-miR-125b-2-3p acaagucaggcucuugggacc chr1:19881359.. [score:1]
For three of the ST12-unique DE miRNAs (bta-miR-155, bta-miR-125b and bta-miR-223) evidence of induction by bacteria has been previously documented. [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
Unst) Pathways in cancer miR-659, −141, −190, −449a, −200c, −361-5p, −145 9.51E-12 KRAS, PTEN, VEGFA, STAT5B, MITF, BCL2 MAPK signaling pathway miR-23a, −23b, −141, −145, −200c, −92a, −125b, −24 2.94E-11 MKNK2, MEF2C, FGF, SOS1, RAS, MAerkPK2 Wnt signaling pathway miR-125b, −449a, −302e, −145, −23a, −29b-2-5p, −659, −200c 2.76E-08 LRP5, LRP6, TCF7, PLCB4, DVL3, WNT1, WNT5A ErbB signaling pathway miR-23a, −23b, −125b, −206, −302e, −513c 3.19E-07 ERBB4, GRB2, SHC1, PIK3R3, PIK3CD, AKT3 Colorectal cancer miR-659, 23a, −23b, −141, −190, −449a, −200c, −361-5p, −145 4.48E-07 DCC, APPL1, TGFBR2, SMAD3, SMAD4, APC Axon guidance miR-23a, −23b, −200c, −145 7.23E-07 PLXNC1, EFNB2, PAK4, DCC, SEMA6A, PAK7, MET Neurotrophin signaling pathway miR-302e, −361-5p, −452, −525-5p, −449a, −659 1.82E-06 NTRK2, NGFR, KRAS, MAP3K1, PIK3R3, PLCG1 Renal cell carcinoma miR-659, −141, −190, −449a, −200c, −361-5p, −145 3.75E-05 GAB1, MET, SOS1, GRB2, VEGFA, NRAS Focal adhesion miR-24, −27b, −125a-3p, −139-5p, −206, −200c 5.04E-05 ITGB3, PXN, SHC3, ACTB, SRC, PAK2 Regulation of actin cytoskeleton miR-200c, −145, −27b, −92a, −300, −206 8.29E-05 RAC1, ROCK2, GIT1, PIK3R3, ITGA3, LIMK1 Table 3List of enriched pathways (P < 0.05), in which genes predicted to be targeted by differentially expressed miRNAs (P < 0.05) in blood plasma of hyperstimulated vs. [score:6]
This study demonstrated that eight miRNAs (miR-503, miR-21, miR-29b, miR-142-3p, miR-34a, miR-152, miR-25 and miR-130a) were highly expressed, while nine miRNAs (miR-125a, miR-199a-3p, miR-125b, miR-99a, let-7c, miR-145, miR-31, miR-202 and miR-27b) were expressed at lower level between the follicular and luteal stages in ovine ovarian tissues. [score:5]
Unst)  Pathways in cancer miR-125b, −153, −410, −494 9.51E-12 DCC, GRB2, SMAD2, SOS1, E2F3  MAPK signaling pathway mir-125b, −153, −494 2.94E-11 MEF2C, MAPKAPK2, MAP3K1, TGFB2, FGFR2  Wnt signaling pathway miR-147, −153, −410, −494 2.76E-08 LRP6, WNT5A, DVL3, DKK2, PLCB1, ANGL2  ErbB signaling pathway miR-125b, −410 3.19E-07 ERBB4, SOS1, MAPK1, NRG3, GAB1, MAP2K7  Colorectal cancer miR-125b, −410, −153, −494 4.48E-07 DCC, BCL2, SMAD4, RAF1, SMAD2, PIK3R3  Axon guidance miR-147, −153, −410, −494 7.23E-07 PLXNA2, ROCK2, EFNA3, NFAT5, MAPK1  Neurotrophin signaling pathway miR-125b, −134, −147, −494 1.82E-06 NTF3, MAP3K1, SOS1, SORT1, BCL2  Melanogenesis miR-134, −99a-3p 4.52E-06 MAPK1, WNT5A, KRAS, GNAI3, CREB1  Melanoma miR-125b, −494 1.70E-05 E2F2, FGFR1, IGF1R, FGF7, RAF1  Prostate cancer miR-125b, −147, −153, −410, −494 1.82E-05 FGFR2,, IGF1R, MAPK1, IGF1, BCL2 In order to explore the temporal changes in the expression of circulatory miRNA especially in blood plasma of hyperstimulated heifers, the expression of candidate miRNAs was investigated at different days during the estrous cycle (Days 0, 3 and 7). [score:3]
[1 to 20 of 3 sentences]
12
[+] score: 12
Among the miRNAs expressed in both females and males, 22 were up regulated in females (P < 9.62E-05) including the let-7-complex miRNAs rmi-let-7a, rmi-miR-100 and rmi-miR-125 (let-C miRNAs) (Table 5 and Additional file 9). [score:4]
We observed correlated co -expression profiles of tick miRNAs overlapping two D. melanogaster clusters, miR-100:miR-125:let-7 and miR-275:miR-305 indicating that these clusters may also be conserved in the cattle tick genome (Additional file 12). [score:3]
Our results show that these three miRNAs present similar expression trends (Figure 3E) suggesting that rmi-let-7a, rmi-miR-100 and rmi-miR-125 may also collocate to the same genomic region in the R. microplus genome. [score:3]
