sort by

18 publications mentioning hsa-mir-1228

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-1228. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 266
We observed that TNF-α treatment markedly inhibited miR-1228* promoter activity and inhibition of NF-κB with PDTC prevented TNF-α -mediated downregulation of the activity levels (Fig. 3B), suggesting that NF-κB may negatively regulate miR-1228* expression. [score:11]
In our study, restoration of miR-1228* suppressed EMT phenotype and reduced gastric cancer cell migration, this could possibly attribute to miR-1228* -mediated downregulation of NF-κB activity and through targeting CK2A2 expression. [score:10]
Western blot showed that overexpression of miR-1228* in SGC-7901 cells down-regulated mesenchymal markers (Vimentin, β-catenin, Snail, Slug, and ZEB1/2), while up-regulated epithelial marker E-cadherin (Fig. 5A). [score:9]
In the present study, we identified that miR-1228* was down-regulated in more than 70% of gastric cancer samples when compared with their nontumor counterparts and provide experimental evidence that it may function as a tumor suppressor through negatively regulating EMT and inhibiting NF-κB activity. [score:8]
Taken together, these data indicate that the suppression of NF-κB activity by miR-1228* may be through targeting CK2A2 expression. [score:7]
Since c-Rel subunit is a member of the NF-κB family, NF-κB activation phenocopied the effects of c-Rel in regulating miR-1228* expression, suggesting that NF-κB pathway was negatively involved in the downregulation of miR-1228* in gastric cancer. [score:7]
Furthermore, miR-1228* overexpression also resulted in the downregulation of NF-κB activity. [score:6]
Our results showed that the activity of NF-κB was significantly decreased by overexpression of miR-1228* (Fig. 4A), indicating a negative feedback loop between miR-1228* expression and NF-κB activity. [score:5]
Our data also showed that c-Rel was able to binds directly with miR-1228* promoter and negatively regulate its expression. [score:5]
are means ± SEM, n  =  3. (B) Increased miR-1228* expression suppresses xenograft tumor growth. [score:5]
Mechanistically, we demonstrated that miR-1228* inhibits NF-κB activation and potentially suppresses EMT. [score:5]
Overexpression of miR-1228* significantly suppressed the tumor growth (Fig. 2B). [score:5]
All cases (n = 50) were stratified into two groups: miR-1228* low expression (n = 36) and miR-1228* high expression (n = 14). [score:5]
Increased miR-1228* Expression Suppresses Xenograft Tumor Formation. [score:5]
miR-1228* Suppresses NF-κB Activity and CK2A2 Expression in SGC-7901. [score:5]
Restoration expression of miR-1228* in gastric cancer cells significantly inhibit cell migration and tumor growth. [score:5]
As shown in Fig. 1C, miR-1228* was significantly low expression in all cancer cell lines compared with GES-1. Taken together, these results provide strong evidence that miR-1228* was down-regulated in gastric cancer. [score:5]
Firstly, to determine whether the miR-1228* is differentially expressed in human primary gastric cancers, the expression level of the mature miR-1228* was examined using TaqMan real-time PCR in 50 pairs of human gastric cancer tissues and pair-matched adjacent noncancerous gastric tissues. [score:5]
To further identify downstream targets of miR-1228* in the NF-κB pathway, we performed bioinformatics analysis and found CK2A2 was one of the putative target genes that were predicted. [score:5]
The present work identifies miR-1228* as a negative regulator of NF-κB activity and highlights its role in suppressing EMT and gastric cancer growth, suggests that selective restoration of miR-1228* might be beneficial for gastric cancer therapy. [score:4]
Collectively, data suggests that NF-κB subunits c-Rel functionally contributes to the downregulation of miR-1228* in gastric cancer. [score:4]
Regulation of NF-κB activity and CK2A2 expression by miR-1228*. [score:4]
