sort by

31 publications mentioning hsa-mir-509-2

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-509-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 336
The lack of miR-509 expression in healthy donor blood cell types and CD34 [+] HSPCs [32] exemplifies the importance of functional screening to identify growth-suppressing miRs, as expression profiling comparing acute leukemia cases versus healthy donor samples would not have identified miR-509 as a miR capable of inhibiting leukemia cell growth. [score:9]
Although the mRNAs of 9 of the 12 tested predicted miR-509 targets were not reduced in miR-509-transduced NALM6 cells, some of these may still be targets of miR-509 as they might be inhibited at the translational level [51]. [score:9]
First, we downloaded the sets of predicted mRNA targets of miR-509-5p and miR-509-3p (Set 1), as well as those of the 4 miRs that we had shown not to inhibit NALM6 growth (i. e. miR-381, miR-432, miR-550a and miR-873; Set 2) from the TargetScan6.2 [37] and/or miRDB [38], [39] miR target prediction databases. [score:9]
Then, we intersected these 3 sets of mRNAs [41] to identify the subset of genes expressed in NALM6 and predictively targeted by miR-509, but not predictively targeted by the 4 miRs that did not inhibit NALM6 growth. [score:9]
In the initial study herein, we instead used bioinformatics to define a subset of predicted miR-509 target genes known to be expressed in NALM6 cells but not predicted to be targeted by the miRs that failed to inhibit NALM6 cell growth. [score:9]
Thus, while future studies may find additional targets of miR-509-5p and/or miR-509-3p that contribute to miR-509 -mediated growth inhibition, our current results demonstrate that RAB5C is a novel target of miR-509 and an important driver of the growth of human B-ALL cells. [score:7]
These targets were subjected to a filtering strategy presented in Fig. 4A and meet the following criteria: (i) They are predicted targets of miR-509-5p and/or miR-509-3p from TargetScan6.2 and/or miRDB. [score:7]
Upon effective knockdown of RAB5C using each of 3 shRNA constructs, NALM6 cell growth was reduced; thus, RAB5C knockdown phenocopied the growth inhibition observed by enforced miR-509 expression. [score:7]
However, given that reduction at the mRNA level was observed in ≥84% of miR targets with reduced protein levels [52], we decided to focus in the study herein on predicted targets inhibited by miR-509 at the mRNA level. [score:7]
However, miR-509 is not a global inhibitor of cell growth, as enforced miR-509 expression in 2 T-ALL (Jurkat and KARPAS-45) and 1 myeloid leukemia (K562) cell lines did not inhibit growth. [score:7]
Of these 74 predicted targets of miR-509, 12 genes previously demonstrated in the literature to be either involved in leukemia and oncogenesis (ERLIN2, FLI1, FOXP1, MAML1, RAC1, YWHAB and YWHAG), or predicted as miR-509 targets by both TargetScan6.2 and miRDB (PGRMC1, RAB5C, RAC1, TFDP2, UHMK1, USP9X) were selected for initial qRT-PCR analysis. [score:7]
Since RAB5 has been implicated in cell cycling [44], [45] and is one of the top 3 predicted targets of miR-509-3p by both TargetScan6.2 (Total context+ score  = −0.65) and miRDB (Target score  = 91), we focused our subsequent studies on RAB5C. [score:7]
Susceptibility to miR-509 growth inhibition is likely due to differential expression or differential dependence upon miR-509 target genes for cell proliferation and survival [46]. [score:7]
We then selected those targets known to be involved in cellular processes that regulate growth (e. g. proliferation, cell cycle, cell death, oncogenes), resulting in a set of 74 growth-related predicted miR-509 targets. [score:6]
3 of these 12 predicted targets (RAB5C, RAC1, and UHMK1) were down-regulated by miR-509 at the mRNA level (Figure 4B). [score:6]
Our observations that co-transduction of the RAB5C ORF lacking its 3′UTR (therefore no longer regulated by miR-509) rescues miR-509 -mediated growth inhibition indicates that reduction of RAB5C is a major mechanism of miR-509 -mediated NALM6 growth inhibition. [score:6]
Our observation that enforced miR-509 expression inhibits growth of B-ALL cell lines provided the clue to identifying the role of RAB5C in the growth of B-ALL cells. [score:5]
Enforced miR-509 expression inhibits growth of NALM6 cells. [score:5]
Set 1 refers to the list of predicted targets of miR-509-5p or miR-509-3p from TargetScan6.2 or miRDB. [score:5]
In absolute qRT-PCR quantifications [30], [31], miR-509-transduced NALM6 cells expressed 1,814±95 copies (mean ± SEM) per cell of miR-509-5p (Table 1), comparable to levels of miR-18a, which for reference is expressed at the 70th percentile of all miRs in NALM6 cells based on our miR microarray data (Figure 1D). [score:5]
We went on to determine the cellular mechanism of miR-509 -mediated B-ALL growth inhibition and identify RAB5C as a key B-ALL growth-promoting factor targeted by miR-509. [score:5]
Using qRT-PCR to assess levels of 12 of these 74 targets in miR-509-transduced versus empty vector-transduced NALM6 cells, 3 predicted miR-509 targets were reduced in miR-509-transduced NALM6 cells. [score:5]
Neither miR-509-5p nor miR-509-3p is predicted to target RAB5A, and we did not detect any change in RAB5A expression in miR-509-transduced NALM6 cells (Figure S5). [score:5]
Moreover, RAB5C mRNA was the target most reduced in response to miR-509 expression, and therefore we focused on RAB5C for further experiments. [score:5]