Interestingly let-7, miR-100 and miR-125 are known to be clustered in the same genomic location in the D. melanogaster and A. gambiae genomes within 1 kb and 4.5 kb, respectively [30]. [score:1]
We found tick miRNAs overlapping five of these clusters, including the miR-100:miR-125:let-7, miR-275:miR-305, miR-2a-2:miR-2a-1:miR-2b-2, and miR-310:miR-311:miR-312:miR-313:miR-991:miR-992 clusters (Additional file 12). [score:1]
[1 to 20 of 5 sentences]
13
[+] score: 7
The summary of the six DE miRNA common to all species is described in Fig.   5. Briefly, all DE candidates were single copy miRNA across all libraries, and 4 DE miRNA (miR-101-3p, miR-16-5p, miR-143-3p and miR-155-5p) were up-regulated in bats while 2 (miR-125-5p and miR-221-5p) were down-regulated. [score:7]
[1 to 20 of 1 sentences]
14
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
When compared with the control period (day-14), we identified a total of 22 DE miRNAs at day+28 including 10 up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-34a, miR-152, miR-16a, and miR-28) and 12 down-regulated (bta-miR-200a, miR-145, miR-99a-5p, miR-125b, miR-99b, miR-125a, miR-96, miR-484, miR-1388-5p, miR-342, miR-486 and miR-1271) (Table  2). [score:6]
[1 to 20 of 1 sentences]
15
[+] score: 6
Other miRNAs from this paper: bta-mir-125a, bta-mir-125b-1, bta-mir-128-1, bta-mir-181a-2, bta-mir-199a-1, bta-mir-27b, bta-mir-34b, bta-mir-127, bta-mir-181b-2, bta-mir-215, bta-mir-218-2, bta-mir-30e, bta-mir-181c, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-22, bta-mir-30a, bta-mir-200b, bta-mir-122, bta-mir-34c, bta-mir-34a, bta-mir-128-2, bta-mir-143, bta-mir-146b, bta-mir-154a, bta-mir-181d, bta-mir-199a-2, bta-mir-218-1, bta-mir-32, bta-mir-326, bta-mir-429, bta-mir-449a, bta-mir-449b, bta-mir-449c, bta-mir-504, bta-mir-181a-1, bta-mir-181b-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2285c, bta-mir-449d, bta-mir-424, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Three (miR-192-5p, miR-32-3p, miR-122-5p) of these five miRNAs showed decreased expression level in yak, and one miRNA (miR-125-5p) was upregulated in yak. [score:6]
[1 to 20 of 1 sentences]
16
[+] score: 6
miR-125b was used as an endogenous control to normalize the target miRNA because this miRNA is expressed consistently in preimplantation mouse embryos [26]. [score:5]
Quantity of miR-181a was normalized to miR-125b. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 5
Other miRNAs from this paper: hsa-mir-17, hsa-mir-19a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-198, hsa-mir-208a, hsa-mir-10a, hsa-mir-223, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-155, hsa-mir-29c, hsa-mir-99b, hsa-mir-296, hsa-mir-196b, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-640, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-550a-3, bta-mir-29a, bta-mir-125b-1, bta-mir-126, bta-mir-10a, bta-mir-124a-1, bta-mir-17, bta-mir-29b-2, bta-mir-29c, bta-mir-150, bta-mir-122, bta-mir-19a, bta-mir-99b, hsa-mir-208b, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, bta-mir-124a-2, bta-mir-124b, bta-mir-146a, bta-mir-155, bta-mir-196b, bta-mir-208a, bta-mir-208b, bta-mir-223, bta-mir-296, bta-mir-29d, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, hsa-mir-548q, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, bta-mir-2284w, bta-mir-2284x, hsa-mir-548y, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, hsa-mir-548ay, hsa-mir-548az, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Tumor necrosis factor (TNF) biosynthesis, for example, is inhibited by Mycobacterium tuberculosis – an intracellular mycobacterial pathogen that infects alveolar macrophages – by altering levels of human macrophage miRNAs, including miR-125b and miR-155, for its own benefit (28). [score:3]
