sort by

83 publications mentioning mmu-mir-92b

Open access articles that are associated with the species Mus musculus and mention the gene name mir-92b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 377
All n = 3; bar, SEM; * P < 0.05; ** P < 0.01; *** P < 0.001; Student’s t test MiR-92b-3p bound to the 3′-untranslated region (UTR) of GABRA3 and inhibited its expressionTo further elucidate the potential molecular mechanisms involved, a target prediction program (TargetScan Release 7.0: http://www. [score:10]
For the inhibition and overexpression of miR-92b-3p and Gabra3, AsPC-1 and SW1990 cells were cultured to 60–70% confluence and then transfected with a miR-92b-3p mimic, miR-92b-3p inhibitor, GABRA3 overexpression vector, GABRA3 shRNAs (GCTGAAGTGGTTTATTCTTGG and GCTCTTTGCCATATTCAATCT) or respective controls (GenePharma, Shanghai, China) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. [score:9]
Collectively, miR-92b-3p directly targeted and reduced Gabra3 expression levels, which led to suppressed proliferation, migration, and invasion in PC cells via the AKT/mTOR and JNK pathways. [score:8]
Mechanistically, miR-92b-3p overexpression suppressed Gabra3 expression, which then led to the inactivation of important oncogenic pathways, including the AKT/mTOR and JNK pathways. [score:7]
In addition, the in vivo and in vitro experiments reveal that increased expression levels of miR-92b-3p suppress cell proliferation, migration, and invasion by targeting GABRA3 in PC cells. [score:7]
Here, we provide evidence that miR-92b-3p acted as a tumor suppressor in PC by regulating Gabra3 expression. [score:6]
Bar, SEM; * P < 0.05; ** P < 0.01; *** P < 0.001; Student’s t test or Fisher’s exact test Altered miR-92b-3p expression levels have been found in various types of tumors, but whether miR-92b-3p expression is involved in PC development remains unknown. [score:6]
Our results show that miR-92b-3p expression is down-regulated in PC tissues and cell lines and inversely related to clinical tumor size, lymph node metastasis, TNM stage and poor prognosis. [score:6]
Altered miR-92b-3p expression levels have been found in various types of tumors, but whether miR-92b-3p expression is involved in PC development remains unknown. [score:6]
Moreover, miR-92b-3p overexpression inhibited proliferation, migration and invasion in PC cells, but miR-92b-3p knockdown yielded opposite effects in vitro and in vivo. [score:6]
MiR-92b-3p bound to the 3′-untranslated region (UTR) of GABRA3 and inhibited its expression. [score:6]
Among them, we found that GABRA3 was the only one that had similar expression level changes in AsPC-1 and SW1990 cells; Gabra3 expression levels were increased with antisense-miR-92b-3p transfection and reduced with miR-92b-3p mimic transfection (Fig. 3a-d). [score:5]
a A heat map of the expression changes of 9 candidate genes predicted to be targets of miR-92b-3p in PC cells transfected with miR-92b-3p mimic, antagomir, or negative control. [score:5]
However, among the nine candidate genes (including CDKN1C) predicted by TargetScan Release 7.0, only GABRA3 had changes similar to the altered miR-92b-3p expression levels. [score:5]
The 3′-UTR fragment from GABRA3 mRNA containing the predicted miR-92b-3p binding site was amplified by PCR and then cloned into a pGL3 dual-luciferase miRNA target expression vector (Promega) to form the reporter vector (GABRA3-WT). [score:5]
In another report, miR-92b-3p targeted the PTEN/Akt signaling pathway to suppress proliferation, invasion and migration and stimulate apoptosis in glioma cells [25]. [score:5]
After synthesizing cDNAs with a miRNA cDNA Synthesis Kit (Takara, Shiga, Japan) and a Reverse Transcriptase MMLV Kit (Invitrogen), the expression levels of miR-92b-3p and its target genes were analyzed using SYBR Premix Ex Taq (Takara) and an Applied Biosystems ViiA™ 7 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). [score:5]
Our results suggest that miR-92b-3p acted as a tumor suppressor by targeting Gabra3 -associated oncogenic pathways; these results provide novel insight into future treatments for PC patients. [score:5]
MiR-92b-3p overexpression decreased the levels of proteins related to the AKT/mTOR and JNK pathways, and this function of miR-92b-3p could occur through direct or indirect mechanisms. [score:5]
These findings suggest that the miR-92b-3p/Gabra3 axis is an important regulator of PC development and progression; these results provide potential targets for future PC treatments. [score:5]
Pearson χ2 tests were used to analyze the association between miR-92b-3p expression levels and GABRA3 expression levels. [score:5]
In addition, the tumors that formed due to miR-92b-3p overexpression also had fewer Ki-67 [+] cells and lower Gabra3, p-mTOR, p-p70s6k, MMP-2 and MMP-9 expression levels than those in the control group (Fig. 8g-j). [score:5]
In an effort to identify the downstream players, we found that miR-92b-3p directly regulated Gabra3 expression to modify the biological behavior of PC cells. [score:5]
Interestingly, GABRA3 and miR-92b-3p co-overexpression attenuated the tumor inhibitory role of miR-92b-3p, as shown by increased proliferation (Fig.   6a-f), migration (Fig. 6g-i) and invasion (Fig. 6j-l) in both AsPC-1 and SW1990 cells. [score:5]
To determine whether miR-92b-3p directly regulated Gabra3 expression, the 3′-UTR of GABRA3, which was predicted to interact with miR-92b-3p, was cloned into a pGL3.0 luciferase reporter vector (Fig.   4e). [score:5]
In addition, Gabra3 overexpression abolished these regulatory effects of miR-92b-3p in both AsPC-1 and SW1990 cells (Fig. 7f-g), further supporting that miR-92b-3p regulates Gabra3. [score:5]
MiR-92b-3p overexpression suppressed the proliferation and invasion of PC cells in both in vivo and in vitro mo dels. [score:4]
Taken together, these results imply that reduced miR-92b-3p expression levels may play an important role in the development and progression of PC. [score:4]
k Proposed mo del for how miR-92b-3p regulates PC cell proliferation and metastasis by targeting Gabra3 via the AKT/mTOR and JNK pathways. [score:4]
It has been suggested that phosphorylated ΔNp63α can up-regulate miR-92b-3p in squamous cell carcinomas [35]. [score:4]
These results seem to contradict previous findings showing that increased miR-92b-3p levels targeted the PTEN/Akt signaling pathway in gliomas [25]; however, these results probably also reflect the complicated and coordinated network that exists in cancer development, which could ultimately promote the malignant progression of cancers. [score:4]
Taken together, these data imply that miR-92b-3p likely suppressed PC cell proliferation and metastasis through regulating Gabra3. [score:4]
However, Gabra3 overexpression abolished the regulatory effects of miR-92b-3p on the AKT/mTOR and JNK pathways. [score:4]
Taken together, these results suggest that miR-92b-3p can directly modulate Gabra3 expression in PC. [score:4]
Consistently, gelatin zymography assays showed that MMP-2 and MMP-9 enzymatic activities were increased in PC cells expressing low levels of miR-92b-3p; however, their activities were decreased in PC cells overexpressing miR-92b-3p (Fig. 7d-e). [score:4]
Our present study revealed that miR-92b-3p can regulate the proliferation, migration, and invasion of PC cells through modifying Gabra3 expression. [score:4]
Matrigel transwell assays showed a similar phenomenon in which miR-92b-3p overexpression inhibited invasion, and decreased miR-92b-3p levels accelerated AsPC-1 and SW1990 cell invasion (Fig. 3c-d). [score:4]
Consistently, AsPC-1 and SW1990 cells overexpressing miR-92b-3p had decreased p-AKT, p-mTOR and p-p70s6k levels, as well as decreased p-JNK1/2, p-c-Jun, MMP-2 and MMP-9 protein levels (Fig. 7c). [score:3]
Moreover, lower miR-92b-3p expression levels in various PC cell lines than in normal pancreatic epithelial cells was also detected (Fig. 1d). [score:3]
Cell apoptosis was not affected by altered miR-92b-3p expression levels (Fig. 2f-g). [score:3]
The oncogenic roles of miR-92b-3p have been demonstrated primarily in regulating glioblastoma development [24, 25]. [score:3]
Taken together, our data suggest an important role for miR-92b-3p in suppressing PC growth and metastasis in vivo. [score:3]
c-es in PC cells transfected with miR-92b-3p mimic, inhibitor, or negative control. [score:3]
c Immunoblotting analyses of the levels of proteins in the AKT/m-TOR and JNK pathways in PC cells after transfection with miR-92b-3p mimic, inhibitor, or negative control. [score:3]
Consistent with the in vitro findings, AsPC-1 cells overexpressing miR-92b-3p had slower tumor growth rates and lower tumor volumes, tumor weights, and tumor formation frequencies than the control group (Fig.   8a-d). [score:3]
Previous studies have found that miR-92b-3p can control cell cycle progression through targeting CDKN1C [28]. [score:3]
b ISH analyses of miR-92b-3p expression levels in 82 FFPE PC and CNP tissues. [score:3]
In situ hybridization (ISH) staining confirmed remarkably lower miR-92b-3p expression levels in 82 formalin-fixed paraffin-embedded (FFPE) PC tissue samples than the CNP tissues (Fig. 1b-c). [score:3]
This study revealed a novel tumor-suppressing mechanism in PC, indicating that miR-92b-3p may serve as a diagnostic and prognostic biomarker in PC patients. [score:3]