To identify targets of miR-509 that might mediate growth of B-ALL cells, we used a filtering strategy to prioritize the many predicted targets of miR-509 (Figure 4A). [score:5]
Enforced miR-509 expression inhibited growth of NALM6 cells. [score:5]
To identify relevant miR-509 targets, we may in the future employ biochemical or genomic techniques [49], [50] to identify all of the targets of miR-509 in NALM6 cells. [score:5]
RAB5C is a direct target of miR-509. [score:4]
This indicated that miR-509 directly targets the 3′UTR of RAB5C via both predicted miR-509-3p binding sites. [score:4]
To investigate the cellular mechanisms by which enforced miR-509 expression inhibits growth, we examined whether miR-509 regulates cell cycle progression by conducting BrdU/7-AAD staining [36]. [score:4]
Table S6 List of the 395 predicted targets of miR-509-5p and/or miR-509-3p selected based on filtering strategy shown in Figure 4A. [score:3]
This was despite documented overexpression of miR-509 in these transduced cell lines (Figure S3). [score:3]
MiR-509 directly targets RAB5C. [score:3]
0111777.g004 Figure 4(A) Venn diagram showing the number of mRNAs that do not overlap, or are shared between each set in our in silico strategy to identify relevant targets of miR-509. [score:3]
0111777.g005 Figure 5(A) Sequence alignment of RAB5C to miR-509-3p predicted by TargetScan6.2. [score:3]
Identifying mRNA targets of miR-509. [score:3]
Figure S3 Enforced expression of miR-509 was detected by qRT-PCR in selected T-ALL and myeloid leukemia cell lines transduced with miR-509 lentivirus. [score:3]
Thus, RAB5C rescued, in large part, the growth inhibitory effects of miR-509. [score:3]
Enforced miR-509 resulted in inhibition of growth of 3 B-ALL cell lines, NALM6, REH and RCH-ACV. [score:3]
We next examined if the growth inhibitory effects of miR-509 extended to other B-ALL (RCH-ACV and REH), T-cell ALL (T-ALL; Jurkat and KARPAS-45) or myeloid leukemia (K562) cell lines. [score:3]
NALM6 cells were transduced with either EV#1or miR-509 overexpressing lentivirus, and whole cell lysates were harvested at 7 days after transduction. [score:3]
Since miR-509-5p and miR-509-3p are undetectable in normal or leukemic hematopoietic cells, miR-509 does not qualify as a tumor suppressor miR for leukemias. [score:3]
In this paper, we extended our gain-of-function screening of human miRs to B-ALL cells and identified miR-509 as a novel B-ALL growth -inhibitory miR. [score:3]
Overexpression of RAB5C ORF in NALM6 cells co-transduced with miR-509 was confirmed by western blotting (Figure 6E, 6F). [score:3]
Our observations in NALM6 are consistent with previous reports that both miR-509-5p [47] and miR-509-3p [48] suppressed cell growth and induced apoptosis in a human renal cancer cell line. [score:3]
Our miR microarray expression analyses [32] (GEO Series accession number GSE51908) revealed undetectable endogenous levels of mature miR-509-5p and miR-509-3p in NALM6 and other acute leukemia cell lines (Figure 1D, 1E), as well as in primary leukemia cases and CD34 [+] hematopoietic stem-progenitor cells (HSPCs) and blood cell types from normal human donors (Figure 1D, 1E). [score:3]
Grey boxes indicate the 2 predicted miR-509-3p target sites (66–72 and 759–766), and the “X” indicates the deletion sites present in the deletion (Δ) constructs. [score:3]
Figure S4 RAB5C protein levels were decreased in RCH-ACV and REH cells with enforced miR-509 expression. [score:3]
RAB5C mediates the growth -inhibitory effect of miR-509. [score:3]
More extensive testing will be necessary to determine if the growth inhibitory effects of miR-509 might be specific to B-ALL cells or some molecularly-defined subset of leukemias or shared with other cancer types. [score:3]
TargetScan6.2 predicts a miR-509-5p binding site in the 3′UTR of RAB5B (total context+ score  = −0.04). [score:3]
Enforced miR-509 expression in decreased proportion of cells in S-phase, induced apoptosis and activated caspase-3/7. [score:3]
In order to determine whether RAB5C mediates miR-509 induced growth inhibition in NALM6 cells, we performed a rescue experiment. [score:3]
Sequences shown in bold refer to position 66–72 and 759–766 of RAB5C 3′UTR where miR-509-3p is predicted to target. [score:3]
MiR-509-3p was expressed at 3,656±117 copies per cell in miR-509-transduced NALM6 cells, also within the physiological range of miR copy numbers per cell (range: <10 to>30,000 copies per mammalian cell) [30]. [score:3]
We further observed that enforced miR-509 expression reduced the number of actively proliferating cells and increased apoptotic and dead NALM6 cells, indicating that miR-509 reduces cell proliferation and survival. [score:3]
There are 2 miR-509-3p binding sequences in the 3′UTR of RAB5C (Figure 5A), as predicted by both miRDB and TargetScan6.2. [score:3]
0111777.g003 Figure 3(A) Representative flow cytometric plots showing cell cycle distribution of NALM6 cells transduced with empty vector (EV#1) or miR-509 overexpressing lentivirus. [score:3]
Given that RAB5 is a key regulator of the endosome pathway, the impaired cell growth in miR-509-transduced or RAB5C-knockdown cells might be due to aberrant recycling of surface growth receptors, such as transferrin receptor [53]. [score:3]
In this study, we conducted a functional miR-HTS in NALM6 cells and identified miR-509 as a novel inhibitor of human B-ALL cell growth. [score:3]