Further investigations on the association between CK2A2 and miR-1228* demonstrated that the protein levels of CK2A2 was concomitantly down-regulated upon miR-1228* stable overexpression in SGC-7901 cells (Fig. 4C). [score:4]
Our data indicated downregulation of miR-1228* in gastric cancer tissues and gastric cancer cell lines. [score:4]
Downregulation of miR-1228* in gastric cancer tissues and gastric cancer cell lines. [score:4]
We hypothesized that NF-κB activation is attributed to the downregulation of miR-1228* in gastric cancer. [score:4]
miR-1228* is Frequently Down-regulated in Human Gastric Cancer. [score:4]
To generate stable transfected cells, the miR-1228* and miR-NC expression constructs were transfected into the SGC-7901 cell line using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:3]
miR-1228* restoration inhibits xenograft tumor formation of gastric cancer cells. [score:3]
Here, we provided evidence that miR-1228* was down-regulated in gastric cancer tissues compared with normal tissues. [score:3]
The miR-1228* low -expression group had inclinations towards larger tumor size. [score:3]
About 72% of tumor samples were lower expressed with miR-1228* (Fig. 1B). [score:3]
Relationship between miR-1228* expression and clinicopathologic features of patients with gastric cancer (n = 50). [score:3]
As expected, RT-PCR analysis showed that miR-1228* stable cells had an increase of mature miR-1228* expression when comparing to miR-NC stable cells (Fig. 2A). [score:3]
In this study, we showed that miR-1228* reduced the expression of CK2A2 at the protein level. [score:3]
The expression of miR-1228* was analyzed by real-time PCR and normalized to RNU6B. [score:3]
0058637.g001 Figure 1(A) In human gastric cancer tissues compared with paired adjacent noncancerous (normal) gastric tissues, the miR-1228* was down-regulated. [score:3]
Data were expressed as means ± SEM, n  =  3. (A) SGC-7901-miR-1228* and SGC-7901-miR-NC were transfected with the NF-κB reporter construct, respectively. [score:3]
Differences between the expression levels of the miR-1228* in gastric cancer patients were determined by the Wilcoxon signed-rank test. [score:3]
And NF-κB inhibitor PDTC remarkably antagonized TNF-α -mediated miR-1228* promoter low activity. [score:3]
Furthermore, miR-1228* overexpression caused a decrease of cell migration (Fig. 5B–C). [score:3]
In order to verify whether CK2A2 is a true target of miR-1228*, a segment of the CK2A2 3’UTR containing the binding site was cloned into the 3’UTR of the luciferase gene in pMIR-REPORT plasmid [29]. [score:3]
NF-κB Activation is Responsible for the Lower Expression of miR-1228* in Gastric Cancer. [score:3]
By the end of the experimental period, the size and wet weight of tumors with miR-1228* overexpression was significantly smaller and lower than that of the control group (Fig. 2C–D). [score:3]
NF-κB activation is responsible for the lower expression of miR-1228*. [score:3]
Our results showed that the expression level of miR-1228* was significantly decreased in gastric cancer tissues in comparison with the adjacent noncancerous gastric tissues (Fig. 1A). [score:3]
The luciferase assay with a reporter containing the miR-1228* binding sequence at the 3’UTR of CK2A2 mRNA suggested that miR-1228* directly targets the 3’UTR of CK2A2. [score:3]
The miR-1228* expression vector (miR-1228*) or negative control (miR-NC) was constructed by cloning of annealed oligonucleotides that contained the optimized miR-1228* stem-loop (Oligonucleotides were designed as: top strand, 5′-TGC TGG TGG GCG GGG GCA GGT GTG TGG TTT TGG CCA CTG ACT GAC CAC ACA CCC CCC CGC CCA C-3′; bottom strand, 5′- CCT GGT GGG CGG GGG GGT GTG TGG TCA GTC AGT GGC CAA AAC CAC ACA CCT GCC CCC GCC CAC C-3′. ) [score:3]
The expression level of miR-1228* was normalized to RNU6B. [score:3]
Thus, the data indicates that miR-1228* inhibits xenograft tumor growth of gastric cancer cells in vivo. [score:3]
