sort by

19 publications mentioning hsa-mir-300

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-300. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 388
The miR-300 precursor expression plasmid, inhibitor expression plasmid and non -targeting control plasmid were obtained from Genechem. [score:9]
In this study, we observed that miR-300, a miRNA with so far unknown function in metastasis, played an important role as a suppressor of EMT in human epithelial cancer through direct targeting Twist, which, in turn, inhibited metastasis. [score:8]
To address whether the expression of miR-300 is associated with its target, Twist in patients, miR-300 and Twist expression were examined in specimens from 75 patients with oral cancer. [score:7]
MiR-300 may negatively regulate EMT by direct targeting Twist and therefore inhibit cancer cell invasion and metastasis, which implicates miR-300 as an attractive candidate for cancer therapy. [score:7]
Correlation analysis between miR-300 expression and the expression levels of its target gene, as well as tumor metastasis was performed in specimens from patients with head and neck squamous cell carcinoma (HNSCC). [score:7]
B. Western Blot analysis revealed a significant increase of E-cadherin expression and reduced Vimentin expression in miR-300 overexpression cells. [score:7]
Western Blot analysis revealed a significant increase of E-cadherin expression and reduced Vimentin expression in miR-300 overexpression cells (Figure  3B). [score:7]
D, E. of Twist protein expression in HN-12 and MDA-MB-231 cells treated with miR-153 mimic (D) or in HN-4 and MCF-7 cells treated with miR-153 inhibitor F, G, H, I. Overexpression of Twist rescued the repressive effects of miR-300 on EMT, leading to morphological changes (F), molecular changes consistent with EMT (G, H), and elevated invasive abilities in transwell assays (I). [score:6]
To demonstrate that the endogenous miR-300 can regulate the expression of Twist, the miR-300 inhibitor was transfected into HN-4 and MCF-7 cells. [score:6]
To further validate direct targeting of Twist by miR-300, functional rescue experiment was performed by co-transfection with miR-300 mimic and plasmid constructs expressing Twist in HN-12 cells and MDA-MB-231 cells using Lipofectamine 2000 as described above. [score:6]
Enforced miR-300 expression suppressed cell invasion in vitro and experimental metastasis in vivo. [score:5]
The cobblestone-like appearance and E-cadherin expression remained intact and Vimentin expression was attenuated in the cells treated with TGF-β in combination with miR-300. [score:5]
A significant inverse correlation between miR-300 and Twist expression levels was observed, which confirms the functional interaction of miR-300 and its target Twist. [score:5]
Ectopic expression of miR-300 effectively blocked TGF-beta -induced EMT and reversed the phenotype of EMT in HN-12 and MDA-MB-231 cells, but inhibition of miR-300 in the epithelial phenotype cells, HN-4 and MCF-7 cells, could induce EMT. [score:5]
Twist protein expression decreased when HN-12 and MDA-MB-231 cells were treated with miR-300 mimic and increased when HN-4 and MCF-7 cells were treated with miR-300 inhibitor (Figure  4D,E). [score:5]
In the present study, Twist was predicted as the target of miR-300 by TargetScan. [score:5]
miR-300 expression is inversely correlated with Twist expression and metastasis in tumors from patients with oral cancer. [score:5]
Figure 6 miR-300 expression is inversely correlated with Twist expression and metastasis in primary tumors from patients with oral cancer. [score:5]
Remarkably, miR-300 was down-regulated in cancer cells that have undergone EMT comparing with typical epithelial phenotype carcinoma cells, indicating miR-300 might be a regulator of EMT. [score:5]
Clinically, miR-300 expression was found inversely correlated with Twist expression and reduced miR-300 was associated with metastasis in patient specimens. [score:5]
The lung weight and the tumor nodules of mice in miR-300 over -expression group were respectively 40% and 66% less than that in negative control group, which indicates miR-300 can inhibit tumor metastasis in vivo. [score:5]
The miR-300 mediated inhibition of invasion and metastasis likely operates through its suppression effect on EMT. [score:5]
In summary, our study suggests that down-regulation of miR-300 is required for EMT initiation and maintenance. [score:4]
Generation of stable cell lines with overexpression or knockdown of miR-300. [score:4]
Figure 3 Down-regulation of miR-300 is required for EMT initiation and maintenance. [score:4]
In addition, site-directed mutagenesis of the seed region abolished the inhibitory effect of miR-300 on firefly luciferase activity (Figure  4B). [score:4]
C. Fifteen miRNAs, including miR-300, were confirmed down-regulated in the HNSCC cells that underwent EMT by real-time PCR. [score:4]
Twist is a direct target of miR-300. [score:4]
D. The down-regulation of miR-300 was also observed in breast cancer cells that underwent EMT. [score:4]
These data indicate that miR-300 targets Twist, which in turn results in a negative regulation of EMT. [score:4]
In addition to miR-200 family, miR-300 was one of the most down-regulated miRNAs in both HNSCC cells and breast cancer cells that underwent EMT (Figure  1C,D). [score:4]
In this study, we verified that miR-300 was down-regulated during an EMT. [score:4]
Our findings showed that down-regulation of miR-300 is required for EMT initiation and maintenance. [score:4]
D. HN-4 and MCF-7 cells with down-regulated level of miR-300 acquired a fibroblastoid appearance. [score:4]
Our data provide evidence that down-regulation of miR-300 is involved in metastatic events, which is consistent with the function of miR-300 in modulating EMT. [score:4]
In addition, downregulation of miR-300 led to increased cell invasion (Figure  3F). [score:4]
Down-regulation of miR-300 is required for EMT initiation and maintenance. [score:4]
Down-regulation of miR-300 in cells having undergone EMT. [score:4]