Correlation between miR-92b-3p expression and clinico-pathologic features. [score:3]
Together, these results suggest that miR-92b-3p can inhibit the proliferation and invasion of PC cells in vitro. [score:3]
a- c Tumor growth curve and tumor weights after AsPC-1 cells stably expressing miR-92b-3p or empty vector were injected into nude mice. [score:3]
Combined with two other breast cancer and lung adenocarcinoma studies indicating the influence of Gabra3 on the AKT/mTOR, and JNK pathways [20, 31], we suggest that the regulatory role of miR-92b-3p in the AKT/mTOR and JNK pathways might be indirect and Gabra3 -dependent. [score:3]
j analyses to detect MMP-2 and MMP-9 activities in tumor xenografts from the miR-92b-3p overexpression and control groups. [score:3]
The oncogenic regulatory role of the miR-92b-3p/Gabra3 axis was further demonstrated via modulation of the AKT/mTOR and JNK regulatory pathways. [score:3]
We further studied the relationship between miR-92b-3p expression levels and clinico-pathologic features in 82 PC patients. [score:3]
Conversely, the opposite effect was shown in PC cells transfected with miR-92b-3p inhibitor (Fig. 2a-e). [score:3]
While 70% mice in the control group had liver metastases, they were rarely detected in the group overexpression miR-92b-3p (Fig. 8e-f). [score:3]
Fig. 1Reduced miR-92b-3p expression levels were found in PC tissues and cell lines. [score:3]
b-d qPCR and immunoblotting analyses of the GABRA3 expression levels in PC cells transfected with miR-92b-3p mimic, antagomir, or negative control. [score:3]
To better understand the reliance of miR-92b-3p on Gabra3 in modulating the biological behavior of PC cells, we then overexpressed GABRA3 and miR-92b-3p and examined cell proliferation, migration and invasion abilities. [score:3]
Reduced miR-92b-3p expression levels correlated well with larger tumor sizes, higher lymph node metastasis rates and advanced tumor/node/metastasis (TNM) stages (Fig. 1e-h). [score:3]
e-g Association analyses of miR-92b-3p expression levels and tumor size, lymph node metastasis and TNM stage. [score:3]
a qPCR analyses of the expression levels of miR-92b-3p in 46 fresh PC and CNP tissues. [score:3]
AsPC-1 cells stably overexpressing miR-92b-3p were created according to a previously described procedure [37]. [score:3]
d Comparison of miR-92b-3p expression levels in the PC cell lines with those in normal pancreatic epithelial cells by qPCR. [score:3]
org/vert_71/) [21] was utilized to predict the possible targets of miR-92b-3p. [score:3]
g-i Immunohistochemistry and qPCR analyses to detect the number of Ki-67 [+] cells and the protein and mRNA levels of Gabra3, MMP-2 and MMP-9 in tumor xenografts from the miR-92b-3p overexpression and control groups. [score:3]
For example, it was suggested that miR-92b-3p overexpression increased viability in glioblastoma cells through repressing the TGF-beta/smad3/p21 signaling pathway [24]. [score:3]
In our study, we used both in vitro and in vivo assays to confirm the tumor inhibitory role of miR-92b-3p in PC development. [score:3]
Tumor volume analyses were based on the equation: V = (length × width [2]) / 2. For the tumor metastasis study, miR-92b-3p -overexpressing and negative control AsPC-1 cells (1 × 10 [6]) were transplanted onto the head or body of the pancreas of the mice (males, n = 5; females, n = 5). [score:3]
We also noted that tumors with high miR-92b-3p expression levels often had a reduced number of Ki-67 [+] (cell proliferation marker) positive cells (Fig. 7a-b). [score:3]
By using clinical PC tissue samples, we demonstrated an inverse relationship between miR-92b-3p and Gabra3 expression levels; these levels are also tightly correlated with PC patient prognosis. [score:3]
f Immunoblotting analyses to detect p-p70s6k, MMP-2 and MMP-9 protein expression in PC cell lines co -transfected with the miR-92b-3p mimic and GABRA3 construct. [score:3]
In our study, increased enzymatic activities and levels of MMP-2 and MMP-9 were found when miR-92b-3p expression was decreased; these effects could accelerate the migration and metastasis rates in PC via Gabra3. [score:3]
MiR-92b-3p expression levels were lower in PC tissues than corresponding noncancerous pancreatic (CNP) tissues and were associated with a poor prognosis in PC patients. [score:2]
MiR-92b-3p inhibited PC cell proliferation and invasion in vitro. [score:2]
The dysregulation of miR-92b-3p has been reported in several types of tumors, but these results are contradictory. [score:2]
All n = 3; bar, SEM; Compared with negative control group, n. s., no significant difference, * P < 0.05, ** P < 0.01, *** P < 0.001, Student’s t test Fig. 6Gabra3 restoration reversed the miR-92b-3p -mediated inhibition of cell growth, migration and invasion in PC. [score:2]
As with pancreatic cancer, the genes involved in regulating miR-92b remain unknown. [score:2]
First, we found that miR-92b-3p expression levels were obviously decreased in 46 fresh PC tissues compared with those in the paired corresponding non-cancerous pancreatic (CNP) tissues (Fig.   1a). [score:2]
Conversely, miR-92b-3p knockdown induced an aggressive phenotype in PC cells. [score:2]
MiR-92b-3p expression levels were reduced in human PC tissues and cell lines. [score:2]
Gabra3 was involved in the miR-92b-3p -mediated regulation of PC cell growth, migration, and invasion. [score:2]
The putative binding site of miR-92b-3p in the Gabra3 3′-UTR was mutated by using a site-directed mutagenesis kit (TransGen Biotech, Beijing, China), and the new reporter vector was called GABRA3-MU. [score:2]
Another study of epithelial ovarian cancer revealed that miR-92b could be regulated by aldehyde dehydrogenase 1 family member A2 (ALDH1A2) and protocadherin 9 (PCDH9) [36]. [score:2]
MiR-92b-3p inhibited cancer cell proliferation and metastasis in vivo. [score:2]
e A putative miR-92b-3p -binding site (wild type, WT) existed in the 3′-UTR of Gabra3 mRNA, and a nucleotide mutation (mutant, MU) was created at the binding site. [score:2]
The miR-92b-3p/Gabra3 axis regulated the AKT/mTOR and JNK pathways to modify PC proliferation and metastasis. [score:2]
Dual luciferase assays showed that while miR-92b-3p suppressed the luciferase activity of the reporter containing the wild type 3′-UTR of GABRA3 in both AsPC-1 and SW1990 cells, the effect was obviously abrogated with the mutated reporter (Fig. 4f-g). [score:2]
These results improve our understanding of PC-related miRNAs and support the development of miR-92b -based therapies for the treatment of PC. [score:2]
Furthermore, Western blot assays confirmed that miR-92b-3p regulated Gabra3. [score:1]
b Association analyses of miR-92b-3p levels and the number of Ki-67 [+] cells and the levels of p-p70s6k, MMP-2 and MMP-9 in 82 FFPE PC tissues. [score:1]
e Effects of miR-92b-3p on tumor metastases in nude mice. [score:1]
To study the role of miR-92b-3p in modulating PC metastasis in vivo, all the livers of the xenograft nude mice were stained with hematoxylin-eosin (HE) to assess metastasis lesions. [score:1]
After incubation with 5× SSC solution at room temperature for 15 min, miR-92b-3p probes were added for hybridization at 50 °C overnight. [score:1]
Xenograft mouse mo dels were used to assess the role of miR-92b-3p in PC tumor formation in vivo. [score:1]
Investigations regarding the molecular mechanisms have proposed that miR-92b-3p targets the integrin α6/Akt axis or RAB23, a member of the Ras-related small GTPase family [27]. [score:1]
However, anti-tumor effects of miR-92b-3p have also been reported [26, 27]. [score:1]
In our study, we found that miR-92b-3p levels were obviously reduced in PC tissues and cell lines and correlated well with the prognosis of PC patients. [score:1]
h Pearson χ2 tests were used to analyze the association of miR-92b-3p levels with GABRA3 levels in 46 pairs of PC and CNP tissues. [score:1]
Higher miR-92b levels have been inversely correlated with lymph node metastasis and better esophageal squamous cell carcinoma prognosis [26]. [score:1]
We propose that miR-92b-3p interacts with Gabra3 via its mRNA 3′-UTR. [score:1]
c Representative images of the ISH staining analyses of 82 FFPE PC and CNP tissues using the anti-miR-92b-3p probe. [score:1]
h Kaplan-Meier analyses of postoperative survival in PC patients stratified by miR-92b-3p levels. [score:1]
To evaluate cell proliferation in vivo, miR-92b-3p -overexpressing and negative control AsPC-1 cells (2 × 10 [6]) were subcutaneously injected into the right and left hind footpads of the mice (males, n = 5; females, n = 5). [score:1]
The expression levels of miR-92b-3p and Gabra3 were measured by quantitative PCR (qPCR), immunoblotting, in situ hybridization (ISH) and immunohistochemistry (IHC). [score:1]
f-g Flow cytometric analyses of Annexin V-FITC staining were used to quantify apoptosis induced by miR-92b-3p. [score:1]
The human miR-92b-3p construct was created by inserting the coding sequence (CDS) of miR-92b-3p into the pCDH-CMV-MCS-EF1-copGFP vector (System Biosciences, Palo Alto, CA, USA). [score:1]
The miR-92b-3p mimic and control were co -transfected into AsPC-1 and SW1990 cells. [score:1]