Thus, miR-509 inhibited the growth of all 3 tested human B-ALL cell lines, NALM6, RCH-ACV and REH. [score:3]
Cells were transduced with either EV#1or miR-509 overexpressing lentivirus, and whole cell lysates were harvested at 7 days after transduction. [score:3]
4 miRs (miR-381, miR-509, miR-550a, and miR-873) and 1 miR cluster (miR-432∼136) inhibited NALM6 growth in at least 2 of 3 replicate screens performed. [score:3]
RNA was isolated from NALM6 cells transduced with EV#1 or miR-509 overexpressing lentivirus at 7 days after transduction. [score:3]
While our BrdU/7-AAD analysis did not detect significantly elevated numbers of miR-509-transduced NALM6 cells in cell cycle phase G [2]/M, this could be due to expression of the compensatory isoform RAB5A. [score:3]
To determine if repression of RAB5C would phenocopy the growth suppressive effect of miR-509, NALM6 cells were transduced with 3 different lentiviruses, each containing a distinct shRNA against RAB5C. [score:3]
Informatics prediction of RAB5C as a target of miR-509. [score:3]
Using NALM6 B-ALL cell line, enforced expression of miR-509 reduced NALM6 B-ALL cell growth in 3 independent growth assays. [score:2]
As expected, miR-509-5p and miR-509-3p were strongly overexpressed in miR-509-transduced NALM6 cells as assayed by qRT-PCR (Figure 1C). [score:2]
MiR-509 inhibited growth of RCH-ACV and REH B-ALL cell lines. [score:2]
Both miR-509-3p binding sequences are present in the RAB5C 3′UTR of several species including human, mouse, rat, horse and dog, suggesting that the regulation of RAB5C by miR-509 is also conserved. [score:2]
MiR-509 has been reported previously to be down-regulated in renal cell carcinoma as compared to normal tissue counterparts [47], [48]. [score:2]
MiR-509 -mediated growth inhibition was also observed in 2 additional B-ALL cell lines, REH and RCH-ACV. [score:2]
MiR-509 inhibited growth of 2 additional B-ALL cell lines. [score:2]
In contrast, NALM6 cells co-transduced with miR-509 plus RAB5C lentiviruses had 36% greater growth than cells co-transduced with miR-509 plus the empty vector (p<0.05). [score:1]
Co-transfection of Δ1Δ2 construct (in which both predicted miR-509-3p binding sites were deleted) with miR-509-3p mimic abolished the reduction in luciferase signal. [score:1]
This plasmid was then used as a template for site-directed mutagenesis to delete the first miR-509-3p binding sites in RAB5C-3′UTR-luciferase deletion construct, Δ1or Δ1Δ2 using primers Del56-72. [score:1]
Correspondingly, RAB5C protein was 85% (p<0.001) lower in miR-509-transduced cells by western blotting (Figure 4C, 4D). [score:1]
Absolute copy number of mature miR-509 and miR-18a RNA per NALM6 cell. [score:1]
Co-transfection of either RAB5C-3′UTR-luciferase deletion construct, Δ1 or Δ2, plus miR-509-3p mimic resulted in >50% lower (p<0.01) relative luciferase activity than cells transfected with only the indicated RAB5C-3′UTR deletion constructs. [score:1]
NALM6 cells were transduced with miR-509 lentivirus to MOI  = 2, and total RNA was collected at 7 days after transduction. [score:1]
Figure S5 RAB5A mRNA levels show no change in miR-509-transduced NALM6 cells. [score:1]
Means ± SEMs are plotted, and SEMs for miR-509 were very small. [score:1]
We cloned the full-length wild type (WT) 3′UTR of RAB5C downstream of firefly luciferase gene (luc2) in the pmirGLO luciferase vector and also generated 3 luciferase constructs containing 1 (Δ1 or Δ2) or both (Δ1Δ2) deletions of miR-509-3p binding sites (Figure 5B). [score:1]
Co-transfection of miR-509-3p mimic and RAB5C-3′UTR WT luciferase vector resulted in 81% lower (p<0.001) relative luciferase activity than in cells transfected with RAB5C-3′UTR WT luciferase vector alone (Figure 5C). [score:1]
RAB5C mRNA levels showed the greatest reduction, with a 40% lower level (p<0.05) in miR-509-transduced than in empty vector-transduced NALM6 cells (Figure 4B). [score:1]
Copy number per cell was estimated based on standard curves of miR-509-5p, miR-509-3p or miR-18a using DNA oligonucleotides. [score:1]
MiR-509 was then subcloned from pWCC52-miR-509 into empty lentiviral vector #2 (EV#2; pWCC72) downstream of DsRed. [score:1]
For deletion of the second miR-509-3p binding site in Δ2 construct and Δ1Δ2 constructs, standard PCR was performed. [score:1]
Values for miR-509 were normalized to EV#1. [score:1]
Instead, we decided to focus on miR-509 for further studies. [score:1]
We then examined if reduced RAB5C is responsible for the functional effects of miR-509. [score:1]
NALM6 cells were transduced with miR-509 lentivirus or empty vector (EV#1) at MOI  = 2, and transduced GFP [+] cells were mixed with an equal number of mock-transduced cells (GFP [–]) 7 days later to achieve an initial culture of ∼50%GFP [+] cells; this was designated Day 0 and the %GFP [+] cells (pre-gated on viable cells) was assessed weekly by flow cytometry. [score:1]
To examine if miR-509 directly represses RAB5C, we employed RAB5C-3′UTR luciferase reporter assays. [score:1]
We showed that miR-509 indeed binds to the 3′UTR of RAB5C via the 2 thermodynamically predicted sites. [score:1]
4 days after transduction, miR-509-transduced NALM6 had fewer cells in S-phase than empty vector-transduced cells (Figure 3A), and this was statistically significant (Figure 3B, p<0.05). [score:1]
At 8 days after transduction, cultures of miR-509-transduced NALM6 cells contained 43% fewer viable cells than empty vector-transduced cells by trypan blue counts (Figure 2A). [score:1]