Hematopoietic stem cell differentiation into myeloid and lymphoid lineages, for example, has been shown to be under the influence of several miRNAs, including miR-125b, miR-126, and miR-196b (4, 18). [score:1]
Exosome miRNAs – including a number of immune-relevant ones, such as bta-miR-223 and bta-miR-125b – have been found in both human breast milk and bovine milk (54– 56). [score:1]
[1 to 20 of 3 sentences]
18
[+] score: 5
For example, five inflammation-related miRNAs (miR-9, miR-125b, miR-155, miR-146a and miR-223) were differentially expressed in bovine CD14+ monocytes stimulated with either LPS or Staphylococcus aureus enterotoxin B (SEB) [14]. [score:3]
Tili E. Michaille J. J. Cimino A. Costinean S. Dumitru C. D. Adair B. Croce C. M. Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-α stimulation and their possible roles in regulating theresponse to endotoxin shock J. Immunol. [score:2]
[1 to 20 of 2 sentences]
19
[+] score: 4
Estradiol suppresses NF-kappa B activation through coordinated regulation of let-7a and miR-125b in primary human macrophages. [score:4]
[1 to 20 of 1 sentences]
20
[+] score: 4
A study by Dilda et al. challenging bovine monocytes with E. coli LPS revealed the upregulation of miR-9, miR-125b, miR-155, miR-146a, and miR-223. [score:4]
[1 to 20 of 1 sentences]
21
[+] score: 3
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-10b, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
Skaftnesmo et al. (2017) explored which miRNAs regulate mRNAs during initiation of puberty, and several regulated miRNAs in the pubertal stage had earlier been associated (miR-20a, miR-25, miR-181a, miR-202, let7c/d/a, miR-125b, miR-222a/b, miR-190a) or have now been found connected (miR-2188, miR-144, miR-731, miR-8157) to the initiation of puberty. [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 3
Other miRNAs from this paper: bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-151, bta-mir-21, bta-mir-27a, bta-mir-125b-1, bta-mir-205, bta-mir-27b, bta-mir-193a, bta-mir-98, bta-let-7d, bta-mir-17, bta-mir-200a, bta-mir-200c, bta-mir-210, bta-mir-29b-2, bta-mir-29c, bta-let-7g, bta-mir-200b, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-100, bta-mir-130a, bta-mir-146a, bta-mir-155, bta-mir-184, bta-mir-219-1, bta-mir-223, bta-mir-28, bta-mir-494, bta-mir-708, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-2284w, bta-mir-2284x, bta-mir-3596, bta-mir-652, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-664b, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
A recent RT-qPCR study, for example, highlighted the differential expression of five inflammation related miRNAs (miR-9, miR-125b, miR-155, miR-146a and miR-223) in response to E. coli lipopolysaccharide (LPS) and S. aureus enterotoxin B stimulation of bovine monocytes [10]. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 3
Other miRNAs from this paper: bta-mir-125b-1, bta-mir-200a, bta-mir-204
A muscle-specific lncRNA, lncMD, functions as a ceRNA to sponge miR-125b, resulting in increasing expression of IGF2 (insulin like growth factor 2) to promote bovine muscle differentiation [36]. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
Data were normalized to abundance of miR-125b mRNA and expressed as relative fold change using the sample with the lowest value as the calibrator (mean ± SEM; n = 4 pools of five oocytes/embryos each). [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
A recent study using quantitative real time PCR technique revealed differential expression of five inflammation related miRNAs (miR-9, miR-125b, miR-155, miR-146a and miR-223) after stimulation of bovine monocytes with lipopolysaccharide (LPS) and S. aureus enterotoxin B [22]. [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