Ultimately, nine candidate genes that could interact with miR-92b-3p were selected for verification. [score:1]
f H&E staining of the liver after injection of AsPC-1 cells transfected with miR-92b-3p or empty vector. [score:1]
Dual-luciferase reporter assays were used to determine how miR-92b-3p regulates Gabra3. [score:1]
Further studies of PC are needed to define the function of the miR-92b -mediated molecular signaling pathway in controlling PC initiation and progression. [score:1]
g analyses to detect MMP-2 and MMP-9 activities in PC cell lines co -transfected with miR-92b-3p mimic and GABRA3 construct. [score:1]
All n = 3; bar, SEM; * P < 0.05; ** P < 0.01; *** P < 0.001; Student’s t test PC xenograft mouse mo dels were then used to determine the function of miR-92b-3p in vivo. [score:1]
ISH was used to detect miR-92b-3p in tissue microarrays using digoxigenin-labeled sense and antisense miR-92b-3p probes. [score:1]
Our results suggest that reduced miR-92b-3p levels increased Gabra3 levels, which led to AKT/mTOR and JNK pathway activation in PC cells. [score:1]
In addition, a reporter carrying a mutated miR-92b-3p binding site was also created (Fig. 4e). [score:1]
The results showed that AsPC-1 and SW1990 cells with increased miR-92b-3p levels had slower recovery rates than those of control cells; however, decreased miR-92b-3p levels in PC cells led to faster wound closure than in control cells (Fig.   3a-b). [score:1]
Inverse relationships between miR-92b-3p and Gabra3, as well as p-p70s6k, MMP-2 and MMP-9, were also identified (Fig. 7a-b). [score:1]
d-e MMP-2 and MMP-9 activities were measured by gelatin zymography in AsPC-1 and SW1990 cells after transfection with miR-92b-3p mimic, inhibitor, or negative control. [score:1]
a Clinical specimens of normal pancreatic epithelium and PC with low and high TNM stages were stained for miR-92b-3p, Gabra3, Ki-67, p-p70s6k, MMP-2 and MMP-9. Representative images from a tissue microarray are shown. [score:1]
Thus, on the one hand, the seemly distinct functions of miR-92b-3p in different types cancers reflect the intrinsic complexities and diversities of tumor biology; on the other hand, these distinct functions remind us that the biological roles of miRNAs could be context -dependent and that caution should be exercised when using miRNA therapies in clinical patients. [score:1]
Data were analyzed by using the 2 [−ΔΔCT] method and presented as relative to the GAPDH mRNA and RNU6B levels for miR-92b-3p. [score:1]
Moreover, an inverse relationship between Gabra3 and miR-92b-3p was also identified in 46 fresh PC and paired CNP tissues (Fig. 4h). [score:1]
[1 to 20 of 126 sentences]
2
[+] score: 213
Our results demonstrated that miR-92b-3p negatively regulated MEF2D expression by directly targeting the 3′untranslated region (UTR) of MEF2D mRNA. [score:9]
Up-regulation of microRNA-92b-3p (miR-92b-3p) and the suppressive effect of miR-92b-3p on expressions of ANP, ACTA1 and β-MHC in Ang-II -induced mouse cardiomyocytes. [score:8]
Our data has also revealed that miR-92b-3p inhibits hypertrophic phenotype in cardiomyocytes through down-regulation of transcription factor MEF2D expression. [score:8]
Consistently, the up-regulations of ANP, ACTA1 and β-MHC protein in Ang-II -induced NMVCs were significantly suppressed by over -expression of miR-92b-3p (Figure 3G). [score:8]
Moreover, in parallel with the findings with MEF2D siRNA, over -expression of miR-92b-3p decreased the cell size of cardiomyocytes and inhibited the expressions of ANP, ACTA1 and β-MHC in Ang-II -induced mouse cardiomyocytes. [score:7]
In the present study, RT-qPCR results revealed that NF-κB P65 inhibitor JSH23 or QNZ could efficiently abolish the upregulation of miR-92b-3p by Ang-II in NMVCs (p<0.05, p<0.01, respectively) (Figure 3D). [score:6]
Moreover, knockdown of MEF2D by miR-92b-3p or siRNA targeting MEF2D inhibited Ang-II -induced cardiomyocyte hypertrophy in vivo and in vitro, respectively. [score:6]
In the present study, we confirmed that NF-κB P65 inhibitor JSH23 or QNZ could efficiently abolish the upregulation of miR-92b-3p in Ang-II -induced NMVCs. [score:6]
Our current study has provided several lines of evidence to support the notion that miR-92b-3p inhibits cardiac hypertrophy through targeting MEF2D. [score:5]
Our data suggest that MEF2D is a novel target of miR-92b-3p in myocardial hypertrophy, and enhancement of miR-92b-3p expression may be protective against myocardial hypertrophy. [score:5]
N=6-8. MRNA and protein expressions of MEF2D in Ang-II -treated NMVCs (E) and in Ang-II -induced NMVCs with overexpression of miR-92b-3p (F). [score:5]
Moreover, mRNA and protein expression of MEF2D were also shown increased in Ang-II -treated NMVCs (Figure 4E), but was reversed in Ang-II -induced NMVCs with enforced expression of miR-92b-3p (Figure 4F). [score:5]
Meanwhile, Western blot results demonstrated that expression of ANP, ACTA1 and β-MHC in mouse myocardium in response to Ang-II infusion was also suppressed by miR-92b-3p delivery (p<0.05, p<0.01, p<0.001, respectively) (Figure 2D). [score:5]
Additionally, miR-92b-3p mimic inhibited MEF2D expression at both mRNA and protein levels in mouse cardiomyocytes. [score:5]
Consistently, miR-92b-3p also significantly attenuated the upregulations of ANP, ACTA1 and β-MHC by Ang-II in vivo and in vitro. [score:4]
Consistently, the Western blot results showed that the up-regulations of ANP, ACTA1, β-MHC and MEF2D by Ang-II in NMVCs could be reversed by miR-92b-3p mimic and MEF2D siRNA, respectively (Figure 5B). [score:4]
Down-regulation of microRNA-92b-3p (miR-92b-3p) in the hypertrophic myocardium. [score:4]
Since our data showed that miR-92b-3p was markedly down-regulated in the myocardium of Ang-II-infused mice. [score:4]
We verified that miR-92b-3p was upregulated in Ang-II -induced hypertrophic mouse cardiomyocytes in this study. [score:4]
Importantly, the upregulations of MEF2D mRNA and protein by Ang-II in cardiomyocytes could be reversed by miR-92b-3p in vivo and in vitro. [score:4]
Meanwhile, miR-92b-3p was observed upregulated in Ang-II -treated NMVCs (p<0.01) (Figure 3C). [score:4]
N = 3. (D) MiR-92b-3p expression in Ang-II -induced NMVCs with pre-treatment with the NF-κB inhibitor JSH23 or QNZ, respectively. [score:4]
Taken together, our data have demonstrated that miR-92b-3p is down-regulated in cardiac hypertrophy, and miR-92b-3p ameliorates cardiac hypertrophic responses in vivo and in vitro. [score:4]
These data revealed that NF-κB signaling mediates the upregulation of miR-92b-3p in Ang-II -induced mouse cardiomyocytes. [score:4]
Results of showed that miR-92b-3p mimic and MEF2D siRNA could efficiently suppress the increase of cell size of Ang-II -induced NMVCs (Figure 5A). [score:3]
MiR-92b-3p regulates Mef2 levels through a negative-feedback circuit during Drosophila muscle development [13], but the role of miR-92b-3p in cardiac hypertrophy has not been well understood. [score:3]
MicroRNA-92b-3p (miR-92b-3p) suppresses the hypertrophic phenotype of NMVCs in vitro. [score:3]
MiR-92b-3p attenuates Ang-II -induced cardiac hypertrophy in vivo To further demonstrate the potential role of miR-92b-3p in Ang-II -induced cardiac hypertrophy, we determined whether restoring miR-92b-3p expression via tail vein injection of miR-92b-3p agomir could exert protective effect on the cardiac hypertrophy. [score:3]
Either miR-92b-3p mimic or MEF2D siRNA could efficiently inhibit Ang-II -induced hypertrophy in neonatal mouse ventricular cardiomyocytes (NMVCs). [score:3]
Then, we examined the expression of MEF2D in NMVCs after transfection with miR-92b-3p mimic. [score:3]
Figure 5MicroRNA-92b-3p (miR-92b-3p) suppresses the hypertrophic phenotype of NMVCs in vitro (A) Morphologies of Ang-II -treated NMVCs as revealed by. [score:3]
Therefore, the present study suggests that miR-92b-3p might be a potential target for prevention and treatment of cardiac hypertrophy. [score:3]
The size of cardiomyocytes was markedly increased in the myocardium of Ang-II-infused mice, but which could be reversed by the enforced expression of miR-92b-3p (p<0.05, p<0.01, respectively) (Figure 2C). [score:3]
org) showed that MEF2D was a potential target gene of miR-92b-3p. [score:3]
N = 3. (F) of Ang-II -induced NMVCs with overexpression of miR-92b-3p. [score:3]
The relative ratio of the FL/RL was used to indicate the suppression of MEF2D by miR-92b-3p. [score:3]
NMVCs were also transfected with 50 nM scramble or miR-92b-3p mimic, or 50 nM siRNA targeting MEF2D (Ribobio, Guangzhou, China) by oligofectamine reagent (Invitrogen, Carlsbad, CA), respectively. [score:3]
N = 8. To further demonstrate the potential role of miR-92b-3p in Ang-II -induced cardiac hypertrophy, we determined whether restoring miR-92b-3p expression via tail vein injection of miR-92b-3p agomir could exert protective effect on the cardiac hypertrophy. [score:3]
The matching positions for miR-92b-3p within 3′-UTR of the targeted mRNA is shown in Figure 4A. [score:3]
Phenotype of cardiac hypertrophy of Ang-II-infused mice with enforced expression of miR-92b-3p. [score:3]
Decreased expression of miR-92b-3p in the hypertrophic myocardium. [score:3]
Verification of MEF2D as a target gene of miR-92b-3p. [score:3]
MicroRNA-92b-3p (miR-92b-3p) negatively modulates MEF2D expression. [score:3]