However, there were no significant relationships between the miR-1228* expression and other clinicopathologic features such as age, gender, histological type or TNM stage (Table 1). [score:3]
miR-1228* Inhibits EMT. [score:3]
The miR-1228* target region of the CK2A2 3’UTR sequence was chemically synthesized by Shanghai Biotech and inserted downstream of the pMIR-REPORT luciferase plasmid (Applied Biosystems), named as pMIR-CK2A2. [score:3]
Here we utilized bioinformatic programs (Promoter 2.0 and P-match) to identify potential regulators of miRNA-1228* [16], [17]. [score:2]
Immunohistochemical staining indicated decreased Vimentin and increased E-cadherin expression in miR-1228* xenograft tumor compared to the control (×400). [score:2]
Guled et al [41] demonstrated that miR-1228* was highly expressed in malignant mesothelioma samples compared with normal samples. [score:2]
The data provide the first evidence that miR-1228* restoration in gastric cancer negatively regulates EMT. [score:2]
To further determine whether NF-κB subunit c-Rel is responsible for deregulating miR-1228*, we transfected SGC-7901 cells miR-1228*-promoter with or without GFP-c-Rel and observed a significant decrease of luciferase activity in GFP-c-Rel group than control (Fig. 3C). [score:2]
Using 2 [-ΔΔCT] values, fold change of miR-1228* < 1.0 was considered as low, while it > 1.0 was regarded as high expression [18]. [score:2]
Using miRanda and RNA22 [23], [24], we located one potential binding site for miR-1228* at the 3’UTR of CK2A2 (Fig. 4B). [score:1]
Our another study showed miR-1228* was one epithelial cancer-related miRNA (unpublished). [score:1]
0058637.g003 Figure 3(A) Schematic representations of the miR-1228* promoter region (the black arrowheads is the c-Rel binding domains), the lower is the pGL3-miR-1228*-promoter construct. [score:1]
miR-1228* or miR-NC stable transfection SGC-7901 cells suspensions (2.5×10 [7] cells/ml) in 200 µl serum-free medium were subcutaneously injected into the flanks of nude mice, respectively. [score:1]
Since miR-1228* seems to negatively regulates NF-κB activity, we therefore investigated if miR-1228* could also negatively regulate EMT in gastric cancer. [score:1]
The migration ability of miR-1228* or miR-NC stable transfection SGC-7901 cells were detected using Transwells (8-mm pore size, Corning). [score:1]
Immunohistochemical staining was employed to further confirm EMT-related proteins changes of miR-1228* transfected SGC-7901 cells in the xenograft mo del. [score:1]
In our previous study, by analyzing the miRNA array of pancreatic cancer spheres, miR-1228* was found as one of cancer-related miRNAs (data not shown). [score:1]
are means ± SEM, n  =  3. In order to assess functional role of miR-1228* in gastric cancer, the optimized miR-1228* stem-loop was cloned into pcDNA6.2-GW/EmGFP vector. [score:1]
Data were expressed as means ± SEM, n  =  3. In order to investigate the influence of miR-1228* on the NF-κB signaling pathway, NF-κB reporter constructs were transfected into either miR-1228* or miR-NC stable transfected SGC-7901 cells and the activity of NF-κB luciferase was determined after 48 hours. [score:1]
and coloned to pGL3-Enhancer Vector (Promega) [16], named as pGL3-miR-1228*-promoter. [score:1]
Stable transfection of SGC-7901 cells with miR-1228* or miR-NC were injected subcutaneously into nude mice. [score:1]
Gastric cell line SGC-7901 cells were transfected with pcDNA6.2-GW/EmGFP-miR-1228* or pcDNA6.2-GW/EmGFP-NC vector and stable cell lines were generated and named miR-1228* or miR-NC, respectively. [score:1]
These results suggested that miR-1228* interacts with the CK2A2 mRNA 3’UTR. [score:1]
However, only few researches of miR-1228* have been reported. [score:1]
The pGL3-miR-1228*-promoter/control, GFP-c-Rel/control, pMIR-CK2A2/control or NF-κB reporter vector (Promega) were transiently transfected into SGC-7901 cells using Lipofectamine 2000, pRL-TK (Promega) was used as internal normalization [17]. [score:1]