HN-4 and MCF-7 cells with down-regulated level of miR-300 acquired a fibroblastoid appearance (Figure  3D). [score:4]
By targeting Twist, miR-300 plays an important role in the regulation of EMT. [score:4]
The lung metastasis mo dels were established by the tail vein injection of MDA-MB-231 cells transfected with a blank vector and MDA-MB-231cells over -expression of miR-300. [score:3]
Overexpression of Twist rescued the repressive effects of miR-300 on EMT, leading to morphological and molecular changes consistent with EMT (Figure  4 F,G,H) and elevated invasive abilities in the cells (Figure  4I). [score:3]
miR-300 inhibits the experimental lung metastasis in vivo. [score:3]
The sequence of the miR-300 inhibitor was as follows: 5′-GAGAGAGUCUGCCCUUGUAU-3′. [score:3]
In addition, the miR-300 expression level in metastasis -positive patients (n = 35) was significantly lower (P =0.033) than that in metastasis -negative patients (n = 40) (Figure  6B). [score:3]
It was shown that a significant inverse correlation between Twist and miR-300 expression levels by Pearson correlation analysis (R = -0.367, P = 0.001) in these patients (Figure  6A). [score:3]
org) was used to predict potential targets for miR-300 [33]. [score:3]
The low expression of miR-300 plays an important role in EMT -mediated tumor metastasis. [score:3]
Through dual-luciferase assays, we confirmed the Twist 3′UTR as a direct target of miR-300. [score:3]
Overexpression of miR-300 led to significant resistance to TGF-β induced EMT (Figure  2). [score:3]
F. Downregulation of miR-300 led to increased cell invasion in transwell assays. [score:3]
White boxes indicated cases with inverse expression pattern of miR-300 and Twist (n = 47), while shaded boxes showed cases with no inverse relationship between miR-300 and Twist (n = 28). [score:3]
Ectopic expression of miR-300 could repress invasion in vitro and experimental pulmonary metastases in vivo. [score:3]
To gain further insights into the role of miR-300 in oral cancer metastasis, the expression of miR-300 and Twist was detected in 75 oral cancer samples. [score:3]
Overexpression of miR-300 blocks TGF-β induced EMT. [score:3]
Comparing with their parental cells, HN-12 and MDA-MB-231 cells ectopically expressing miR-300 showed an obvious shift in morphology, from spindle-shaped cells to more cobblestone-like cells (Figure  3A). [score:3]
The sequence of the miR-300 inhibitor was as follows: 5′-GAGAGAGUCUGCCCUUGUAU-3′. [score:3]
These results show that reducing endogenous miR-300 expression can efficiently induce EMT. [score:3]
These results reveal a previously unknown function of miR-300 to prevent metastasis by suppressing EMT. [score:3]
The expression levels of miR-300 were examined in epithelial carcinoma cells that underwent an EMT using quantitative reverse transcription-PCR. [score:3]
Furthermore, our data demonstrated that over -expression of miR-300 in cancer cells could prevent TGF-β -induced EMT. [score:3]
A. Images of lungs from all mice intravenously injected with MDA-MB-231 cells and with MDA-MB-231cells over -expression of miR-300 (n = 7). [score:3]
So far, no direct evidence has been reported that miR-300 may affect EMT, therefore, we selected miR-300 for further analysis as an unknown candidate regulator of EMT. [score:3]
Although low level expression of miR-300 was reported in some types of cancer [26- 28], the exact role of miR-300 in cancerous transformation and progression is not clear. [score:3]
MiR-300 was found down-regulated in the HNSCC cells and breast cancer cells that underwent EMT. [score:3]
A. Ectopic expression of miR-300 produced obvious morphological changes in HN-12 and MDA-MB-231, from spindle-shaped cells to more cobblestone-like cells. [score:3]
Firstly, stable cell lines of HN-12 and MDA-MB-231cells with ectopic expression of miR-300 were generated by transfection of miR-300 precursor. [score:3]
Bioinformatic prediction of miR-300 potential targets. [score:3]
Figure 5 miR-300 inhibits the experimental lung metastasis in vivo. [score:3]
org), Twist was predicted as a potential target gene of miR-300. [score:3]
The median value was used as cutoff point for separating miR-300 high and low expression cases. [score:3]
B. A dual-luciferase reporter system analysis was performed to validate miR-300 target genes. [score:3]
It was observed that miR-300 was significantly down-regulated both in natural mesenchymal phenotype cells (HN-12 cell and MDA-MB-231 cell) and EMT cell culture mo dels by exposure to TGF-β compared with epithelial phenotype cells (HN-4 cell and MCF-7 cell). [score:3]
C. Endogenous study showed that cotransfection of Twist 3′UTR with miR-300 inhibitor caused an elevated luciferase signal in both HN-4 and MCF-7 cells. [score:3]
As shown in Figure  5A,C,D, the tumor nodules and total lung weight were dramatically reduced in miR-300 over -expression group. [score:3]
More importantly, the involvement of miR-300 in the regulation of EMT was observed in two different types of cancer, breast cancer and oral cancer, suggesting it is a common regulatory mechanism of tumor cell invasion rather than a tissue-specific one. [score:3]
In order to determine the correlation coefficient (R) and the significance (P) between the expression of miR-300 and Twist mRNA, the Pearson’s correlation algorithm was applied. [score:3]
A 3′UTR fragment containing the predicted miR-300 targeting sites of Twist was fused downstream of the firefly luciferase gene. [score:3]
MiR-300 plays an important role in EMT through direct targeting of Twist. [score:3]
In contrast, by inhibition of miR-300, epithelial phenotype cells could be triggered to undergo EMT, which was accompanied by a more invasive property. [score:3]
Ectopic expression of miR-300 can reduce invasiveness and metastasis of cancer cells both in vitro and in vivo (Figure  7). [score:3]
In addition, the expression level of miR-300 is associated with metastatic pattern in oral squamous cell carcinoma. [score:3]