First, the in silico prediction indicated that MEF2D was a potential target of miR-92b-3p, and the dual luciferase assay revealed that miR-92b-3p specifically bound to the 770-777 site in the 3′-UTR of MEF2D. [score:2]
Nevertheless, the mechanism underlying the down-regulation of miR-92b-3p in human and mouse hypertrophic myocardium warrants further investigation. [score:2]
Using a site-directed mutagenesis kit (TransGen, Beijing, China), the miR-92b-3p binding site sequence GTGCAAT was replaced with GTCGTTT to construct the corresponding recombinant luciferase reporter plasmid containing the mutant potential miR-92b-3P binding sequences. [score:2]
Compared with the negative scramble control, mRNA and protein expression of MEF2D were significantly decreased in miR-92b-3p -modified NMVCs (p<0.05, respectively) (Figure 4B). [score:2]
Additionally, miR-92b-3p agomir could significantly attenuate the compensatory increases of EF and FS in Ang-II-infused mice (Figure 2A, 2B). [score:1]
Consistently, RT-qPCR results showed that miR-92b-3p was also decreased in human hypertrophic myocardium (Figure 1G). [score:1]
To normalize RNA content, U6 was used for miR-92b-3p template normalization and GAPDH was used for coding genes template normalization. [score:1]
MicroRNA-92b-3p (miR-92b-3p) was shown elevated in peripheral blood of patients with chronic systolic heart failure [12]. [score:1]
According to our previous report [34], the recombinant luciferase reporter plasmid containing the potential miR-92b-3p binding site sequences of MEF2D gene was constructed. [score:1]
Therefore, our data demonstrated a protective role of miR-92b-3p in cardiac hypertrophy. [score:1]
The amount of 20 nmol NC agomir or 20 nmol miR-92b-3p agomir was delivered into each mouse via tail vein injection at 4 interval time points within 14 d. Left ventricular (LV) function variables were assessed by transthoracic echocardiography 2 weeks after the mini-osmotic pump implant surgery. [score:1]
MiR-92b-3p mimic and MEF2D siRNA were transfected into NMVCs, followed by assay and determining the expressions of hypertrophy-related genes. [score:1]
As expected, the compensatory increase of heart function was restored and the altered cardiac structures were also reversed by miR-92b-3p in Ang-II-infused mice. [score:1]
Results of echocardiography showed that the thickened LV walls (LVPWd, LVPWs) and decrease in the LV volume (LVd, LVs) were reversed in Ang-II-infused mice received miR-92b-3p agomir injection. [score:1]
Predicted miR-92b-3p seed matches to the sequence in the 3′UTR of MEF2D mRNA. [score:1]
In the present study, miR-92b-3p was observed significantly decreased in Ang-II infusion mouse mo del of cardiac hypertrophy. [score:1]
Additionally, decrease of miR-92b-3p was also observed in the myocardium of patients with hypertrophy. [score:1]
Enforced enhancement of miR-92b-3p ameliorated angiotensin II (Ang-II) infusion -induced cardiac hypertrophy in mice. [score:1]
Human embryonic kidney (HEK) 293 cells (3×10 [5] cells per well in the 12-well plate) were cotransfected with 200 ng of recombinant luciferase reporter plasmid, 50 nM miR-92b-3p mimic, and 20 ng of pRL-TK plasmid as an internal control (Promega, Madison, WI). [score:1]
N = 3. (E) Determination of miR-92b-3p level in NMVCs. [score:1]
Contrast to the previous report that miR-92b-3p was elevated in peripheral blood of patients with chronic heart failure [12], our present data indicated that the increased circulating miR-92b-3p may not derived from the myocardium of patients with cardiac hypertrophy. [score:1]
In this study, we observed a significant decrease of miR-92b-3p in mouse and human hypertrophic myocardium. [score:1]
Quantitative reverse-transcription PCR (qRT-PCR) for miR-92b-3p was performed on cDNA generated from 0.5 μg total RNA according to the manufacturer's protocol (Ribobio, China). [score:1]
The seed sequence of miR-92b-3p is UAACGUGA, and the complementary nucleotide sequences are shown in red words. [score:1]
[1 to 20 of 67 sentences]
3
[+] score: 34
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-132, mmu-mir-133a-1, mmu-mir-136, mmu-mir-144, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-203, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-215, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-127, hsa-mir-136, hsa-mir-146a, hsa-mir-185, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, hsa-mir-193b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, mmu-mir-486b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
[1 to 20 of 2 sentences]
4
[+] score: 34
It was also of interest that the expression of several miR-92 cluster members (17, 18a, 19a, 20a, 20b and 106a) was inversely correlated with TIMP2 expression in a panel of primary neuroblastoma tumors, and that low expression of TIMP2 in tumors is associated with poor overall and event free patient survival (Figure S9). [score:7]
Overall, members of the miR-92 clusters mapping to chromosome 13 and X had significantly lower expression in the miR-34a treated tumors relative to negative control, presumably due to the substantial decrease in MYCN levels resulting from miR-34a targeting (Figure 6D and E). [score:5]
Treatment of these cells with doxycycline repressed both MYCN expression (∼50 fold; Figure 6F) and the expression of miR-92 cluster members (5 to 10 fold; Figure 6G), resulting in an approximate 4 fold increase in TIMP2 mRNA (Figure 6F). [score:5]
Co-transfection of this construct with miR-20b mimics into NB1691 cells significantly reduced luciferase activity relative to a negative control oligonucleotide (Figure 6H), while mutation of the seed site abrogated the effect of miR-20b on luciferase activity, thus we conclude that miR-20b, and potentially other miR-92 family members directly target TIMP2. [score:5]
Intriguingly, several members of the oncogenic miR-92 polycistronic clusters mapping to chromosomes 13 and X, which are positively regulated by MYCN binding to their promoter regions [55], [56], are computationally predicted to target the TIMP2 3′ UTR (Figure 6C). [score:4]
In order to confirm that TIMP2 was a direct target of miR-92 cluster members, a segment of the TIMP2 3′ UTR containing the miR-20b, miR-17-5p, miR-106a and miR-20a seed site (all the same sequence, Figure 6C) was cloned into a luciferase reporter plasmid. [score:4]
In order to experimentally confirm that MYCN was repressing TIMP2 through the up-regulation of miR-92 cluster members, we used the well characterized SHEP-TET21N cell line containing a repressible MYCN transgene to determine if TIMP2 levels increased when MYCN levels were repressed. [score:2]
As demonstrated in this report, the decline in MYCN corresponded with a decrease in the levels of miR-92 polycistronic cluster members in NB1691 tumors, which are positively regulated by this transcription factor. [score:2]
[1 to 20 of 8 sentences]
5
[+] score: 30
Five of these [miR-34b-3p, miR-34c-5p, miR-34b-5p, miR-92b-3p, and miR-182-5p; as well as miR-31-5p, which was identified through literature search (41)] belonged to the aforementioned seven miRNAs which were expressed more highly in the C57BL/6J mice and downregulated throughout the time course. [score:6]
Furthermore, seven miRNAs were expressed more highly in C57BL/6J mice and were mainly downregulated across the time course (miR-92b-3p, miR-34b-5p, miR-672-5p, miR-31-5p, miR-34c-5p, miR-34b-3p, and miR-182-5p; listed in descending order according to the heat map in Figure 5). [score:6]
These are comprised of miRNAs with a lower (miR-34b-5p and miR-92b-3p) or higher (miR-467e-5p) expression in DBA/2J vs C57BL/6J mice throughout the time course and those that are more highly expressed at 48 or 120 hpi only (miR-223-3p and miR-21a-3p). [score:5]
The RT-qPCR analysis confirmed the higher expression of miR-223-3p, miR-21a-3p, and miR-467e-5p in DBA/2J and the lower expression of miR-34b-5p and miR-92b-3p after infection, compared to C57BL/6J (Figure 8B). [score:4]
When expressing the RNAseq data as CPM, RT-qPCR data of four of the five miRNAs correlated strongly with the RNAseq data (ρ = 0.8 each, p ≤ 0.05, Spearman correlation), whereas miR-92b-3p did not correlate significantly (ρ = 0.25, p = ≥ 0.05). [score:3]
When FC values were used, RT-qPCR detected changes in miR-21a-3p, miR-223-3p, and miR-34b-5p expression in the same direction as measured by RNAseq, whereas no significant regulation was observed for miR-467e-5p and miR-92b-3p (Figure 8A). [score:3]
The RT-qPCR data differed in a minor way from the RNAseq data in that expression of miR-34b-5p and miR-92b-3p at t = 0 did not differ significantly between the mouse strains (Figure 8B). [score:3]
[1 to 20 of 7 sentences]
6
[+] score: 20
Other miRNAs from this paper: hsa-mir-92b
Secondly, depletion of Epac1 expression by different means (siRNA or miR92b -induced knockdown) severely diminished VEGFR-2 expression and hampered basal and VEGF -induced sprouting angiogenesis as well as sheet migration. [score:6]
Furthermore, according to data base searches (TargetScan, RefGene), transcription of the Epac1 encoding gene rapgef3 can be targeted by microRNA-92b (miR-92b). [score:5]