A differential expression of four immune related miRNAs, miR-125b, miR-155, miR-146a, and miR-223 upon stimulation of bovine monocytes with LPS or Staphylococcus aureus enterotoxin B was demonstrated (Dilda et al., 2012). [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
Finally, let-7 and miR-125b among other miRNAs have been shown to control mammary gland development and lactation [14]. [score:2]
[1 to 20 of 1 sentences]
28
[+] score: 1
Quantity of miRNA was normalized relative to abundance of miR-125b. [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
In contrast, the plasma samples were enriched with moderate concentrations of miRNAs associated with adipose tissue, such as miR-15a, miR-19a/b, miR-21, miR-27b, miR-92a/b, miR-103, miR-106a/b, miR-107, miR-125b, and miR-150 [11, 12]. [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-125b-1, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-155, hsa-mir-106b, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-151a, hsa-mir-450a-1, hsa-mir-452, hsa-mir-450a-2, hsa-mir-92b, hsa-mir-151b, hsa-mir-378d-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-151, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-92a-2, bta-let-7d, bta-mir-17, bta-mir-450a-2, bta-mir-7-3, bta-let-7f-1, bta-let-7c, bta-mir-15a, bta-mir-99b, hsa-mir-450b, bta-mir-106b, bta-mir-143, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-26a-1, bta-mir-378-1, bta-mir-452, bta-mir-92a-1, bta-mir-92b, bta-mir-7-2, bta-mir-7-1, bta-mir-181a-1, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, bta-mir-450a-1, bta-mir-378-2, hsa-mir-378b, bta-mir-2284w, bta-mir-2284x, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-450b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, hsa-mir-378j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-378b, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-378c, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, bta-mir-378d, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
7 mir-155 14,390 2,101.7 let-7c 14,020 2,047.7 mir-143 12,204 1,782.4 mir-181a-2//mir-181a-1 11,882 1,735.4 mir-146a 10,952 1,599.6 mir-15a 9,938 1,451.5 mir-99b 9,755 1,424.8 mir-148a 9,502 1,387.8 mir-125b-1//mir-125b-2 9,395 1,372.2 mir-106b 9,284 1,356.0 mir-26b 9,146 1,335.8 mir-16b 8,750 1,278.0 let-7d 8,273 1,208.3 mir-16a 8,007 1,169.5 mir-92//mir-92a 7,427 1,084.7 mir-7//mir-7-2//mir-7-1 6,852 1,000.8 Fig. 2IsomiRs and detection of star sequences. [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
Pogue AI MicroRNA-125b (miRNA-125b) function in astrogliosis and glial cell proliferationNeurosci Lett. [score:1]
[1 to 20 of 1 sentences]
32
[+] score: 1
Recently, 200–300 nm large, miRNA-223- and miRNA-125b-enriched EVs have been demonstrated in cow’s milk that also resist digestion under simulated gastrointestinal tract conditions [66]. [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
In total, 22 miRNAs (bta-miR-21-5p, -miR-143, -miR-10b, -let-7i, -miR-202, -miR-148a, -let-7f, -miR-3600, -miR-99a55p, -let-7a-5p, -miR-27b, -miT-100, -let7g, -miR-26a, -miR-378, -miR-30d, -miR-125b, -450a, -miR-30e-5p, -let-7b, -miR-199a-3p, and -miR-26c) contributed to the top twenty most abundantly sequenced miRNAs in the bovine CL. [score:1]
[1 to 20 of 1 sentences]
34
[+] score: 1
# 4427975: hsa-miR-1-3p (002222), hsa-miR-16-5p (000391), hsa-miR-125b-5p (000449), hsa-miR-223-3p (002295), hsa-miR-29b-3p (000413), ath-MIR156a (000333), ath-MIR166a (000347), and cel-miR-39 (000200); and ath-MIR167a (000348) under "Made to Order" Cat. [score:1]
[1 to 20 of 1 sentences]
35
[+] score: 1
These included bta-miR-125b (16,807), bta-miR-16b (1023), bta-miR-92a (5157), bta-miR-378 (2098), bta-miR-940 (1435) and bta-miR-2284x (31,532). [score:1]
[1 to 20 of 1 sentences]