Data were expressed as means ± SEM, n  =  3. To prove our hypothesis, we created a luciferase construct with miR-1228* promoter region and evaluated its activity in response to NF-κB activation. [score:1]
Figure S1 Effect of miR-1228* on EMT in AGS cells. [score:1]
Effect of miR-1228* on EMT in SGC-7901 cells. [score:1]
Therefore, our data outline a double negative feedback loop between NF-κB and miR-1228*. [score:1]
0058637.g004 Figure 4 (A) SGC-7901-miR-1228* and SGC-7901-miR-NC were transfected with the NF-κB reporter construct, respectively. [score:1]
miR-1228* expression was also evaluated in gastric cancer cell lines and one immortalized normal gastric mucosal epithelial cell line (GES-1). [score:1]
are means ± SEM, n  =  3. (B) Schematic graph of the putative binding site of miR-1228* in the CK2A2 predicted by miRanda. [score:1]
We found three c-Rel binding domains in the 2-kb miR-1228* promoter region (Fig. 3A). [score:1]
Data were expressed as means ± SEM, n  =  3. To prove our hypothesis, we created a luciferase construct with miR-1228* promoter region and evaluated its activity in response to NF-κB activation. [score:1]
Using a miR-1228* promoter-reporter construct that contained 2-kb fragments of the miR-1228* promoter, we found that NF-κB pathway activator TNF-α decreased miR-1228* promoter activity. [score:1]
[1 to 20 of 85 sentences]
2
[+] score: 16
Other miRNAs from this paper: hsa-mir-637
miR-1228 was upregulated and coexpressed with its host gene LRP1 suggesting a conventional VDRE- mediated transactivation upon 1,25D3 treatment. [score:6]
This suggests that 1,25D3 induced expression of miR-1228 may affect osteoblast differentiation via down-regulation of BMP2K. [score:6]
The target of miR-1228, BMP2K, was previously identified to be increased in mouse osteoblasts upon treatment with BMP2 (Kearns et al., 2001). [score:3]
Interestingly, miR-637 and miR-1228 are two miRNAs located intergenic in DAPK3 and LRP1, respectively. [score:1]
[1 to 20 of 4 sentences]
3
[+] score: 11
Downregulation of p53 expression conversely increases expression of miR-1228, thereby acting as a positive feedback loop that contributes to hepatogenesis in HCC [32]. [score:8]
MiR-1228 exerts pleiotropic function as an oncogene by promoting the cell cycle and cell mobility and negatively regulating the expression of p53. [score:3]
[1 to 20 of 2 sentences]
4
[+] score: 10
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
[1 to 20 of 2 sentences]
5
[+] score: 9
For example, miR-105 has been reported to function as a potential tumor suppressor and inhibit cell proliferation by regulating the PI3K/AKT signaling pathway in human HCC [11]; Tan and colleagues identified a serum of miRNA panel (hsa-miR-206, hsa-miR-141-3p, hsa-miR-433-3p, hsa-miR-1228-5p, hsa-miR-199a-5p, hsa-miR-122-5p, hsa-miR-192-5p, and hsa-miR-26a-5p) that has considerable clinical value in HCC diagnosis [12]; The presence of miR-101 has also been indicated to be a biochemical marker for monitoring the progression of tumor development in HBV-related HCC, and to be a potential prognostic marker and therapeutic target for HCC [13]. [score:9]
[1 to 20 of 1 sentences]
6
[+] score: 5
6 HCs Exosomes RT-PCR mir-1228-3pGiallombardo et al., 2016 miR-429, miR-205, miR-200b, miR-203, miR-125b miR-34b (up) 38 NSCLCs, 16 patients with COPD, 16 HCs Serum TaqMan Low Density Arrays U6Halvorsen et al., 2016 NSCLCs, NSCLC patients; HCs, healthy controls; RT-PCR, real-time reverse transcription quantitative polymerase chain reaction; COPD, chronic obstructive pulmonary disease; BPD, benign pulmonary diseases. [score:5]
[1 to 20 of 1 sentences]
7
[+] score: 5
Interestingly, 14 of these miRNAs (miR-596, miR-630, miR-422a, miR-490-5p, miR-375, miR-708, miR-345, miR-125b-2, miR-516a-3p, miR-135a, miR-1228, miR-1915, miR-134, and miR-663) have established roles in tumor suppression and drug resistance, while 5 miRNAs (miR-630, miR-375, miR-345, miR-1228, and miR-134) are known to inhibit epithelial–mesenchymal transition and invasion in cancer cells. [score:5]