Figure S2 MiR-509 does not regulate the growth of Jurkat, KARPAS-45 and K562 cells. [score:1]
No difference in mitochondrial membrane potential was observed between miR-509-transduced and empty vector-transduced NALM6 cells (data not shown). [score:1]
[1 to 20 of 99 sentences]
2
[+] score: 62
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-509-1, hsa-mir-509-3
We recently reported that some anionic PNAs, synthesized by our group, are a potential treatment for CF by targeting the miR-509-3p involved in the regulation of CF disease-gene expression [37]. [score:8]
With this study, we demonstrate that the activity of miR-509-3p can be inhibited even with the use of a PNA as short as seven bases long targeting exclusively the seed region of the miRNA. [score:5]
Previously, we showed that the activity of the miR-509-3p miRNA, one of miRNAs involved in the posttranscriptional regulation of CFTR gene of CF and CF-RD, could be inhibited through the use of the 14-mer PNA1 fully complementary to the first fourteen bases of miR-509-3p [37]. [score:4]
Finally, by reverting the expression of the luciferase gene containing the 3′UTR of the CFTR gene, we also demonstrated that PNA1 is able to recognize miR-509-3p in A549 cells. [score:3]
We here anticipate that PNA2, notwithstanding its reduced length, was still able to recognize miR-509-3p in A549 cells where it reverted the expression of the luciferase gene containing the 3′UTR of the CFTR gene. [score:3]
Once the ability of PNA2 to form a stable heteroduplex with miR-509-3p was demonstrated, we examined its potential of being a miR-509-3p inhibitor in a biological context. [score:3]
With the aim of evaluating the feasibility of our hypothesis of shortening the PNA1 molecule to achieve a more synthetically affordable PNA targeted against miR-509-3p that preserves the hybridization properties of the parent PNA1, PNA2 was designed by deleting all the PNA1 bases that were not complementary to the “seed region” of miR-509-3p (i. e. the first seven bases at its 5′end, considered the most important target to achieve the anti-miRNA activity). [score:2]
Furthermore, our group has shown that mutations in the 3′UTR of the CFTR gene may have a pathogenic effect by enhancing the affinity for the miR-509-3p miRNA [15]. [score:2]
On the basis of the positive indications coming from the MD studies, we synthesised the PNA2 molecule and studied its ability to recognize the 2′-OMe mimic of miR-509-3p by CD, UV, and EMSA studies and evaluated its ability to restore the expression of the luciferase gene containing the 3′UTR of the CFTR gene in the presence of miR-509-3p. [score:1]
Synthesis of miR-509-3p and PNAs (Table 1). [score:1]
Briefly, cells seeded in 96-well plates were cotransfected with the luciferase reporter constructs and the miR-509-3p mimic. [score:1]
As expected, the transfection of the miR-509-3p reduced the luciferase activity down to 40%. [score:1]
The same procedure was used to build the miR-509-3p/PNA1 heteroduplex, starting from the refined structure of miR509-3P/PNA2 heteroduplex. [score:1]
In this experiment A549 cells were first transfected with the pLuc-CFTR-3′UTR plasmid (a reporter luciferase construct sensitive to the miR-509-3p mimic action due to the presence of the 3′UTR of the CFTR gene) and with miR-509-3p miRNA. [score:1]
In that study we synthesized a 14-base long PNA fully complementary to the 5′-end of miR-509-3p and carrying a tetrapeptide tail containing two serine phosphates at its C-terminus and a fluorescein group at its N-terminus (PNA1, Table 1). [score:1]
24 h after, the cells were transfected with anti-miR-509-3p PNA. [score:1]
The formation of the miR-509-3p/PNA2 complex was further confirmed by the disappearance of the band of the free miR-509-3p in the miRNA/PNA2 1 : 5 complex (lane 4, Figures 6(b) and 6(c)). [score:1]
The miR-509-3p/PNA heteroduplexes (1 : 1.5 or 1 : 5) were formed by heating the mixture of the samples dissolved in 100 mM KCl, 10 mM K [2]HPO [4], at 90°C for 5 min and slowly cooling at room temperature for 12 h. The amount of each PNA sample was estimated by quantitative UV at 80°C using the following molar extinction coefficients: PNA1 ε = 149.6 mL  μmol [−1 ]cm [−1], PNA2 ε = 69.7 mL  μmol [−1 ]cm [−1], PNA3 ε = 61.6 mL  μmol [−1 ]cm [−1], and miR-509-3p ε = 205.0 mL  μmol [−1 ]cm [−1]. [score:1]
As expected, the analysis of the RMSD in the trajectories of miR-509-3p/PNA2 and miR-509-3p/PNA1 complexes showed high flexibility of the single stranded miRNA segment (Figure 1). [score:1]
For this purpose we tested the ability of PNA2 to revert the reduction of luciferase activity induced by the transfection of the 2′-OMe mimic of miR-509-3p in A549 cells. [score:1]
When miR-509-3p and PNA2 were mixed in the molar ratios of 1 : 1.5 and 1 : 5 (lanes 3 and 4, resp. ) [score:1]
The UV melting profile of the sole PNA2 did not show any significant variation in the A [260] value in 10–70°C (data not shown), whereas, the UV melting of the sole miR-509-3p, in the same experimental conditions, showed a sigmoidal profile with an apparent melting temperature of 26°C, which could be attributed to the melting of poorly stable secondary structures of the miRNA. [score:1]
Synthesis of miR-509-3p and PNAs (Table 1) The miR-509-3p mimic (2′-OMe modified) was synthesized and purified by the oligonucleotide synthesis facility at CEINGE-Biotecnologie Avanzate (Naples, Italy). [score:1]