We therefore overexpressed this microRNA in HUVEC (Figure 5D) and analyzed the protein levels of Epac1 and VEGFR-2. The overexpression of miR-92b not only reduced Epac1 content by 55%, but also lowered the VEGFR-2 amount by 42%, indicating that a decrease in protein content of Epac1 by any approach (siRNA or miRNA), diminishes VEGFR-2 levels. [score:5]
Similarly, miRNAs were over-expressed by transfecting HUVEC with 100 pmol of either the control miRNAs (Ambion, AM17110) or or miRNA-92b-3p (miR-92b, Ambion, PM10102) using the same transfecting reagent and scale. [score:3]
48 h post transfection, cells were lysed and miRNA-92b levels were detected relative to U6 miRNA by qPCR to determine the efficiency of transfection (left). [score:1]
[1 to 20 of 5 sentences]
7
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
adj ssc-miR-371-5p 11.3640 6.94E-19 7.93E-18 ssc-miR-219b-3p 10.1953 2.42E-32 1.94E-30 ssc-miR-218b 5.3242 5.95E-18 5.95E-17 ssc-miR-92b-3p 3.2034 3.39E-17 3.01E-16 ssc-miR-7138-3p 2.0714 1.31E-02 1.59E-02 ssc-miR-219a 2.0675 1.31E-07 4.37E-07 ssc-miR-99a 1.4504 2.83E-06 8.09E-06 ssc-miR-128 1.1854 1.31E-05 3.49E-05 To validate this differential miRNA expression pattern, we performed quantitative stem-loop RT-PCR to assess the expression of the three[35] selected hpiPSCs- specific miRNAs: ssc-miR-371-5p, ssc-miR-106a and ssc-miR-363, which were found to be more highly expressed in hpiPSCs (Fig 3B). [score:7]
Ssc-miR-106a, ssc-miR-363, ssc-miR-195, ssc-miR-497, ssc-miR-146b, ssc-miR-92b-5p, ssc-miR-20b and ssc-miR-935 were highly expressed in hpiPSCs than that in mpiPSCs (Fig 3A). [score:3]
[1 to 20 of 3 sentences]
8
[+] score: 17
This experiment showed for the first time that hsa-miR-92 targets the 3′UTR of the RFX1 transcript, which is in turn known to inhibit PCNA expression. [score:7]
To explain the positive correlation between PCNA and the two miRNAs, we hypothesized that one or many other genes could be inhibited by miR-92 and miR-32 and that these genes could be negative regulators of PCNA (Figure 3A). [score:4]
This results in a positive correlation in expression between hsa-miR-32, hsa-miR-92 and PCNA. [score:3]
A. hsa-miR-32 and hsa-miR-92 (Figure 2B) repress RFX1 via a 3′UTR sequence. [score:1]
To further explore this substantial family of CPC pairs, we focused on the PCNA gene (proliferating cell nuclear antigen) involved in cell replication and DNA repair because it was highly positively correlated with both hsa-miR-92 and hsa-miR-32. [score:1]
This relationship explains the positive correlation found between hsa-miR-92 and the PCNA gene. [score:1]
[1 to 20 of 6 sentences]
9
[+] score: 16
The well expressed miR-21, miR-155 and miR-146a clustered together as consistently upregulated, while the abundant microRNAs of the miR17~92 clusters (miR-19b, miR-20a and miR-92) showed a clear trend towards decreased expression in differentiated cells, as did miR-26a (Figure 2A). [score:8]
In addition, 7 microRNAs of the 17~92 and paralog 106b~25 clusters (namely miR-19a, miR-19b, miR-20a, miR-25, miR-92, miR-93 and miR-106b) were identified among the 53 most expressed microRNAs (groups A and B, see Table 1). [score:3]
There were also non significant trends towards preferential expression of miR-19b and miR-92 in the central memory cells. [score:3]
Expression levels of miR-17-3p, miR-17-5p, miR-19b, miR-20a and miR-92 were therefore determined by single specific qPCR in differentiated CD8 [+ ]T cell subsets, and compared to the levels found in naïve cells. [score:2]
[1 to 20 of 4 sentences]
10
[+] score: 16
Treg-specific miR-17–miR-92 deletion increased Treg apoptosis and reduced proliferation, causing loss of Foxp3 expressing Treg in aged mice (63). [score:3]
It has been proposed that strong CD28 signals inhibit Foxp3 induction, which may be influenced by costimulatory signaling pathways that induce miR-17–miR-92 (41). [score:3]
miR-31 represses human Treg Foxp3 expression (36) while the miR-17–miR-92 cluster represses iTreg formation (37– 40). [score:3]
By contrast, elevated miR-17–miR-92 in murine lymphocytes increased proliferation and reduced cell death (64), resulting in favored Treg accumulation in lymph nodes and non-lymphoid target tissues (63). [score:3]
miR-31 and the miR-17–miR-92 cluster function as negative regulators of iTreg differentiation (29). [score:2]
Moreover, miRNA (miR-31, miR-17–miR-92, and miR-23–miR-27–miR-24) antagomir treatment of T cells in vitro may be exploited to support iTreg generation, while in vivo treatment may foster pTreg generation. [score:1]
miR-17–miR-92 also assists in maintaining Treg fitness (62). [score:1]
[1 to 20 of 7 sentences]
11
[+] score: 14
p53 expression is inhibited by miR-125b [2], while p63 is inhibited by miR-302, miR-21, and miR-92 [3], [4], [5]. [score:7]
MiRNAs have been shown to inhibit the expression of the tumor suppressor p53 (miR-125a/b) and p63 (miR-92, miR-21, 302 and miR-203) [Table 3], indicating that Dicer function may be required to generate mature miRNAs. [score:7]
[1 to 20 of 2 sentences]
12
[+] score: 13
The expression correlation between miR-92a and miR-92b is 0.2, and the expression correlation between miR-25 and miR-92b is 0.172. [score:5]
MiR-25 and miR-92a show a high expression correlation (PCC = 0.798), whereas miR-92b has distinct expression patterns with miR-25 and miR-92a. [score:5]
MiR-92b was found to suppress pro-inflammatory responses [48]. [score:2]
For example, three miRNAs including miR-25, miR-92a and miR-92b are from the miR-25 family. [score:1]
[1 to 20 of 4 sentences]
13
[+] score: 12
Other miRNAs from this paper: mmu-mir-92a-2, mmu-mir-92a-1
Interestingly, miR-92 and miR-92b are specifically expressed in aRG undergoing neurogenic divisions, where the Eomes mRNA is highly expressed (Florio et al., 2015). [score:5]
3' UTR -dependent, miR-92 -mediated restriction of Tis21 expression maintains asymmetric neural stem cell division to ensure proper neocortex size. [score:3]
MicroRNA-92b regulates the development of intermediate cortical progenitors in embryonic mouse brain. [score:2]
The Tbr2 protein has been shown to be repressed by the microRNAs (miRNAs) miR-92 and miR-92b, and both miRNAs regulate bIP specification in the developing neocortex (Bian et al., 2013; Nowakowski et al., 2013). [score:2]
[1 to 20 of 4 sentences]
14
[+] score: 11
Upon activation, both miR-17~92 miRNAs and their target mRNAs are up-regulated (Fig 3C and 3D), but the fold increase of the latter outpaces the former, thereby increasing the ratios between conserved binding sites and miRNA molecules to 2.8 (miR-92 family) and 8.7 (miR-18 family) in 25.5h activated B cells (Fig 3E). [score:6]
They fall into four miRNA subfamilies (miR-17, miR-18, miR-19, and miR-92 subfamilies), with members in each subfamily sharing the same seed sequence. [score:1]
Indicated amounts of synthetic miR-17, miR-18a, miR-19b and miR-92 were added to naïve and activated T KO B cells before RNA extraction. [score:1]
The wild type CD69 3’UTR (wt) contains three binding sites for miR-17~92 miRNAs (one for miR-17 subfamily and two for miR-92 subfamily). [score:1]
The ratios between conserved miR-17~92 binding sites and miRNA molecules range from 0.5 (miR-92 subfamily) to 4.6 (miR-18 subfamily) in naïve B cells (Fig 3E). [score:1]
Our calculation showed that each naïve B cell expresses 900–1,800 molecules of miR-17, miR-19, and miR-92 subfamily miRNAs, and 80 molecules of miR-18 subfamily miRNAs (Fig 3B and 3C and S7 Table). [score:1]
[1 to 20 of 6 sentences]
15
[+] score: 11
Interestingly, we found a correlation between BM-MSC-EVs miRNAs/piRNAs and down-regulated genes, indicating at least one target for each EVs miRNAs/piRNAs (e. g., CEBPA/miR-182, EGR2/miR-150 and miR-92, MPO/ hsa_piR_020814_DQ598650). [score:6]
Moreover, another down-regulated gene, Early Growth Response 2 (EGR2), also involved in apoptosis [61] and differentiation [62], is regulated by two different microRNAs, identified in our sequencing data, miR-150 [63] and miR-92 [64]. [score:5]
[1 to 20 of 2 sentences]
16
[+] score: 11
The increased proportion of cells expressing Tbr2 is in line with a previous prediction based on miRNA profiling of neural progenitor cells in rat dorsal telencephalon which proposed that the expression of miR-92 is down-regulated around the onset of neurogenesis and that it could be directly targeting Tbr2 for post-transcriptional repression [80]. [score:11]
[1 to 20 of 1 sentences]
17
[+] score: 10
Based on the partial residual expression of the miR-17 and miR-92 families (Figure 7B, 7C), and the generally very low expression of the miR-18 family (Figure 7D, note y axis units), we hypothesized that loss of the miR-19 family was responsible for the defective invasion of 17KPC cell lines. [score:5]
In fact, the mir-106b~25 locus is sufficient to drive expression of miRNAs for the miR-17 and miR-92 families to levels close to those observed in KPC lines, suggesting that loss of the miR-17 and -92 families may not be primarily responsible for the invasive defect of 17KPC cell lines. [score:3]
Interestingly, a recent publication linked miR-92 and DUSP10 to PDAC cell proliferation in vitro, suggesting that there may indeed be an important role for this regulatory axis in pancreatic tumorigenesis [61]. [score:2]
[1 to 20 of 3 sentences]
18