B. The miR-300 expression level in metastasis -positive patients was significantly lower (P =0.033) than that in metastasis -negative patients. [score:3]
A luciferase reporter assay and a rescue experiment were conducted to confirm the target gene of miR-300. [score:2]
As shown in Figure  4C, the miR-300 inhibitor increased the normalized firefly luciferase activity, as compared to the negative control (NC) (Figure  4C). [score:2]
Primer sequences are in Table  1. Correlation analysis between miR-300 level and Twist mRNA expression was performed. [score:2]
These results imply that miR-300 may function as an EMT regulator. [score:2]
In this study, we focused on the roles of miR-300 in regulating EMT. [score:2]
As a consequence of stable knockdown of miR-300, HN-4 and MCF-7 cells showed cellular changes consistent with EMT and increased invasiveness. [score:2]
Figure 7 Schematic diagram of miR-300’s regulation of EMT and metastasis. [score:2]
In addition, levels of Twist protein in lung lysates from miR-300 treated mice were markedly reduced compared with control mice, further confirming that the Twist gene is a true target of miR-300. [score:2]
C. Significant decrease of in vitro invasive abilities of cells was observed in cells with ectopic expression of miR-300 in transwell assays. [score:2]
The luciferase reporter assay and the rescue assay results showed that miR-300 directly targets the 3′UTR of Twist. [score:2]
To examine whether miR-300 directly interacts with the predicted 3′UTR of Twist, the 3′UTR of human Twist was cloned downstream the firefly luciferase coding sequence and co -transfected with miR-300 mimic into 293 T cells. [score:2]
To ascertain that the miR-300 regulates EMT through its interaction with Twist, a rescue experiment was also performed. [score:2]
The expression of Twist was significantly depressed in the miR-300 treated animals compared to negative controls. [score:2]
In accordance with our in vitro findings, ectopic expression of miR-300 in MDA-MB-231cells led to approximate 2.9-fold decrease in the number of lung metastasis tumor nodules compared with vector control cells, providing in vivo evidence that miR-300 has therapeutic potential for metastasis prevention. [score:2]
For this purpose, we next investigated whether miR-300 could inhibit the experimental lung metastasis in vivo. [score:1]
Therefore, we subsequently turned our attention to the anti-metastatic efficacy of miR-300 in a mouse mo del of experimental lung metastasis. [score:1]
These results indicate that miR-300 is required for EMT maintenance in mesenchymal phenotype cells. [score:1]
These data suggest that miR-300 is necessary for TGF-β -induced EMT. [score:1]
This interaction between miR-300 and Twist mRNA has not been previously reported. [score:1]
Furthermore, significant lower levels of miR-300 and higher levels of Twist were found in patients with metastasis than that in patients without metastasis. [score:1]
To assess the effect of the endogenous miR-300, luciferase activities were also measured in HN-4 and MCF-7 cells in the presence of miR-300 inhibitor. [score:1]
A. The grey dotted line and the solid grey line indicated the median value of miR-300 and Twist. [score:1]
MDA-MB-231 cells stably transfected with miR-300 or with negative control vector (2 × 10 [6] cells in 0.2 ml PBS) were injected into mice via the tail vein. [score:1]
Significant inverse correlation was observed between miR-300 and Twist in patient specimens (R = -0.367, P = 0.001). [score:1]
Real-time PCR analysis for miR-300 and Twist mRNA was performed as described above. [score:1]
The sequences of miR-300 were as follows: Sense: 5′- UAUACAAGGGCAGACUCUCUCU-3′. [score:1]
Reducing miR-300 level induces EMT in HN-4 and MCF-7 cells. [score:1]
The role of miR-300 in EMT was investigated by transfection of the miR-300 mimic or inhibitor in natural epithelial-mesenchymal phenotype cell line pairs and in transforming growth factor (TGF) beta -induced EMT cell mo dels. [score:1]
A miR-300 mutated binding site (mut) was also constructed. [score:1]
4 × 10 [4] 293 T cells were cultured in 24-well plates and cotransfected with 0.15 μg of either pGL3-Twist 3′UTR or pGL3-Twist 3′UTR-mut together with 0.05 μg of the control vector containing renilla luciferase, pRL-TK (Promega) and 40 pmol of miR-300 mimics. [score:1]
As Twist plays an essential role in EMT as well as tumor metastasis, our data establish a mechanistic link between miR-300, Twist, EMT and tumor metastasis. [score:1]
Next, we tested the ability of miR-300 to reverse the mesenchymal phenotype of highly invasive cancer cells, HN-12 and MDA-MB-231. [score:1]
Figure 4. A. The predicted binding of miR-300 with Twist 3′UTR was illustrated. [score:1]
Overexpression of miR-300 reverses the mesenchymal characteristics of HN-12 and MDA-MB-231 cells. [score:1]
In addition, the ectopic expression of miR-300 is sufficient to reverse the mesenchymal characteristics and decrease the invasive abilities of mesenchymal phenotype cells. [score:1]
These data provide further evidence of a functional link between miR-300 and Twist in cancer patients. [score:1]
The predicted binding of miR-300 with Twist 3′UTR was illustrated (Figure  4A). [score:1]
Figure 2. A. Phase contrast microscopy of HN-4 (upper panel) and MCF-7 (lower panel) cells treated with TGF-β alone and co-incubated with miR-300 mimic. [score:1]
As a matter of fact, we have shown that miR-300 could decrease in vitro invasive behavior of highly invasive cancer cells, suggesting it might be a rational approach of treatment against metastasis. [score:1]
The sequences of miR-300 were as follows: Sense: 5′- UAUACAAGGGCAGACUCUCUCU-3′. [score:1]
Cotransfection of Twist 3′UTR with miR-300 mimic led to a strong reduction of the luciferase signal. [score:1]
The Twist 3′ UTR segment, which contains the putative binding site for miR-300 was amplified by PCR from HN-12 cells genomic DNA and inserted into the SmaI and HindIII sites downstream of the firefly luciferase coding region of the pGL3 vector (Promega), resulting in pGL3-Twist 3′UTR. [score:1]