The initial structures of the heteroduplexes formed by miR-509-3p with PNA1 and PNA2 were built by using the NMR structure of the 6-mer RNA(GAGUUC)/PNA(GAACTC) heteroduplex (PDB ID = 176D) [43]. [score:1]
we observed the appearance of a new band, corresponding to the miR-509-3p/PNA2 complex, which was upshifted relative to the bands of the two components alone. [score:1]
The UV melting experiments performed on the miR-509-3p/PNA2 mixture (1 : 1.5 ratio) showed a sigmoidal profile, which was indicative for the heteroduplex/single strands transition (Figure 4). [score:1]
Luciferase construct bearing the 3′UTR of CFTR gene [15] was used as miR-509-3p sensitive. [score:1]
The miR-509-3p/PNA2 and miR-509-3p/PNA1 heteroduplexes were built starting from the NMR structure of the RNA(GAGUUC)/PNA(GAACTC) duplex (PDB-ID 176D) [43] as described in Materials and Methods. [score:1]
Moreover, the torsion angles of RNA segments in miR-509-3p/PNA2 and miR-509-3p/PNA1 duplexes showed values very similar to those adopted by miR20a in the 4F3T crystal structure [42] suggesting that PNA2 and PNA1 could easily interact with the AGO-miRNA complex, not requiring any conformational adaptations. [score:1]
The data showed for the miR-509-3p/PNA2 complex a lower value of absorbance than the arithmetic sum of each component alone (Figure 3), thus evidencing that heteroduplex stacking interactions between the miRNA strand and the PNA2 had occurred. [score:1]
The concentration of miR-509-3p/PNA2 and miR-509-3p was 1.0 × 10 [−5 ]M. The spectra were signal-averaged over at least three scans and baseline was corrected by subtracting the buffer spectrum. [score:1]
In continuing our studies on the Cystic Fibrosis and on the control of the related miR-509-3p miRNA, we decided to test the capability of the short 7-mer PNA2 (Table 1), bearing the same functionalization of PNA1 and complementary to the seed region of miR-509-3p, to bind this miRNA. [score:1]
The electrophoretic mobility of PNA2 alone (lanes 1) was slower than that of miR-509-3p alone (lane 2). [score:1]
To allow the visualization of miR-509-3p alone, the gel was also visualized after the EtBr staining (Figure 6(b)). [score:1]
The EMSA data further corroborated the CD evidence about the ability of PNA2 to form a stable complex in the presence of miR-509-3p miRNA. [score:1]
The miR-509-3p mimic (2′OMe -modified) was synthesized by the oligonucleotide synthesis facility at CEINGE-Biotecnologie Avanzate (Naples, Italy). [score:1]
To further confirm the formation of the miR-509-3p/PNA2 heteroduplex complex, circular dichroism (CD) spectra were registered for the miR-509-3p, PNA2, and their 1 : 1.5 mixture after the annealing procedure (Figure 5). [score:1]
The sequences and the complete structures of PNA2 and PNA3 are shown in Table 1. The miR-509-3p/PNA2 complex, prepared as described in Materials and Methods, was analysed by UV spectroscopy in the temperature range of 25–90°C. [score:1]
Watson-Crick canonical pairs were then refined using distance restraints on the first seven bases of miR-509-3p/PNA2 heteroduplex. [score:1]
This data suggests that PNA2 is able to form a complex with miR-509-3p provided with the thermal stability required for in vivo experiments. [score:1]
[1 to 20 of 40 sentences]
3
[+] score: 48
This in silico analysis predicted miR- 125b-1* to target 3 mRNAs, miR-146a-5p to target 47 mRNAs, miR-181a-5p to target 14 mRNAs, miR-204-5p to target 12 mRNAs, miR-219a-5p to target 5 mRNAs, and miR-509-3p to target 1 mRNAs for a total 82 targets (see Table 2). [score:15]
In silico analysis using IPA analysis based on the research of targets experimentally validated in previously published studies indicated that miR-125b-1*, miR-146a-5p, miR-181a-5p, miR-204-5p, miR-509-3p and miR-219-5p were upregulated in SPARC expressed cells. [score:8]
Furthermore, downregulation of miR-509-3p was shown to be a tumor suppressor in tumor cells and associated with tumor cell invasion and migration [72]. [score:6]
Our study also observed that another miR-509- 3p associated with cell proliferation and migration is upregulated in SPARC overexpressed cells. [score:6]
We tested the expression of levels of six miRNAs (has-miR-125b-1*, has-miR-146a-5p, has-miR-181a-5p, has-miR-204-5p, has-miR-219-5p and has-miR-509-3p) which were found to be differentially regulated with. [score:4]
Validation of miR-125-b1*, miR-181a-5p, miR-146a-5p, miR-204-5p, miR-219-5p and miR-509-3p upregulation by quantitative real time PCR (qRT-PCR). [score:4]
miR-509-3p, a significant regulator of the MAP3K8 oncogene was shown to be down regulated in tumor cells [71]. [score:3]
qRT-PCR was performed on miR-125b-1* (FC = 1.57), miR-181a-5p (FC = 2.21), miR-146a-5p (FC = 1.68), miR-204-5p (FC = 1.57), miR-509-3p (FC = 1.73) and miR-219-5p (FC = 1.57) in SPARC overexpressed medulloblastoma cells (pSPARC) compared to empty vehicle (pEV) treated control samples. [score:2]
[1 to 20 of 8 sentences]
4
[+] score: 43
Meanwhile, miR-508-3p, the most significantly downregulated miRNA in penile cancer, has been revealed a lower expression level in renal cancer tissues, in the same study, another downregulated miRNA named miR-509-3p which can suppress the proliferation of renal cancer cells was also found to be downregulated in penile cancer, together indicating its tumor suppressive role in cancer development [60]. [score:17]