[1 to 20 of 1 sentences]
8
[+] score: 5
In osteoblasts, 1,25D [3] induces the expression of miR-637 and miR-1228 by two distinct mechanisms [64]. [score:3]
The induction of miR-1228 by 1,25D [3] is through VDRE -mediated transactivation of a host gene LRP1; while the regulation of miR-637 is by intronic VDRE -mediated induction without the transactivation of the host gene DAPK3 [64]. [score:2]
[1 to 20 of 2 sentences]
9
[+] score: 4
A large number of overexpressed IR-responsive miRNAs that we identified in our work were found to be deregulated in human cancers, such as hsa-mir-513 [55], hsa-mir-744 [56], hsa-mir-92a [57], [58], hsa-mir-1228* [59], hsa-mir-671-5p [60], hsa-mir-638 [38], hsa-mir-370 [61], and hsa-mir-675 [62]. [score:4]
[1 to 20 of 1 sentences]
10
[+] score: 3
24 *** hsa-mir-770-5p 19 *** 75.47 *** hsa-mir-93* 9.5 *** 92.1 - Inhibited differentiation & low cell count *** hsa-let-7b* 4.75 *** 28.64 *** hsa-mir-1224-3p 2.38 *** 51.46 *** hsa-mir-1228 2.38 ** 9.43 *** hsa-mir-1249 1.66 *** 53.17 *** hsa-mir-125a-5p 19 *** 69.8 *** hsa-mir-1260 7.12 *** 61.75 *** hsa-mir-1280 11.88 *** 68.95 *** hsa-mir-129-3p 9.5 *** 65.64 - hsa-mir-1296 9.5 *** 36.36 *** hsa-mir-133a/hsa-mir-133b 42.75 * 0.85 *** hsa-mir-150 4.75 *** 60.37 *** hsa-mir-197 4.75 *** 27.79 *** hsa-mir-204 2.85 *** 27.44 *** hsa-mir-328 0.1 ** 30.87 *** hsa-mir-342-3p 33.25 *** 58. [score:3]
[1 to 20 of 1 sentences]
11
[+] score: 3
We confirmed the expression changes (> 2-fold) of mir-184 and mir-1250 in brain and of mir-1281, mir-551b, mir-3185, mir-3162-5p and mir-1228 in heart in mechanical asphyxia cases (Figure 2A and 2C). [score:3]
[1 to 20 of 1 sentences]
12
[+] score: 3
Even though expression of miRNAs showed considerable inter-individual variation, several miRNAs, including miR-1825 and miR-1228, were relatively constant among women (Figure 1). [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 2
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-214, hsa-mir-126, hsa-mir-1246
Hu J. Wang Z. Liao B. Y. Yu L. Gao X. Lu S. Wang S. Dai Z. Zhang X. Chen Q. Human miR-1228 as a stable endogenous control for the quantification of circulating microRNAs in cancer patients Int. [score:1]
Therefore, we assessed the levels of candidate miRNAs for the internal control such as RNU6B, RNU19, RNU48, miR-16, and miR-1228 based on previous human studies [14] by using a small number of clinical samples (HSA, n = 2; Benign, n = 2; Control, n = 2). [score:1]
[1 to 20 of 2 sentences]
14
[+] score: 2
Simultaneously some non-canonical miRNAs (e. g. originated from simtrons mir-1225 and mir-1228) are distant from the terminal loop. [score:1]
Mammalian mir-1225 and mir-1228, initially predicted as mirtrons, are actually splicing-independent [35]. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 2
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUA Interestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUAInterestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 2
However, in different cell systems, p53 mRNA levels have been shown to be regulated by adjusting the rate of transcription (histone deacetylases (HDAC9, [59]), by modulation of mRNA stability (i. e. via miRNA-1228 [57]) or by hybridization of antisense transcript Wrap53 [29]. [score:2]
[1 to 20 of 1 sentences]
17
[+] score: 1
The respective 16 markers include hsa-miR-1299, hsa-miR-3124, hsa-miR-4290, hsa-miR-2278, hsa-miR-32*, hsa-miR-3149, hsa-miR-877*, hsa-miR-584, hsa-miR-3148, hsa-miR-122, hsa-miR-718, hsa-miR-670, hsa-miR-3680*, hsa-miR-193b*, hsa-miR-3911 and hsa-miR-1228* (see Figure  4). [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
In 5 studies, U6 snRNAs (small nuclear RNAs) were selected as the internal normalization control; in the remaining studies, the plant miRNAs miR-168, mmu-miR-295, miR-181a and miR-181c, miR-16, and miR-1228 were used as controls. [score:1]
[1 to 20 of 1 sentences]