Primer sequences are in Table  1. Mutation from GTA to CAT was introduced in the potential miR-300 binding sites (named pGL3-Twist 3′UTR-mut) by using the QuickChange Stratagene method. [score:1]
[1 to 20 of 126 sentences]
2
[+] score: 276
Other miRNAs from this paper: hsa-mir-188, hsa-mir-362, hsa-mir-346
Expression of p16Ink4a is decreased in CPCs upon Bmi1 and miR-300 upregulation (Figure 2c); in contrast, p19ARF levels are upregulated. [score:9]
Expression of the remaining putative miR-300 targets tested was not influenced by miR-300, although all were inhibited by Bmi1 overexpression (Supplementary Figure S6). [score:9]
[40] Expression of Bmi1 in other murine cell lineages (MEFs and MSCs) consistently activated miR-300 expression, although the levels of overexpression were variable. [score:7]
Thus, it is possible that miR-300 upregulation may at least partially account for the downregulation of p16Ink4a and the p38 pathway, thereby bypassing cell senescence. [score:7]
RT-qPCR analysis revealed that Mef2a, Map2k3, Igfr1, and Fgf1r expression was dependent on miR-300 expression, and this decrease in expression could be reversed by transfection of an anti-miR-300 (five shown in bold in Figure 5a). [score:7]
Since none of the confirmed genes modulated by overexpression of miR-300 or Bmi1 (Oct4, Nkx2.5, Tbx5, and vWF) are predicted as direct targets (Figure 5), our results suggest a non-direct effect. [score:7]
Both cell lines exhibited an increase in Bmi1 expression following suppression of miR-300 expression (Figures 6a and b). [score:7]
Gene expression analysis of cell-cycle senescence -associated and stemness markers in CPC-miR-300 and CPC-B+ cells demonstrated a significant upregulation in p19, c-myc, Nanog, and Oct4 levels and a clear reduction in p16 levels (Figures 2c and d). [score:6]
MirVana miRNA inhibitor (Applied Biosystems, Carlsbad, CA, USA) was used to knockdown mir-300 expression in a separate set of experiments. [score:6]
Furthermore, miR-300 overexpression induced an upregulation of Oct4 mRNA to levels similar to those in CPC-B+ cells (Figures 2c and d). [score:6]
Accordingly, overexpression of Bmi1 in mouse embryonic fibroblasts (MEFs) and adipose tissue-derived MSCs induced the upregulation of miR-300 relative to control cells (GFP), although the relative increase was cell-type dependent (Figure 1g). [score:6]
Collectively, these data illustrate the great complexity of the regulatory mechanisms underlying gene expression at this locus (reviewed in Royo and Cavaille [32]), but also highlight the apparent selectivity of Bmi1 for miR-300 expression and the consequent impact on some elements of the DLK1-MEG3 domain. [score:6]
Taken together, these results suggest that Bmi1 might directly or indirectly regulate miR-300 expression. [score:6]
We compared all potential miR-300 target genes predicted by specialized databases and Ingenuity Pathway Analysis (IPA) was used to link the direct targets. [score:5]
[46] Because Nkx2.5 is not a plausible direct target for miR-300 (Figure 5), we infer that this effect is indirect. [score:5]
[31] Detailed miRNA array expression analysis of the whole miRNA-encoding locus in CPC-B+ and CPC-sh-Bmi1 cells showed that miR-300 was the only miRNA significantly modulated by overexpression of Bmi1 (Figure 3b). [score:5]
As neither p16Ink4a or p19ARF are miR-300 targets, the present evidence suggests that the observed changes to p16INK4a and p19ARF expression are due mainly to changes in the transcriptional activity of their respective promoters. [score:5]
These data suggest that Bmi1 positively regulates miR-300 and, reciprocally, miR-300 negatively regulates Bmi1 expression in a negative feedback loop. [score:5]
Since the most important known senescence-relevant target of Bmi1 is p16Ink4a, reduction of senescence in CPCs by miR-300 is almost certainly associated with reduction of p16Ink4a expression. [score:5]
showed that anti-miR-300 (50 pmol) suppressed the Bmi1 -mediated effect on several target genes (Figures 2c and d). [score:5]
The finding of Bmi1 as a highly probable target of miR-300 suggests that it could directly regulate Bmi1. [score:5]
Forced expression of miR-300 reduced spontaneous endothelial differentiation of CPCs, and a similar effect was obtained after Bmi1 overexpression. [score:5]
Accordingly, miR-300 overexpression provoked a decrease in Dlk1 mRNA levels in CPCs and MSCs, but not in MEFs (Figure 3e), suggesting a context -dependent regulation. [score:4]
Because Bmi1 upregulation increased cellular proliferation, we questioned whether this was mediated by miR-300. [score:4]
Specifically, Bmi1 -induced upregulation of miR-300 in CPCs (1.35-fold) was found to be similar to MSCs (1.5-fold), but lower than that observed in MEFs (4.3-fold). [score:4]
Indeed, genes related to multipotency and stemness were found to be overrepresented in CPC-B+ and CPC-miR-300 cells (Figures 2c and d), and recovered to normal levels when miR-300 was downregulated. [score:4]
[44] We show that in CPCs, Bmi1, and miR-300 oppositely regulate expression of p16Ink4a and p19ARF. [score:4]
Consistent with a modification in senescence development, differences were found in cell-cycle distribution in miR-300 -expressing cells (Supplementary Figure S4). [score:4]
confirmed an upregulation of miR-300 in the YFP+ (CPC-B+) population, but not miR-188 or miR-362, which were not overrepresented in the YFP− population (Figure 1f). [score:4]
Taken together, our study provides evidence that miR-300 could play an important role in maintaining multipotent cell status, favouring Oct4 transcription factor expression, and negatively regulating differentiation. [score:4]
Additionally, we found that modulation of miR-300 expression also affected other elements of the DLK1-MEG3 domain in different cell types (Figure 3e), which was contingent on Bmi1 regulation (Supplementary Figure S6). [score:4]
To further examine whether miR-300 is a relevant downstream effector of Bmi1, we knocked down miR-300 expression in CPC-miR-300 and CPC-B+ cells using anti-miR-300 oligonucleotides. [score:4]