According to the result, we found that although the population -based effects and inherent differences inevitably emerged as the previous report [33], the tendency of the expression patterns was consistent with the NGS findings, as miR-107 and miR-223-3p showed the upregulated expression levels in cancerous penile tissues, while miR-1247-5p and miR-509-3p showed the downregulated expression levels in cancerous penile tissues, which again verified the smRNA-seq sequencing data (S6 Fig). [score:13]
From both techniques, miR-509-3p showed the largest fold-change of downregulated expression levels in cancerous penile tissues, and miR-107 possessed the largest fold-change of upregulated expression levels in cancerous penile tissues, which together indicated that the expression levels of miRNAs detected by smRNA-seq sequencing were reliable (S5 Fig). [score:13]
[1 to 20 of 3 sentences]
5
[+] score: 31
Downregulation of miR-146a was shown to play a role in migration and metastasis of breast carcinoma [38] and miR-509-3p was shown to be a tumor suppressor in renal cell carcinoma with downregulation associated with cell invasion and migration in renal cell cancer [39]. [score:9]
RT-PCR validated three significantly upregulated miRNAs and three significantly downregulated miRNAs namely miR-217, miR-216a, miR-216b, miR-146a, miR-509-3p and miR-211. [score:7]
For validation using RT-PCR, we chose three miRNAs (miR-217, miR-216a, and miR-216b) that were upregulated and three miRNAs (miR-146a, miR-509-3p, miR-211) that were downregulated by at least 6 standard deviations in tumor compared to control arrays. [score:6]
Seven of these miRNAs–miR-509-3p, miR-146a, miR-145, miR-29b-2-star, miR-187, miR-133a, miR-211–were underexpressed in tumors versus controls by at least 6 standard deviations from the mean. [score:3]
Furthermore, miR-146a is directly involved in various types of cancer including prostate, gastric, sarcoma, leukemia and pancreatic cancer; and miR-509-3p is involved in renal cell carcinoma with no direct link to a specific pathway. [score:3]
Three miRNAs (miR-146a, miR-509-3p and miR-211) showed significantly reduced expression in the intraocular medulloepithelioma specimens. [score:3]
[1 to 20 of 6 sentences]
6
[+] score: 24
Intriguingly, miR-128 is expressed in brain, whereas miR-509 is not present in brain but shows a strong expression in kidney and testis. [score:5]
Tested miRNAs (Table 1) included the 32 mentioned above; 6 additional miRNAs that appeared in more recent versions of the miRbase database and had putative target sites in the truncated isoform (miR-485-3p, miR-509, miR-617, miR-625, miR-765 and miR-768-5p) were also included because allelic variants were found in their target sites after re-sequencing of patients with anxiety disorders [19]. [score:5]
Interestingly, miR-151-3p and miR-185 have partially overlapping target sequences in the full-length isoform and, in a similar way, miR-128, miR-509 and miR-768-5p target the same segment of the 3'UTR of the truncated isoform (Figure 1B). [score:5]
The remaining four miRNAs (miR-324-5p, miR-330-3p, miR-509 and miR-625) caused a slight reduction in the expression levels of the truncated isoform of NTRK3 (maximum 15%), but none of them reached statistical significance. [score:3]
The most conspicuous inhibition was detected with miR-625 (62% reduction), miR-509 (47%) and miR-128 (32%), while the other five miRNAs gave a reduction ranging between 13% and 30%. [score:3]
In the case of pGL4.13-TR, the luciferase activity was significantly reduced by 8 miRNAs (Figure 1A), all of which were predicted by at least one program: miR-128, miR-324-5p, miR-330, miR-485-3p, miR-509, miR-625, miR-765 and miR-768-5p. [score:1]
It is worth of notice that while both miR-128 and miR-509 cause a strong reduction in luciferase activity (30-50%), only miR-128 seems to repress the corresponding protein isoform in SH-SY5Y cells. [score:1]
Luciferase-validated miRNAs were therefore transfected into either undifferentiated (miR-128, miR-324-5p, miR-330, miR-485-3p, miR-509, miR-625, miR-765 and miR-768-5p) or differentiated SH-SY5Y cells (miR-151-3p and miR-185), and protein levels were assessed by western blotting 72 h after transfection. [score:1]
[1 to 20 of 8 sentences]
7
[+] score: 13
Overexpression of miR-508-3p and miR-509-3p could suppress the proliferation of renal cell carcinoma (RCC), induce cell apoptosis, and inhibit cell migration in vitro [60]. [score:7]
For example, in a recent study using both NGS and microarray analysis to discover novel miRNAs in rat kidneys, the rno-miR-509-5p, rno-miR-509-3p and rno-miR-1306-5p that expressed at low levels were only detected by NGS, but not by the microarray [35]. [score:3]
A recent study demonstrated that miR-508-3p and miR-509-3p played an important role as tumor suppressor during tumor formation [60]. [score:3]
[1 to 20 of 3 sentences]
8
[+] score: 11
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-101-1, hsa-mir-139, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-142, hsa-mir-144, hsa-mir-127, hsa-mir-154, hsa-mir-185, hsa-mir-195, hsa-mir-29c, hsa-mir-101-2, hsa-mir-380, hsa-mir-381, hsa-mir-323a, hsa-mir-520e, hsa-mir-520a, hsa-mir-518c, hsa-mir-520d, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-509-1, hsa-mir-576, hsa-mir-548a-1, hsa-mir-586, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-599, hsa-mir-548a-3, hsa-mir-607, hsa-mir-613, hsa-mir-548c, hsa-mir-625, hsa-mir-634, hsa-mir-642a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-656, hsa-mir-509-3, hsa-mir-1208, hsa-mir-548e, hsa-mir-548j, hsa-mir-1290, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1247, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1324, hsa-mir-1825, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-323b, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-642b, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