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In addition to the targeting sites for miR-155, miR-181b, and miR-361, the 3′ UTR of mouse Aicda mRNA also contains the putative target sites for miR-125a, miR-351, miR-92b, miR-26a, and miR-103 (identified by using miRNA -targeting prediction tools: TargetScan. [score:9]
[1 to 20 of 1 sentences]
19
[+] score: 9
MiR-92b is significantly up-regulated in lung cancer cells and knockdown of miR-92b inhibits cell growth and sensitizes the A549/DDP cells to DDP by target PTEN (phosphatase and tensin homolog) [19]. [score:9]
[1 to 20 of 1 sentences]
20
[+] score: 9
To address this issue, we first screened the miRNAs whose expressions are modulated in 4T1 cells by miRNA microarray analysis using both total cellular miRNA and exosomal miRNA after treatment with 100 μM of EGCG for 24 h. In brief, a set of miRNAs including let-7, miR-16, miR-18b, miR-20a, miR-25, miR-92, miR-93, miR-221, and miR-320 were up-regulated, and dozens of miRNAs including miR-10a, miR-18a, miR-19a, miR-26b, miR-29b, miR-34b, miR-98, miR-129, miR-181d were down-regulated in both total cellular and exosomal fraction by EGCG treatment (data not shown). [score:9]
[1 to 20 of 1 sentences]
21
[+] score: 9
Hypermethylation of the human Dkk3 promoter [26] may be the mechanism for the downregulation in various tumour types, as is repression of Dkk3 by the MYCN regulated miRNA-92 [27], [28]. [score:5]
In addition there are two recent studies showing that Dkk3 expression is regulated by miRNA-92 in neuroblastoma cell lines [27], [28]. [score:4]
[1 to 20 of 2 sentences]
22
[+] score: 9
Several microRNAs (Mir128, Mir181d, Mir92b) have been implicated in regulation of neuronal development and differentiation; several of the top mRNA modules enriched in targets of the microRNAs are also enriched in developmental genes. [score:5]
Mir92b has been implicated in the development of intermediate cortical progenitors in embryonic mouse brain [32], pointing again to a possible connection between CAG-length dependent dysregulation and developmental processes. [score:3]
cortex, we found a single microRNA, Mirlet7f-1, with significant difference in association with Q, opposite sign of association with Q in striatum and cortex, and FDR<0.05 for association with Q in both tissues, and additional 6 microRNAs (Mir206, Mir301b, Mir92b, Mir378b, Mir208b, Mir449a) satisfying p<0.05 for association with Q in both tissues. [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 7
In contrast to expression in AML cells, miR-92 expression in ALL cells was higher than in PBMNC (P = 0.0272), and miR-92a expression was significantly higher in ALL cells than in AML cells (P = 0.0021) (Figure 1D). [score:7]
[1 to 20 of 1 sentences]
24
[+] score: 7
In the further study, Cheng et al. [53] found that the expression of Rab23 is regulated by the miR-92b. [score:4]
Forced expression of miR-92b decreased the mRNA and protein level of Rab23, and Rab23 rescued the biological functions of miR-92b. [score:3]
[1 to 20 of 2 sentences]
25
[+] score: 7
MiR-92, another member of the cluster, has been shown to regulate myocardial angiogenesis through targets distinct from those of miR20a, including integrin subunit alpha5 [14]. [score:4]
Note relatively higher expression of 3′ members of the cluster, miR-20a, miR-19b, and miR-92. [score:3]
[1 to 20 of 2 sentences]
26
[+] score: 6
The blockade of IL-4 up-regulated miR-17-5p and miR-92 significantly with p <. [score:4]
The miR-17-92 transcript encoded by mouse chromosome14 (and human chromosome 13) is the precursor for 7 mature miRs (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b and miR-92) [24, 25]. [score:1]
01 for miR-92 and p <. [score:1]
[1 to 20 of 3 sentences]
27
[+] score: 6
VSELs also express several miRNAs that attenuate Igf-1/Igf-2 signaling in these cells (mir681, mir470, mir669b) as well as up regulate expression of p57 (mir25.1, mir19b, mir92). [score:6]
[1 to 20 of 1 sentences]
28
[+] score: 6
In this study, miR-92b (one member of the miR-17-92 family) was highly expressed in SP-HCCs. [score:3]
In this study, miR-10b, miR-21 and miR-92b were frequently over-expressed. [score:3]
[1 to 20 of 2 sentences]
29
[+] score: 6
Recent analysis of miRNA expression in developing human, chimp and macaque brains showed rapid changes in developmental expression profiles of a number of conserved miRNAs, including miR-92, in the primate lineage and proposed that miRNAs contributed to the brain's evolutionary expansion (Somel et al., 2011). [score:6]
[1 to 20 of 1 sentences]
30
[+] score: 6
For the generation of conditional endothelial, cardiomyocyte- or hematopoietic-miR-92a knock-out mice (miR-92a [fl/fl]Tie2-Cre, miR-92 [fl/fl]αMHC-Cre and miR-92 [fl/fl]Vav-Cre), the miR-92a recombined chimeric mice were first bred with C57BL/6J wild type and Flp recombinase expressing deleter mice to excise the neomycin selection cassette and then mated with the respective Cre deleter lines expressing Cre recombinase under the control of Tie2, αMHC or Vav promoter. [score:6]
[1 to 20 of 1 sentences]
31
[+] score: 6
Among which we found that three miRNAs (miR-363, miR-367, miR-25) were commonly upregulated while six (miR-33a, miR-33b, miR-92a, miR-92b, miR-137, miR-32) were downregulated in IL-6 -treated GBC-SD cell line samples compared to the representative controls (Figure 4A and Figure 4B). [score:6]
[1 to 20 of 1 sentences]
32
[+] score: 6
The genes and miRNAs expected to be enriched in iPSCs/ESCs, from the literature [18, 21, 38– 42], include transcription factors involved in maintaining “stemness” (FOXD3, GATA6, NANOG, NR6A1, POU5F1, SOX2, UTF1, TFCP2L1, and ZFP42), signaling molecules involved in pluripotency and self-renewal (CRABP2, EDNRB, FGF4, FGF5, GABRB3, GAL, GRB7, IFITM1, IL6ST, KIT, LEFTY1, LEFTY2, LIFR, NODAL, NOG, NUMB, PTEN, SFRP2, and TDGF1), cytokines and growth factors (FGF4, FGF5, LEFTY1, LEFTY2, NODAL, and TDGF1), other ESC-specific genes (BRIX1, CD9, DIAPH2, DNMT3B, IFITM2, IGF2BP2, LIN28A, PODXL, REST, SEMA3A, TERT, ESRG, and GJA1), and miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373, miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, and miR-18a) that were highly enriched in genes and miRNAs that were expressed (NRC ≥ 20) in our reprogrammed iPSCs and the majority of them showed significant upregulation (FC ≥ 2.0, FDR ≤ 0.05) during iPSC reprogramming (Figure 4(c)). [score:6]
[1 to 20 of 1 sentences]
33
[+] score: 6
Cdc42 is a target of miR-92a and miR-92b and miR-25 and miR-363. [score:3]
Cofilin 2 is a target of miR-25, miR-363, miR-92a, and miR-92b. [score:3]
[1 to 20 of 2 sentences]
34
[+] score: 6
When transfected into HeLa cells at individual concentrations of 16.7 nM, they achieved a 10-20-fold (miR-92) or 200–400-fold (miR-17/20a, 18a, 19a/19b) overexpression (Figure 3), far exceeding the 3–5-fold increase that was sufficient to drive B cell lymphoma development in mice (Jin et al., 2013), as well as the 2–36-fold increase found in biopsies of human Burkitt's lymphomas, which consistently exhibit activation of the c-Myc-miR-17~92 axis (Schmitz et al., 2012). [score:4]
For example, the probe mixture for the miR-17 subfamily contains probes for miR-17, miR-20a, miR-106a, miR-20b, miR-106b, and miR-93, the probe mixture for the miR-18 subfamily contains probes for miR-18a and miR-18b, the probe mixture for the miR-19 subfamily contains probes for miR-19a and miR-19b, and the probe mixture for the miR-92 subfamily contains probes for miR-92, miR-363, and miR-25. [score:1]
Since cel-mir-67 is a C. elegans miRNA that has no homolog in mammalian species, we decided to perform the same experiments using microRNA-17~92 (miR-17~92), a miRNA cluster encoding six mature miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92). [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 5
miR-17, miR-20a, and miR-92 also illustrated the importance of collaboration in the regulation of Isl1 and Tbx1 during cardiac development [69]. [score:3]
The six miRNAs can be grouped into four miRNA families based on their seed-sequence: the miR-17 family (miR-17 and miR-20a), the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and miR-92 family (miR-92a-1) [31, 34, 39]. [score:1]
Both the evolutionary sequence analysis and the seed-sequence -based grouping partition these miRNAs into four families: the miR-106 family (miR-17, miR-20a/b, miR-106a/b, and miR-93), the miR-18 family (miR-18a/b), the miR-19 family (miR-19a/b-1/2), and the miR-92 family (miR-25, miR-92a-1/2, and miR-363). [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 5
In addition, we found that miR-101a, miR-146a and miR-17-92 cluster (except miR-92) were upregulated in splenic T cells from MRL-lpr mice. [score:4]
However, miR-92, another member of the miR-17-92 cluster was not changed in either splenic B or T cells. [score:1]
[1 to 20 of 2 sentences]
37
[+] score: 5
Expression levels were normalized against three stably expressed reference miRNAs (hsa-miR-125a, hsa-miR-423 and hsa-miR-92) validated with GeNorm [46] and analyzed using qbase+ software version 2.6 (http://www. [score:5]
[1 to 20 of 1 sentences]
38
[+] score: 5
Except for miR-18, the oncogenic contributions of miR-17/20a, miR-19a/b and miR-92 have all been demonstrated and several functional targets identified, including E2F1, PTEN and BIM1 [26]. [score:3]