We confirmed that miR-300 is upregulated when Bmi1 levels are high. [score:4]
Bmi1 regulates miR-300 expression in CPCs. [score:4]
Forced expression of miR-300 impairs CPC differentiation. [score:3]
This could be related to the different levels of overexpression of miR-300 in the cell populations (Supplementary Figure S3c). [score:3]
[11] We hypothesize that a similar mechanism of suppression of a transcriptional repressor may operate to activate miR-300 when Bmi1 is overrepresented. [score:3]
Also, miR-300 is highly expressed in a primary subpopulation of CPCs characterized by medium -high expression of Bmi1. [score:3]
In particular, BMI1 -induced Oct4 expression was fully dependent on miR-300. [score:3]
Collectively, these results suggest that miR-300 is necessary for Bmi1 -dependent expression of genes involved in cell-cycle dynamics, which might preserve CPCs in a more undifferentiated state. [score:3]
These data suggest a functional impairment of endothelial cell differentiation in miR-300 and Bmi1 -expressing cells. [score:3]
In agreement with this, CPC-miR-300 cells increase the expression levels of Oct4. [score:3]
This effect was also observed for Meg3, which was reduced by miR-300 overexpression in CPCs, but was increased in MSCs (Figure 3e). [score:3]
Of note, Nkx2.5 gene expression was scarcely detected at any period in CPC-B+ and CPC-miR-300 (Figure 4e), and this was confirmed by western blot analysis (Figure 4f). [score:3]
Thus, knockdown of miR-300 in CPC-B+ and CPC-miR-300 cells reduced Oct4 expression to basal levels compared with control cells. [score:3]
We examined Bmi1 expression in CPC-B+ and CPC-miR-300 cells before and after transfection with anti-miR-300. [score:3]
The expression profile of three miRNAs, miR-300, miR-188, and miR-362, was validated by RT-qPCR, but miR-346 was not confirmed (Figure 1d). [score:3]
In summary, miR-300 enhances the expression of a panel of multipotent genes, indicating a plausible association with the maintenance of CPCs in a more undifferentiated state. [score:3]
Presumably, because of the comparatively low basal expression of miR-300 (Supplementary Figure S3b), it was not included in a recently published study on the miRNA repertoire of adult mouse CPCs. [score:3]
Finally, to confirm that miR-300 is a downstream effector of Bmi1 during the early steps of CPC cardiogenic differentiation, we analyzed Nkx2.5 and Tbx5 expression early after anti-miR-300 transfection. [score:3]
We titrated the anti-miR concentration required to achieve at least a 50% reduction of miR-300 expression in both cell lines (Supplementary Figure S5). [score:3]
We found a modest decrease in the expression of Suz12, Ezh1, and Jarid2 in CPC-miR-300 cells relative to CPC-GFP cultures (Figure 3d). [score:3]
We therefore overexpressed miR-300 in CPCs using a non-viral piggyBac vector (Supplementary Figure S2b). [score:3]
The expression profile of the three confirmed miRNAs in CPCs corresponded to miR-362>miR-188>miR-300 (Supplementary Figure S3b). [score:3]
miR-300 favors maintenance of the undifferentiated state, inhibits differentiation, and establishes a negative feedback loop to control levels of Bmi1. [score:3]
Because DLK1-MEG3 regulation is dependent on polycomb-containing complexes, [28] we assessed whether miR-300 could modulate members of the polycomb complexes PRC1 and PRC2. [score:2]
Moreover, mRNA analysis of endothelial markers revealed that Tie2 and vWf expression was significantly reduced in CPC-miR-300 and CPC-B+ cells compared with control CPC-GFP cells (Figure 4b). [score:2]
Time course analysis of cardiac marker gene expression revealed that, compared with control cells, levels of α-MHC, Nkx2.5, and Tbx5 were significantly reduced in CPC-B+ and CPC-miR-300 cells throughout the differentiation period (Figure 4e). [score:2]
Accordingly, the number of β-Gal+ cells was reduced 2.2-fold in CPC-miR-300 and 6-fold in CPC-B+ populations compared with control (Figure 2b, bottom left), suggesting that miR-300 overexpression contributes to reduce and/or delay senescence. [score:2]
All these results suggest that Bmi1 regulates miR-300. [score:2]
Additionally, knockdown of miR-300 in CPC-miR-300 cells led to a significant reduction in cardiosphere size (Figure 4c, right panel). [score:2]
We hypothesize that the DLK1-MEG3 cluster, where miR-300 is localized, could be regulated in a similar manner. [score:2]
In conclusion, miR-300 is a new member of the family of genes that control stem cell function regulated by Bmi1 in multipotent CSCs. [score:2]
Exposure to anti-miR-300 for as little as 3 days resulted in a partial rescue of Nkx2.5 and Tbx5 expression in CPC-B+ and CPC-miR-300 cells compared with control cells (Figure 4g). [score:2]
miR-300 in the Dlk1-Dio3 contextIn humans, miR-300 localizes to a dense miRNA cluster residing in chromosome 14, region 14q32.31 (DLK1-MEG3; Figure 3a). [score:1]
Little is known about the physiological roles of miR-300. [score:1]
Because activation of Bmi1 in CPCs results in increased levels of miR-300 (Figure 1), we tested whether miR-300 activation affected the levels of Bmi1 mRNA and protein. [score:1]
Cardiac differentiation induced by retinoic acid was also reduced in CPC-miR-300 cells. [score:1]
miR-300/ Bmi1 interaction network in CPCLittle is known about the physiological roles of miR-300. [score:1]
After 6 days in culture, cardiospheres from CPC-miR-300 and CPC-B+ cells were significantly larger than those formed from CPC-GFP cells (Figure 4c), corroborating the finding of increased proliferation potential (Figure 2a). [score:1]
miR-300 counteracts CPC replicative senescence. [score:1]
miR-300 in the Dlk1-Dio3 context. [score:1]
Growth rates of CPC-miR-300 and CPC-B+ cells, at all points analyzed, were significantly higher than CPC-GFP cells (Figure 2a). [score:1]
[35] Although prevention of senescence in CPC-miR-300 cells is less effective than in CPC-B+, p16 levels are significantly reduced in CPC-miR-300 cells. [score:1]
miR-300/ Bmi1 interaction network in CPC. [score:1]