miR-513a-3p and miR-509-5p are included in another primate-specific cluster on chromosome X. miRNAs present in Macaca mulatta that preferentially target down-regulated genes, as predicted by four different databases: microRNA. [score:6]
miR-513a-3p and miR-509-5p are included in another primate-specific cluster on chromosome X. In order to determine whether genes targeted by multiple miRNAs were more common in the 1000 down group than the 1000 control group, we also identified the genes included in the 1000 down and 1000 control groups that were targeted by one or more of the 65 miRNAs present in Macaca mulatta previously identified. [score:5]
[1 to 20 of 2 sentences]
9
[+] score: 10
The differential expression of the four PTEN- or TP53 -associated microRNAs is depicted in figure 4. For the BRAF gene, for which 11 cell-lines carry mutations, 40 microRNAs were differentially expressed, with miR-146a and miR-509-3p overexpressed and miR-149 and mR-192b underexpressed the most (table S5). [score:10]
[1 to 20 of 1 sentences]
10
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Several analyses provided evidence that miRNA genes (miR-101, miR-145, miR-223, miR-384, miR-494, miR-509-3p, and miR-1246) regulate CFTR expression, as well as anion transport, particularly in patients with F508 del mutation [58, 59, 60, 61, 62]. [score:5]
The authors synthesized 7- and 13-base-long PNAs with the tetrapeptide Gly-SerP-SerP-Gly at their C-end that was complementary to the sequence recognized by miR-509-3p and blocked its binding to CFTR, thus enabling its expression. [score:3]
This has been observed by Amato et al. who found that the CFTR polymorphism (rs10234329) enhances the affinity for miR-509-3p, a potential CFTR transcript modulator [64]. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 7
Furthermore, we found 8 miRNAs (miR-95, miR-139, miR-379, miR-429, miR-509, miR-518e, miR-542-5p, and miR-659) downregulated in both 6 h aDCs and tDCs with respect to iDCs. [score:4]
Interestingly, 5 miRNAs (miR-95, miR-429, miR-509, miR-542, and miR-659) were downregulated in tDCs and aDCs compared with iDCs. [score:3]
[1 to 20 of 2 sentences]
12
[+] score: 6
miR-492 and miR-548d were both up-regulated (4.9 and 3.2 times respectively) in TSI individuals compared to controls whilst 3 miR (miR-508, miR-509 and miR-664) were >3 fold down-regulated. [score:6]
[1 to 20 of 1 sentences]
13
[+] score: 5
Recently, several miRNAs, including miR-143/145, miR-192/194, miR-339–5p and miR-509-5p have been identified to regulate p53 levels and function through directly targeting MDM2 [27, 29, 30, 48, 49]. [score:5]
[1 to 20 of 1 sentences]
14
[+] score: 5
Another effect of MALAT-1-knockdown is the inactivation of the Rac1/JNK-pathway via activation of miR-509 and the downregulation of High-mobility group protein B1 (HMGB1) [43, 44]. [score:5]
[1 to 20 of 1 sentences]
15
[+] score: 4
In addition, miR-509-3p (30), miR-375 (31), miR-9 (7), miR-101, and miR-128 (32) are down-regulated. [score:4]
[1 to 20 of 1 sentences]
16
[+] score: 3
miRNA profiling of whole blood and blood-derived exosomes obtained from patients with metabolic syndrome detected similar expression of miR-17, miR-197, miR-509-5p, miR-92a, and miR-320a (80). [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
Xing F, Sharma S, Liu Y, Mo YY, Wu K, Zhang YY, et al. miR-509 suppresses brain metastasis of breast cancer cells by modulating RhoC and TNF-α. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
In particular, hsa-mir-520e, hsa-mir-518c-5p, and all six miRNA precursors were, resultingly, downmodulated in the high risk group, while hsa-mir-329-3p, hsa-mir-302d-3p, hsa-mir-520f, hsa-mir-511-5p, hsa-mir-509-3p, hsa-mir-519a-3p, hsa-mir-521, hsa-mir-520h, and hsa-mir-499a-5p were overexpressed. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
The most likely candidate miRNAs targeting the CFTR 3’UTR which overlapped in at least three prediction programs resulted miR-101, miR-144, miR-199-3p, miR-345, miR-376b, miR-377, miR-380, miR-494, miR-509-3p, miR-600 and miR-645. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 2
In particular six out of eight chrXq27.3 miRNAs (miR-506, miR-507, miR-508-3p, miR-509-3p, miR-509-5p and miR-514) showed Pearson’s correlation greater than 0.95 (Figure 4A). [score:1]
Members of this cluster have been previously identified as down-modulated in advanced-stage and/or high grade lesions [19], and one miRNA belonging to the cluster (miR-509) was found to be down-modulated in chemoresistant advanced-stage EOC [20], supporting the relevance of our results. [score:1]
[1 to 20 of 2 sentences]
21
[+] score: 2
Of these seven miRNAs, the four miRNAs hsa-miR-509-3-5p, hsa-miR-214, hsa-miR-34c-3p, and hsa-miR-509-5p show an AUC value lower than 0.3 in our study, indicating a higher expression in healthy individuals compared to MS patients. [score:2]
[1 to 20 of 1 sentences]
22
[+] score: 2
miR-509-3p. [score:1]
miR-509-5p. [score:1]
[1 to 20 of 2 sentences]
23
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