Figure S4 Comparison of miR-17, miR18, miR-19a, miR19b and miR92 levels between NN10#5, 745A#44 and K16 erythroleukemic cells. [score:1]
Transfection of either miR-92 or control anti-miRs did not affect the partial proliferation rescue in #17-92 cells in presence of Dox (Figure 6B). [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 5
Different types of cancer cells express either high or low levels of miR-92 [44- 46] and the high levels of circulating miR-134 was proposed as a diagnostic and prognostic biomarker for certain diseases [47, 48]. [score:5]
[1 to 20 of 1 sentences]
40
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
Targeted knockouts of Mir17 and Mir92 in mice results in hypoplasia of most skull bones, including reduced ossification and cleft palate, similar to human patients (Ventura et al., 2008; de Pontual et al., 2011; Li et al., 2012; Wang et al., 2013). [score:3]
Another miRNA family involved in craniofacial development is the MIR17 and MIR92 family, which has been linked to Feingold syndrome in human patients (Kannu et al., 2013; Tassano et al., 2013). [score:2]
[1 to 20 of 2 sentences]
41
[+] score: 5
Sengul A Santisuk R Xing W Kesavan C Systemic administration of an antagomir designed to inhibit miR-92, a regulator of angiogenesis, failed to modulate skeletal anabolic response to mechanical loadingPhysiol. [score:4]
In the miR-92 antagomir and control antagomir, the 2′O RNA base are methylated and the first two bases and the last three bases are phosphorothiated to increase the stability of antagomir and hence protect it from degradation. [score:1]
[1 to 20 of 2 sentences]
42
[+] score: 5
We have reported that miR-92b expression correlates with glioma WHO grade and promotes glioma proliferation and invasion by targeting beta-catenin [12]. [score:5]
[1 to 20 of 1 sentences]
43
[+] score: 4
Down regulated expression of has-mir-16, and has-mir-92 and increased levels of has-mir-765 correlated with the severe TBI, however, their utility in diagnosing mTBI was limited [24]. [score:4]
[1 to 20 of 1 sentences]
44
[+] score: 4
In addition, there were significant correlations between miR-92 expression, regional lymph node involvement and clinical stage of the tumor. [score:3]
In 2013, Guo et al. analyzed 50 serum samples from OvCa patients and 50 from healthy controls, and found that miR-92 levels were significantly higher in cancer patients [38]. [score:1]
[1 to 20 of 2 sentences]
45
[+] score: 4
The Molecule Activity Predictor (MAP), based on significantly deregulated miRNAs, suggests the inhibition of senescence (blue) and a concurrent increase of cell survival and viability (light orange) and DNA damage (dark orange), mainly due to the miRNAs let-7a, mir-17, mir-21, mir-34a, mir-92, mir-133a, mir-181a and mir-486 (Figure 6). [score:4]
[1 to 20 of 1 sentences]
46
[+] score: 4
For example, miR17|miR-92 cluster is overexpressed in Myc -induced tumor and regulates two genes involved in angiogenesis, TSP1 and CTGF [39]. [score:4]
[1 to 20 of 1 sentences]
47
[+] score: 4
Another well-studied lncRNA, X-inactive specific transcript (XIST), could directly interact with miR-92b and repress each other, besides, XIST could inhibit hepatocellular carcinoma cell proliferation and metastasis [24]. [score:4]
[1 to 20 of 1 sentences]
48
[+] score: 3
Here, by sequence matching using bioinformatics analyses, we found quite a few of candidate miRNAs that target Bcl-2, including miR-429, miR-30, miR-22, miR-25, miR-32, miR-92, miR-363, miR-367, miR-99, miR-27, miR-128, etc. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Among over-expressed miRNAs, e. g., miR-31, miR-96, and miR-92b, which are known to be involved in cancer progression, eight miRNAs (miR-466b/c/p, miR-674, miR-672, miR-1983, miR-3105, and miR-6539) have not been shown to play a role in breast cancer progression. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Our results are also mostly in agreement with those of Esau et al. [25] who identified a similar expression pattern regarding miR-130b, miR-30c, miR-30a*, miR-191, miR-30d, miR-196, miR-30b, miR-19b, miR-92, miR-138 and miR-100 during differentiation of cultured human adipocytes. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
MicroRNA-92b regulates the development of intermediate cortical progenitors in embryonic mouse brain. [score:2]
Agostini et al. (2011), de Antonellis et al. (2011) miR-92b Limits the production of intermediate cortical progenitors ? [score:1]
[1 to 20 of 2 sentences]
52
[+] score: 3
Other miRNAs from this paper: mmu-mir-92a-2, mmu-mir-92a-1
Furthermore, it was suggested that a positive correlation exists among human liver cancer stage, 8-OHdG levels, Ogg1 polymorphisms, ALT/GGT levels, telomerase activity, and overexpression of miR-92, a microRNA that plays a role in both the apoptotic process and the cellular proliferation pathways [39]. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
By contrast, the expressions of the malaria-responsive miR-92-3p and miR-126-3p are not significantly affected by infections, as it was also found by microarrays. [score:3]
[1 to 20 of 1 sentences]
54
[+] score: 3
Bma-let-7, bma-miR-1, bma-miR-9, bma-miR-92, and bma-miR-100b (white asterisks) share 100% identity with a host miRNA, while bma-miR-34 shows high identity with a host miRNA (21/23 nucleotides). [score:1]
Bma-let-7, along with four other B. malayi mature miRNAs found in ELVs (bma-miR-1, bma-miR-9, bma-miR-92, and bma-miR-100b), share perfect sequence identity with host (Homo sapiens) mature miRNAs, as shown in Fig 5B. [score:1]
Common markers include let-7, lin-4, miR-34, miR-71, miR-92, and miR-100c (Fig 7A and 7B). [score:1]
[1 to 20 of 3 sentences]
55
[+] score: 3
Murakami et al. [48] showed a correlation between miR-222, miR-106a, miR-92, miR-17-5p, miR-20 and miR-18 and the degree of differentiation suggesting an involvement of specific miRNAs in the progression of the disease. [score:3]
[1 to 20 of 1 sentences]
56
[+] score: 3
Out of the genes significantly downregulated at S2 in Jaki-treatment compared with the Ctl, we identified some key pluripotent genes, such as Nanog, Prdm14, Sall4, Tbx3, Tet1, Tfcp2l1, and miR92–2, which belongs to the pluripotent miRNA cluster 106a-363 [59– 61] (Fig. 4c, Additional file 4). [score:3]
[1 to 20 of 1 sentences]
57
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-mir-1b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
One example is the mir-25, 92/mir-92b case, in which the mature sequences are almost identical while the rest of the sequences share little sequence similarity (See additional file 6). [score:1]
For human miRNAs with same id numbers, only 2 are separated in the consensus families, namely mir-92/mir-92b and mir-449/mir-449b, showing that most of the miRNA families are robust to the variation in the input of the PBC pipeline. [score:1]
We further examined the alignments for mir-92/92b and mir-449/449b. [score:1]
[1 to 20 of 3 sentences]
58
[+] score: 3
Other miRNAs from this paper: mmu-mir-92a-2, mmu-mir-92a-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b
3' UTR -dependent, miR-92 -mediated restriction of Tis21 expression maintains asymmetric neural stem cell division to ensure proper neocortex size. [score:3]
[1 to 20 of 1 sentences]
59
[+] score: 3
Of the nine miRNAs were specifically expressed in cashmere goat dorsal skin [18], only four of them were examined in the present study: miR-1, miR-374, miR-455-3p and miR-92b. [score:3]
[1 to 20 of 1 sentences]
60
[+] score: 3
Figure 1 MicroRNAs targeting p53: miR-125b, miR-504, miR-1285, miR-92, miR-141, miR-380-5p, miR-15a, miR-16, miR-25, miR-30d, miR-200a [reviewed in Ref. [score:3]
[1 to 20 of 1 sentences]
61
[+] score: 3
Moreover, Bar and colleagues [33] found that the most overexpressed miRNAs in undifferentiated human ES cells are miR-302b, miR-302c, miR-302d, miR-92b, miR-20b, miR-519d, miR-302a, miR-324-3p, miR-187, and miR-18b. [score:3]
[1 to 20 of 1 sentences]
62
[+] score: 2
Other miRNAs from this paper: mmu-mir-155, mmu-mir-92a-2, mmu-mir-92a-1
GAPDH and miR-92 were used as standards for mRNAs and miRNAs, respectively. [score:1]
miR-92 was used for standardization [28]; error bars represent mean ± SD. [score:1]
[1 to 20 of 2 sentences]
63
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-134, mmu-mir-137, mmu-mir-138-2, mmu-mir-145a, mmu-mir-24-1, hsa-mir-192, mmu-mir-194-1, mmu-mir-200b, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-215, hsa-mir-221, hsa-mir-200b, mmu-mir-296, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-134, hsa-mir-138-1, hsa-mir-194-1, mmu-mir-192, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-346, hsa-mir-200c, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-200a, hsa-mir-296, hsa-mir-369, hsa-mir-346, mmu-mir-215, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-221, gga-mir-17, gga-mir-138-1, gga-mir-124a, gga-mir-194, gga-mir-215, gga-mir-137, gga-mir-7-2, gga-mir-138-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-200a, gga-mir-200b, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-7-3, gga-mir-7-1, gga-mir-24, gga-mir-7b, gga-mir-9-2, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-192, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-17a-1, dre-mir-17a-2, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-25, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-137-1, dre-mir-137-2, dre-mir-138-1, dre-mir-145, dre-mir-194a, dre-mir-194b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, mmu-mir-470, hsa-mir-485, hsa-mir-496, dre-let-7j, mmu-mir-485, mmu-mir-543, mmu-mir-369, hsa-mir-92b, gga-mir-9-1, hsa-mir-671, mmu-mir-671, mmu-mir-496a, hsa-mir-543, gga-mir-124a-2, mmu-mir-145b, mmu-let-7j, mmu-mir-496b, mmu-let-7k, gga-mir-124c, gga-mir-9-3, gga-mir-145, dre-mir-138-2, dre-mir-24b, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-let-7l-1, gga-let-7l-2, gga-mir-9b-2