CPC-GFP cells, but not CPC-miR-300 or CPC-B+ cells, formed reticular structures after 10–12 days (Figure 4a, brightfield), which were positive for CD31 (Figure 4a). [score:1]
In humans, miR-300 localizes to a dense miRNA cluster residing in chromosome 14, region 14q32.31 (DLK1-MEG3; Figure 3a). [score:1]
[1 to 20 of 77 sentences]
3
[+] score: 138
Other miRNAs from this paper: hsa-mir-128-1, hsa-mir-206, hsa-mir-128-2, hsa-mir-410
However, treatment with integrin αvβ3 mAb, KP-392, and an Akt inhibitor or ILK and Akt siRNA reversed WISP-1 -inhibited miR-300 expression (Figure 5A–5C), indicating that WISP-1 promotes VEGF-C expression and lymphangiogenesis by suppressing miR-300 expression via the integrin αvβ3, ILK, and Akt pathway. [score:13]
Furthermore, treatment with an ILK or an Akt inhibitor or siRNA reversed WISP-1 -mediated miR-300 expression as well as VEGF-C 3′-UTR activity, implying that ILK and Akt are upstream mediators of WISP-1 suppression of miR-300 expression. [score:9]
In the current study, cells incubation with ILK and Akt inhibitor reversed WISP-1-reduced miR-300 expression indicating WISP-1 inhibited miR-300 expression through ILK/Akt pathway. [score:9]
miR-300 has been reported to inhibit the epithelial-mesenchymal transition and tumor metastasis in human epithelial cancer via targeting of Twist [48]; miR-300 has also been shown to be a negative regulator of differentiation in glioma stem-like cells [49], but its effect on VEGF-C expression remains largely unknown. [score:8]
In summary, we showed that WISP-1 promotes VEGF-C expression and increases lymphangiogenesis by down -regulating miR-300 via the integrin αvβ3, ILK, and Akt signaling pathway, indicating that WISP-1 a novel target for inhibition of lymphangiogenesis in OSCC. [score:8]
WISP-1 induces VEGF-C expression in OSCC cells by inhibiting miR-300 expression through the integrin αvβ3/ILK/Akt pathway. [score:7]
Figure 6 WISP-1 induces VEGF-C expression in OSCC cells by inhibiting miR-300 expression through the integrin αvβ3/ILK/Akt pathway. [score:7]
In addition, WISP-1 promotes VEGF-C expression and lymphangiogenesis by down -regulating miR-300 expression via the integrin αvβ3, ILK, and Akt signaling pathways (Figure 6). [score:6]
To explore miR-300 involvement in WISP-1 -induced VEGF-C expression and lymphangiogenesis, a miR-300 mimic was used; transfection with the miR-300 mimic diminished WISP-1 -induced VEGF-C expression as well as migration and tube formation in LECs (Figure 4C–4F). [score:5]
In addition, we found that miR-300 directly represses VEGF-C protein expression through binding to the 3′-UTR of the human VEGF-C gene, thereby negatively regulating VEGF-C -mediated lymphangiogenesis. [score:5]
Figure 5(A– C) Cells were pretreated for 30 min with integrin αvβ3 antibody, KP-392, and an Akt inhibitor or transfected with ILK and Akt siRNA for 24 h and stimulated with WISP-1 for 24 h. miR-300 expression was examined by qPCR (n = 6). [score:5]
WISP-1 promotes VEGF-C production by inhibiting miR-300 expression. [score:5]
Whether ILK/Akt control miR-300 expression through transcriptional or posttranscriptional regulation is needs further examination. [score:4]
We also found knockdown WISP-1 diminished lymphangiogenesis marker (LYVE-1), integrin αvβ3, ILK, and Akt expression in vivo (Supplementary Figure S7), implying WISP-1/integrin αvβ3/ILK/Akt/miR-300/VEGF-C axis plays key role in lymphangiogenesis in vivo. [score:4]
Collectively, these suggest that miR-300 directly represses VEGF-C protein expression via binding to the 3′-UTR of the human VEGF-C gene via ILK and Akt signaling. [score:4]
WISP-1 promotes VEGF-C expression by down -regulating miR-300. [score:4]
miR-300 directly represses VEGF-C expression via binding to the 3′-UTR of human VEGF-C. DISCUSSION. [score:4]
We therefore examined the role of miR-300 in WISP-1 -mediated VEGF-C expression. [score:3]
Exogenous WISP-1 also reduced miR-300 expression in a concentration -dependent manner (Figure 4B). [score:3]
To learn whether miR-300 inhibits VEGF-C via the 3′-UTR, we constructed a luciferase reporter vector harboring the wild-type 3′-UTR of VEGF-C mRNA (wt-VEGFA-3′-UTR) and a vector containing mismatches in the predicted miR-300 binding site (mt-VEGFA-3′-UTR) (Figure 5D). [score:3]
In addition, miR-300 is inhibited by WISP-1 via the integrin αvβ3/integrin-linked kinase (ILK)/Akt signal pathway. [score:3]
Figure 4(A and B) Cells were infected with WISP-1 shRNA for 24 h or incubated with WISP-1 (0–30 ng/mL) for 24 h, and miR-300 expression was examined by qPCR (n = 5). [score:3]
In addition, we also indicated that the mRNA expression of VEGF-C, WISP-1, integrin αv, integrin β3, ILK, Akt but not miR-300 were higher in OSCC patients than in normal (Supplementary Figure S5 and S6). [score:3]
We observed that exogenous WISP-1 reduced miR-300 expression. [score:3]
Cotransfection with a miR-300 mimic reduced WISP-1 -induced VEGF-C expression, as well as migration and tube formation in LECs. [score:3]
We ranked the 8 miRNAs that harboring the binding sites of VEGF-C. We found miR-300 was the most increased after knockdown WISP-1 (Supplementary Figure S8). [score:2]
The 3′-UTR-luciferase reporter constructs containing the 3′-UTR regions of VEGF-C with wild-type and mutant binding sites for miR-300 were amplified by PCR of cDNAs obtained from H293T cells. [score:1]
We found that miR-300 was increased by WISP-1 shRNA infection in two OSCC cell lines (Figure 4A). [score:1]
In addition, transfection with the miR-300 mimic antagonized the WISP-1-increased luciferase activity in the wt-VEGF-C-3′-UTR plasmid (Figure 5E). [score:1]
org) revealed that the 3′-UTR of VEGF-C mRNA harbors potential binding sites for miR-300. [score:1]
The miR-300 mimic, miRNA control, Lipofectamine 2000, and Trizol were purchased from Life Technologies (Carlsbad, CA, USA). [score:1]
[1 to 20 of 31 sentences]
4
[+] score: 101
miRNA target prediction analysis proved that Twist is the targets of miR-300; transfection of cells with the miR-300 -mimic strongly inhibited ET-1 -induced Twist expression. [score:9]