A separate study performed by gavage of alcohol by a gastrostomy tube found that ethanol increased miR-21, miR-34a, miR-137, miR-409-5p, miR-509-3p, and miR-882 and decreased levels of let-7 family members (let-7a, -7b, and -7g), miR-122, miR-127, miR-181a, miR-181b, miR-192, and miR-871 [62]. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
This cluster is conserved in primates, and consists of seven distinct miRNAs, that is, miR-506, miR-507, miR-508, miR-509, miR-510, miR-513 and miR-514. [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
However, other microRNAs have not been described in cardiac differentiation, including hsa-mir-675-5p, hsa-mir-585-3p, hsa-mir-1248 and hsa-mir-509-5p. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
A miRNA microarray analysis recently identified that miR-509 members and miR-510, which were not included in the microRNA PCR plate used in this study, could clearly distinguish OCCC from HGSC [22]. [score:1]
[1 to 20 of 1 sentences]
27
[+] score: 1
Top 10 miRNAs [d] : miR-335-3p, miR-26a-2-3p, miR-181d-5p, miR-509-5p, miR-524-5p, miR-137, miR-26a-1-3p, miR-595, miR-580-3p, miR-130a-3p EV: extracellular vesicles [a]miRNAs in bold type were also found within the top 20 miRNAs of the current experiment [b]miRNA names are converted to miRBase version 21.0 annotation version 16.0 [c]miRNA names converted from unspecified earlier version [d]miRNA names converted from miRBase version 13.0. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
No hsa-miR-10b-3p ACAGAUUCGAUUCUAGGGGAAU 204514 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG 204753 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG 204373 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC 204407 hsa-miR-99b-3p CAAGCUCGUGUCUGUGGGUCCG 204064 hsa-miR-99b CACCCGUAGAACCGACCUUGCG 204367 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC 204446 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 204339 hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 204584 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG 204227 hsa-miR-202-5p UUCCUAUGCAUAUACUUCUUUG 204730 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA 204101 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU 204507 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA 204539 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA 204480 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG 204077 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG 204458 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG 204503 hsa-miR-514 AUUGACACUUCUGUGAGUAGA 204645 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA 204063 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG 204306 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 204593 First strand of cDNA was synthesized using a Universal cDNA Synthesis Kit II (Exiqon, Cat. [score:1]
[1 to 20 of 1 sentences]
29
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-33b, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Alterations in circulating miR-23a, miR-27a, miR-130, miR-195, miR-197, miR-320a, and miR-509-5p have been associated to metabolic syndrome [153, 154]. [score:1]
[1 to 20 of 1 sentences]
30
[+] score: 1
Other miRNAs from this paper: hsa-mir-17, hsa-mir-28, hsa-mir-223, hsa-mir-127, hsa-mir-188, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-30e, hsa-mir-362, hsa-mir-363, hsa-mir-367, hsa-mir-379, hsa-mir-196b, hsa-mir-450a-1, hsa-mir-431, ssc-mir-28, hsa-mir-493, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-500a, hsa-mir-501, hsa-mir-502, hsa-mir-450a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-506, hsa-mir-508, hsa-mir-509-1, hsa-mir-532, hsa-mir-615, hsa-mir-660, bta-mir-127, bta-mir-30e, bta-mir-17, bta-mir-450a-2, bta-mir-532, bta-mir-363, bta-mir-660, hsa-mir-891a, hsa-mir-892a, hsa-mir-450b, hsa-mir-892b, hsa-mir-708, hsa-mir-509-3, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1248, ssc-mir-17, bta-mir-155, bta-mir-188, bta-mir-194-2, bta-mir-196b, bta-mir-223, bta-mir-28, bta-mir-362, bta-mir-367, bta-mir-379, bta-mir-431, bta-mir-493, bta-mir-500, bta-mir-502a-1, bta-mir-502a-2, bta-mir-502b, bta-mir-615, bta-mir-708, bta-mir-1248-1, bta-mir-1248-2, ssc-mir-450a, bta-mir-2320, bta-mir-1388, bta-mir-194-1, bta-mir-450a-1, eca-mir-30e, eca-mir-367, eca-mir-684, eca-mir-196b, eca-mir-615, eca-mir-708, eca-mir-194-1, eca-mir-493a, eca-mir-17, eca-mir-1248, eca-mir-28, eca-mir-127, eca-mir-379, eca-mir-431, eca-mir-493b, eca-mir-155, eca-mir-194-2, eca-mir-188, eca-mir-223, eca-mir-362, eca-mir-363, eca-mir-450a, eca-mir-450b, eca-mir-450c, eca-mir-500-1, eca-mir-500-2, eca-mir-501, eca-mir-502, eca-mir-508, eca-mir-509a, eca-mir-532, eca-mir-660, ssc-mir-30e, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-127, ssc-mir-532, ssc-mir-708, ssc-mir-1285, ssc-mir-500, hsa-mir-514b, ssc-mir-363-1, ssc-mir-450c, hsa-mir-500b, ssc-mir-194b, ssc-mir-155, ssc-mir-362, bta-mir-3601, ssc-mir-615, ssc-mir-2320, bta-mir-450b, ssc-mir-194a, ssc-mir-196b-2, ssc-mir-363-2, ssc-mir-493, hsa-mir-892c, eca-mir-1388, eca-mir-514b, eca-mir-506a, eca-mir-509b, bta-mir-194b, ssc-mir-1388, ssc-mir-223, ssc-mir-660, bta-mir-194b-2, bta-mir-1949
Three miRNAs are observed in the miRDeep analysis of these clusters, which may be assigned as mir-506, mir-508 and likely mir-509. [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
P1) 8-mer 8th hsa-miR-485-3p NTRK3 19370765 rs72481816 15: 88521572 G C NA 8-mer 8th hsa-miR-765 NTRK3 19370765 rs72481814 15: 88522372 T C NA 7-8mer 4th hsa-miR-509-3p NTRK3 19370765 rs28574753 16: 28109760 G A. [score:1]
[1 to 20 of 1 sentences]