MicroRNA-92b regulates the development of intermediate cortical progenitors in embryonic mouse brain. [score:2]
[1 to 20 of 1 sentences]
64
[+] score: 2
Furthermore, BCR-ABL -positive ALL samples exhibited a 9- to 32-fold reduction in miRNA expression compared to BCR-ABL -negative ALL cells, with the exception of miR-92 which was therefore not further analysed. [score:2]
[1 to 20 of 1 sentences]
65
[+] score: 2
MicroRNA-92 modulates K(+) Cl(-) co-transporter KCC2 expression in cerebellar granule neurons. [score:2]
[1 to 20 of 1 sentences]
66
[+] score: 2
[4] The miR-17-92 gene cluster encodes 6 miRNAs of 4 miRNA families: the miR-17 family including miR-17 and miR-20a, the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and the miR-92 family. [score:1]
The miR-17-92 gene cluster encodes 6 miRNAs of 4 miRNA families: the miR-17 family including miR-17-5p and miR-20a, the miR-18 family (miR-18a), the miR-19 family (miR-19a and miR-19b-1), and the miR-92 family. [score:1]
[1 to 20 of 2 sentences]
67
[+] score: 2
mmu-miR-92 was used as endogenous control. [score:1]
000412[miR-29a], 000413[miR-29b], 000430[miR-92]) specific for mature mmu-miR-29a, mmu-miR-29b and mmu-miR-92 was used. [score:1]
[1 to 20 of 2 sentences]
68
[+] score: 2
Other miRs which were more abundant in CDC-EVs vs MSC-EVs included miR-124, miR-210, miR-92 and miR-320. [score:1]
Another miR similarly abundant in human- and rat-CDC-EVs, and significantly higher compared with MSC-EVs, was miR-92, a member of the miR-17-92 cluster, and an important regulator of cancer and aging [46]. [score:1]
[1 to 20 of 2 sentences]
69
[+] score: 1
Multiple miR-17 and miR-92 family members were amongst the miRNA that most effectively induced Th cell proliferation [18]. [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-101a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, cel-lsy-6, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-101a, rno-mir-128-1, rno-mir-128-2, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-199a, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The probes used were: EAM119 (miR-29b), EAM125 (miR-138), EAM224 (miR-17-5p), EAM234 (miR-199a), EAM131 (miR-92), EAM109 (miR-7), EAM150 (miR-9) and EAM103 (miR-124a). [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
For examples, serum miR-155 is the potential biomarker for B-cell lymphoma [30] but also for other cancers such as breast cancer [31], ovarian cancer [32], and pancreatic cancer [33]; Serum miR-92 is the potential biomarker for colon cancer [34], but also leukemia [35], and ovarian cancer [32]; Circulating miR-223 is the potential biomarker for chronic hepatitis [18], but also for schistosomiasis observed in this study. [score:1]
[1 to 20 of 1 sentences]
72
[+] score: 1
pval miRNA fold change mRNA fold change description mmu-miR-449c-5p Myc −0.89 1.2E-04 1.60E-03 −13.7 7.7 v-myc avian myelocytomatosis viral oncogene homolog mmu-miR-181a-5p Lmo1 −0.73 5.8E-03 1.80E-02 −8.1 5.1 LIM domain only 1 (rhombotin 1) mmu-let-7d-3p Ccnd2 −0.94 6.0E-06 4.00E-04 −77.7 4.3 cyclin D2 mmu-miR-375-3p Specc1 −0.83 7.4E-04 4.40E-03 −7.7 3.8 sperm antigen with calponin homology and coiled-coil domains 1 mmu-miR-92b-5p Notch1 −0.95 3.2E-06 3.10E-04 −108.1 3.5 notch 1 mmu-miR-328-3p Pim1 −0.9 7.6E-05 1.20E-03 −48.1 3.1 Pim-1 proto-oncogene serine/threonine kinase mmu-miR-223-3p Msh2 −0.88 2. 1E-04 2.10E-03 567.7 −3.6 mutS homolog 2 mmu-miR-143-3p Chek2 −0.81 1.3E-03 6.40E-03 6.9 −3.5 checkpoint kinase 2 Due to the similarity of the gene expression patterns, we further investigated whether the bronchial genomic classifier from mice can assist in the diagnosis of lung cancer in humans. [score:1]
[1 to 20 of 1 sentences]
73
[+] score: 1
Using significant microarray genes with a p < 0.01, ToppCluster identified 7 different miRNA binding sites, with 9 different miRNAs listed: MIR-32, MIR-92, MIR-96, MIR-129-5p, MIR-140-3p, MIR-141, MIR-200A, MIR-218, and MIR-1271. [score:1]
[1 to 20 of 1 sentences]
74
[+] score: 1
Although miR-92 has been shown to impair angiogenesis 58 and to promote atherosclerosis 59 60, ablation of this miRNA in mice resulted only in bone defects 61. [score:1]
[1 to 20 of 1 sentences]
75
[+] score: 1
Real time PCR was done on all of the following mature microRNAs of the miR-17-92 Cluster: miR-17, miR-18, miR-19a, miR-19b, miR-20 and miR-92. [score:1]
[1 to 20 of 1 sentences]
76
[+] score: 1
The miR-17–92 cluster is comprised of 6 miRNA genes: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92–1, all of which are located on chromosome 14 in the mouse. [score:1]
[1 to 20 of 1 sentences]
77
[+] score: 1
Levels of two other miRNAs, miR-19a and miR-92, were not changed by Mi22 (data not shown). [score:1]
[1 to 20 of 1 sentences]
78
[+] score: 1
miR-17∼92 [flox/ flox] mice (Jax mice stock 8458 – on a mixed C57BL/6 and 129S4 background) harbouring loxP sites on each side of the miR-17∼92 cluster (Mir17, Mir18, Mir19a, Mir20a, Mir19b-1, Mir92–1) (23), were bred to LysMCre mice (kind gift from Dr. [score:1]
[1 to 20 of 1 sentences]
79
[+] score: 1
miRNAs have been found to be involved in cardiac resynchronization therapy through association with cardiac angiogenesis (miR-30, miR-92 and miR-145), cardiac apoptosis (miR-30) and cardiac fibrosis (miR-29) [35]. [score:1]
[1 to 20 of 1 sentences]
80
[+] score: 1
Four of these p63-miRNA feedback-related pairs (ΔNp63/miR-130b, ΔNp63/miR-92, ΔNp63/miR-181a-5p and ΔNp63/miR-374a-5p) have been validated [24– 27]. [score:1]
[1 to 20 of 1 sentences]
81
[+] score: 1
Of note, miR-92 and let-7 were detected in some of the libraries however the mature miRNAs are perfectly conserved between nematodes and mammals. [score:1]
[1 to 20 of 1 sentences]
82
[+] score: 1
Together these three miRNA clusters contain a total of 15 miRNAs constituting four “seed” families: the miR-17, the miR-18, the miR-19 and the miR-92 family. [score:1]
[1 to 20 of 1 sentences]
83
[+] score: 1
Other miRNAs from this paper: hsa-mir-25, hsa-mir-28, hsa-mir-95, mmu-mir-151, mmu-mir-290a, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-130b, mmu-mir-340, mmu-mir-25, mmu-mir-28a, hsa-mir-130b, hsa-mir-367, hsa-mir-372, hsa-mir-378a, mmu-mir-378a, hsa-mir-340, hsa-mir-151a, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-505, hsa-mir-506, mmu-mir-367, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-648, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-659, hsa-mir-421, hsa-mir-151b, hsa-mir-1271, hsa-mir-378d-2, mmu-mir-467b, mmu-mir-297b, mmu-mir-505, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-421, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-669g, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, mmu-mir-1195, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1289-1, hsa-mir-1289-2, hsa-mir-548k, hsa-mir-1299, hsa-mir-548l, hsa-mir-1302-1, hsa-mir-1302-2, hsa-mir-1302-3, hsa-mir-1302-4, hsa-mir-1302-5, hsa-mir-1302-6, hsa-mir-1302-7, hsa-mir-1302-8, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1255a, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-1268a, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1255b-1, hsa-mir-1255b-2, mmu-mir-1906-1, hsa-mir-1972-1, hsa-mir-548q, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-3116-1, hsa-mir-3116-2, hsa-mir-3118-1, hsa-mir-3118-2, hsa-mir-3118-3, hsa-mir-548s, hsa-mir-378b, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-3156-1, hsa-mir-3118-4, hsa-mir-3174, hsa-mir-3179-1, hsa-mir-3179-2, hsa-mir-3179-3, hsa-mir-548w, hsa-mir-3156-2, hsa-mir-3156-3, hsa-mir-548x, mmu-mir-3470a, mmu-mir-3470b, mmu-mir-3471-1, mmu-mir-3471-2, hsa-mir-378c, hsa-mir-1972-2, hsa-mir-1302-9, hsa-mir-1302-10, hsa-mir-1302-11, mmu-mir-1906-2, hsa-mir-3683, hsa-mir-3690-1, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-1268b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, mmu-mir-28c, mmu-mir-378b, mmu-mir-28b, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, mmu-mir-378c, mmu-mir-378d, hsa-mir-548ay, hsa-mir-548az, hsa-mir-3690-2, mmu-mir-290b, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-3179-4, mmu-mir-466c-3, hsa-mir-548bc, mmu-mir-1271
The functional networks of miR-92b (PRdmiR, mir-25 family, derived from GC rich tandem repeats), miR-28 (RdmiR, mir-28 family, derived from LINE), miR-151 (RdmiR, mir-28 family, derived from LINE), miR-421 (RdmiR, mir-95 family, derived from LINE), miR-1271 (RdmiR, mir-1271 family, derived from LINE), miR-340 (RdmiR, mir-340 family, derived from DNA transportable element) and miR-378 (RdmiR, mir-378 family, derived from SINE) have been reconstructed (Figure 8). [score:1]
[1 to 20 of 1 sentences]