ET-1 promotes cell migration and EMT expression by downregulating miR-300 expression. [score:8]
In addition, BQ123, BQ788 and AMPK inhibitors (Ara A and compound C) reversed ET-1 -inhibited miR-300 expression (Figure 7C) and WT-Twist-3′UTR luciferase activity (Figure 7D). [score:7]
Our study indicates that miR-300 is downregulated in response to ET-1; miR-300 reportedly suppresses tumor formation in human glioblastoma, making it an attractive candidate biomarker for the prediction of response to cancer treatment [42, 43]. [score:6]
The results indicate that miR-300 targets the 3'-untranslated region (UTR) segment of Twist mRNA. [score:5]
Remarkably, miR-300 was down-regulated in cancer cells that underwent EMT compared with miR-300 expression in typical epithelial phenotype carcinoma cells, indicating that miR-300 may affect EMT. [score:5]
ET-1 induces Twist expression by inhibiting miR-300 in chondrosarcomas. [score:5]
Our findings indicate that miR-300 directly represses Twist protein expression through binding to the 3′UTR of human Twist genes, and thus negatively regulates Twist -mediated metastasis. [score:5]
These vectors were then transfected into JJ012 cells after undergoing treatment with various concentrations of ET-1. As shown in Figure 7B, ET-1 decreased luciferase activity in the WT-Twist-3′UTR plasmid but not in the MT-Twist-3′UTR, indicating that miR-300 directly represses Twist protein expression via binding to the 3′UTR of human Twist. [score:4]
miR-300 directly represses Twist expression via binding to the 3'UTR of the human Twist. [score:4]
These data indicate that miR-300 directly represses Twist expression via binding to the 3′UTR of human Twist through ETRs and AMPK signaling. [score:4]
In addition, the downregulation of miR-300 through the ETRs and AMPK pathway is mediated by ET-1 -induced EMT and tumor metastasis. [score:4]
In this study, transfection of cells with miR-300 mimic reduced ET-1 -induced cell migration, indicating that miR-300 can function as a tumor suppressor. [score:3]
This study found that ET-1 promotes EMT in chondrosarcomas by inhibiting miR-300 via the AMP-activated protein kinase (AMPK) signaling pathways. [score:3]
When we transfected chondrosarcomas with a miR-300 mimic then treated them with ET-1, the miR-300 mimic but not the control miRNA abolished ET-1 -induced Twist expression and EMT (Figure 6D-6E). [score:3]
We found that miR-300 expression was decreased in a dose -dependent manner after ET-1 treatment (Figure 6A). [score:3]
A. Cells were incubated with ET-1 (10~100 nM) for 24 h, and miR-300 expression was examined by q-PCR. [score:3]
We also confirmed the role of miR-300 in cell migration by targeting Twist. [score:3]
C-E. Cells were pretreated with BQ123 (10 μM), BQ788 (10 μM), Ara A (1 mM) and compound C (10 μM) for 30 min or pre -transfected with specific siRNAs for 24 h followed by stimulation with ET-1 for 24 h. miR-300 expression or wild-type Twist 3′UTR luciferase activity were examined (n=4-5). [score:3]
To elucidate whether miR-300 specifically targets the Twist 3′UTR, we constructed luciferase reporter vectors harboring wild-type 3′UTR of the Twist mRNA (WT-Twist-3′UTR) and mismatches in the predicted miR-300 binding site (MT-Twist-3′UTR; Figure 7A). [score:3]
Figure 6 A. Cells were incubated with ET-1 (10~100 nM) for 24 h, and miR-300 expression was examined by q-PCR. [score:3]
The data indicate that the miR-300 mimic inhibited ET-1 -induced migration (Figure 6B) and invasion (Figure 6C). [score:3]
Cells were transfected with a control miRNA or miR-300 mimic for 24 h then stimulated with ET-1 (100 nM) for 24 h. B-E. Cell migration (B), invasion (C) and EMT marker expression (D-E) were examined by Transwell migration assay, invasion assay, western blot and q-PCR (n=4-6). [score:1]
miRNA control and miR-300 mimic were purchased from Invitrogen (Carlsbad, CA, USA). [score:1]
Our study elucidates the mechanism of ET-1 -induced EMT in chondrosarcoma; miR-300 may play a pivotal role in this process. [score:1]
Figure 7 A. Schematic 3'UTR representation of the human Twist containing the miR-300 binding site. [score:1]
A. Schematic 3'UTR representation of the human Twist containing the miR-300 binding site. [score:1]
[1 to 20 of 27 sentences]
5
[+] score: 21
Of a number of upregulated miRNAs, miRNA-376a, miR-127, miR-34a, miR-300, miR-342-3p were downregulated following metformin treatment in MCD-fed mice. [score:7]
The five downregulated miRNAs i. e., miRNA-376a, miRNA-127, miRNA-34a, miRNA-300 and miRNA-342-3p, were identical to five of the 71 upregulated miRNAs in control and MCD-fed mice. [score:7]
Notably, miR-122, miR-194, miRNA-101b, and miRNA-705 were upregulated and miRNA-376a, miRNA-127, miRNA-34a, miRNA-300 and miRNA-342-3p were downregulated in the liver tissue of MCD-fed mice treated with or without metformin (Table IB and Fig. 6). [score:7]
[1 to 20 of 3 sentences]
6
[+] score: 20
Expression levels of the other miRNAs were calculated as fold changes based on the miR-214 expression level of 1. miR-148, miR-494, miR-124, miR-193, and miR-300 showed increased expression levels from day 1 to 7. miR-148 showed very high expression levels (2272 to 6517 fold changes compared with that of miR-214) (Figure 3B), while miR-132, miR-186, miR-199, miR-338, and miR-219 showed decreased expression from day 1 to 7 (Figure 3C). [score:8]
The second group that had a low expression level on day 1 and a high expression level on day 7 included miR-148, miR-494, miR-124, miR-193, and miR-300. [score:5]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG We have previously shown that miR-124 is expressed in human core blood hematopoietic progenitor cells (HPCs) and it specifically binds to the Tip110 3′UTR and has a regulatory effect on core blood HPCs [7]. [score:4]
Figure 3Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG (A) Schematic of the Tip110 3′UTR region with predicted miRNA binding sites (Tip110 miRNA). [score:1]
Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
[1 to 20 of 6 sentences]
7
[+] score: 11
The downregulated PTTG1 -targeting miRNAs (miR-329, miR-300, miR-381, and miR-655) induced PTTG1 expression resulting in the downregulation of p53. [score:11]
[1 to 20 of 1 sentences]
8
[+] score: 10
While hsa-miR-548l, hsa-miR-300, has-miR-381, has-let7f-1* and hsa-let7a* miRNAs were not or very poorly expressed in any of the aforementioned cell lines, both PAI-1 (see Table 1 ) and miR-421 (see Table 2 ) were homogeneously found expressed in these cell lines with the highest levels observed in HUVEC. [score:5]
According to bioinformatics tools such as Targetscan [15] and microSniper [16], the rs1050955 polymorphism is predicted to map in the close vicinity of target binding sites for several miRNAs including hsa-miR-300, hsa-miR-381, hsa-miR-548l, hsa-let7f-1*, has-let7-a* and hsa-miR-421. [score:5]
[1 to 20 of 2 sentences]
9
[+] score: 7
For example, miRNAs that promote differentiation such as let-7 family were up-regulated whereas miRNAs that promote pluripotency such as the miR-300 cluster are down-regulated. [score:7]
[1 to 20 of 1 sentences]
10
[+] score: 6
While two of them, miR-539 and miR-300 have no target site in the murine Twist1 3′UTR, a third, miR-543 did not show a significant effect in our screen. [score:3]
While this work was under revision, miR-214 [36], miR-300, miR-539 and miR-543 [37] have also been reported to target the TWIST1 3′UTR. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 5
However, as TGF- β can also promote cancer cell invasion by inducing Epithelial-Mesenchymal Transition (EMT) [87], it is rational to conclude that miRNAs targeting TGF- β pathway may suppress invasion and metastasis by blocking EMT, as miR-300 does in human epithelial cancer [88]. [score:5]
[1 to 20 of 1 sentences]
12
[+] score: 4
Several miRNAs have been documented to directly inhibit TWIST1, including miR-1-1 [26], miR-33a [27, 28], miR-137 [29], miR-186 [30], miR-300 [31], miR-520d-5p [32], miR-539 [31], miR-543 [31], miR-675 [33], and miR-720 [34]. [score:4]
[1 to 20 of 1 sentences]
13
[+] score: 4
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Another couple of miRNAs (miR-32-3p and miR-300-3p) was down-regulated around the time of the first spontaneous seizure (Supplementary Fig. S7C). [score:4]
[1 to 20 of 1 sentences]
14
[+] score: 3
The panel of the 776 miRNAs screened in this study included other miRNAs whose genes are also located in this region, such as miR-300 and miR-541, but their expression was not modulated with passage of VERO cells. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 1
Impressively, our previous microarray data indicated that in addition to miR-127 and miR-379, several other miRNAs from the Dlk1-Gtl2 region, including miR-433, miR-300, and miR-382, were also increased in MRL-lpr and B6-lpr mice [34]. [score:1]
[1 to 20 of 1 sentences]
16
[+] score: 1
A recent computational analysis exploring the potential cross-talk between RBPs, such as PUM proteins, and miRNA -mediated repression of human mRNAs identified a specific group of miRNA (miR-30-abcde/385-5p, miR-144, miR-376c, miR-300, miR-101, miR-221/222, and miR-410) binding sites overrepresented near PUM recognition sites in the 3'-UTR, suggesting strong cooperation to control the decay of these mRNAs [22]. [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
As shown in Figure 3D, miR-300 mimics or antisense led to a reduction or increase of luciferase activity. [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-98, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-141, mmu-mir-194-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-203a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-200b, mmu-mir-300, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-343, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-135a-2, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-326, hsa-mir-135b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-21, rno-mir-26b, rno-mir-27b, rno-mir-27a, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-33, rno-mir-98, rno-mir-126a, rno-mir-133a, rno-mir-135a, rno-mir-141, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-203a, rno-mir-211, rno-mir-218a-2, rno-mir-218a-1, rno-mir-300, hsa-mir-429, mmu-mir-429, rno-mir-429, hsa-mir-485, hsa-mir-511, hsa-mir-532, mmu-mir-532, rno-mir-133b, mmu-mir-485, rno-mir-485, hsa-mir-33b, mmu-mir-702, mmu-mir-343, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-511, rno-mir-466b-1, rno-mir-466b-2, rno-mir-532, rno-mir-511, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466b-8, hsa-mir-3120, rno-mir-203b, rno-mir-3557, rno-mir-218b, rno-mir-3569, rno-mir-133c, rno-mir-702, rno-mir-3120, hsa-mir-203b, mmu-mir-344i, rno-mir-344i, rno-mir-6316, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-3569, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, rno-mir-466b-3, rno-mir-466b-4, mmu-mir-203b
Type of site Context+ Context Structure Energy Is experimental validated rno-miR-326-5p MIMAT0017028 3 8mer 7mer-m8 imperfect −0.442 −0.242 431 −65.97 TRUE rno-miR-485-5p MIMAT0003203 2 7mer-m8 −0.343 −0.372 290 −34.96 TRUE rno-miR-300-5p MIMAT0004743 1 8mer −0.338 −0.421 156 −15.16 TRUE rno-miR-702-5p MIMAT0017884 1 8mer −0.317 −0.274 142 −13.86 TRUE rno-miR-203b-3p MIMAT0017800 2 7mer-m8 −0.298 −0.421 295 −29.93 TRUE rno-miR-33-3p MIMAT0017104 2 8mer 7mer-m8 −0.297 −0.813 305 −22.7 TRUE rno-miR-466b-3p MIMAT0017285 1 8mer −0.295 −0.47 159 −15.26 TRUE rno-miR-532-5p MIMAT0005322 1 7mer-m8 −0.268 −0.302 151 −10.71 TRUE rno-miR-511-5p MIMAT0012829 1 7mer-m8 −0.268 −0.302 152 −10.37 TRUE rno-miR-343 MIMAT0000591 1 7mer-m8 −0.262 −0.24 140 −13.75 TRUE rno-miR-203a-3p MIMAT0000876 1 8mer −0.245 −0. [score:1]
[1 to 20 of 1 sentences]
19
[+] score: 1
We also choose to include seven miRNAs (mir-370, mir-337-5p, mir-376c, mir-377, mir-1247, mir-758 and mir-300) that are located on the q arm of chromosome 14, which has been found to be aberrant and implicated in many types of cancer [24]. [score:1]
[1 to 20 of 1 sentences]