sort by

137 publications mentioning hsa-mir-320d-2 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-320d-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 189
MiR-320 expression was down-regulated, while PBX3 was up-regulated in glioma tissues. [score:8]
PBX3 (Pre-B cell leukemia homeobox 3), a putative target gene of miR-320, has been reported to be upregulated in various tumors and promote tumor cell growth through regulating MAKP/ERK pathway. [score:7]
MiR-320 is downregulated in multiple cancers, including glioma and acts as tumor suppressor through inhibiting tumor cells proliferation and inducing apoptosis. [score:7]
In this research, we found that PBX3 was overexpressed in glioma tissues and was regulated by miR-320, suggested PBX3 may participate in the glioma inhibition function of miR-320. [score:6]
In summary, our current data demonstrated that miR-320 is downregulated in glioma tissues and inversely correlates with PBX3 expression. [score:6]
Either miR-320 overexpression or PBX3 knockdown suppressed the phosphorylation of Raf-1, p38, ERK1/2, ERK5 and JNK. [score:6]
In addition, miR-320 was demonstrated to inhibit osteosarcoma cell proliferation by directly targeting fatty acid synthase [22]. [score:6]
Taken together, the results presented indicated miR-320 may suppress glioma cell growth through targeting PBX3 and regulating MAPK pathway. [score:6]
MiR-320 downregulation and PBX3 upregulation was found in glioma tissues. [score:6]
Both miR-320 overexpression and PBX3 knockdown inhibited Raf-1/MAPK activation. [score:6]
In this study, we found that miR-320 expression was downregulated in glioma tissues. [score:6]
The results showed miR-320 expression was significantly increased by miR-320 mimics, while PBX3 expression was significantly reduced by miR-320 mimics (as shown in Fig.   2a–c). [score:5]
These results suggested that miR-320 directly modulate PBX3 expression by direct binding. [score:5]
Overexpression of miR-320 suppressed glioma cell proliferation, induced cell cycle arrest and apoptosis. [score:5]
To determine whether PBX3 expression was regulated by miR-320 in glioma cells, U87 and U251 cells were transfected with miR-320 mimic, and the expression of miR-320 and PBX3 was determined using qRT-PCR and western blot assays. [score:5]
MiR-320 overexpression or PBX3 knockdown inhibits MAPK pathway activation in glioma cells. [score:5]
Over expression of miR-320 inhibited glioma cell proliferation and induced cycle arrest and apoptosis. [score:5]
a miR-320 expression in U87 and U251 cells following transfection with miR-320 mimics or NC, and miR-320 expression was significantly increased in cells transfected with miR-320 mimics in comparison with that with NC. [score:5]
To address whether miR-320 functions through targeting PBX3, PBX3 knockdown was performed using shPBX3 and the effect of which on the activation of Raf-1, p38 and ERK1/2 was detected. [score:4]
b PBX3 expression in U87 and U251 cells following transfection with miR-320 or NC, and PBX3 expression was significantly reduced by miR-320 compared with NC. [score:4]
Either miR-320 overexpression or PBX3 knockdown induced inactivation of MAPK pathway. [score:4]
In addition, as a putative target gene of miR-320, whether miR-320 functions through regulating PBX3 remains unknown. [score:4]
MiR-320 overexpression suppressed glioma cells proliferation and induced cell cycle arrest and apoptosis. [score:4]
Dong et al. found miR-320 showed significantly low expression in glioblastoma patients [13], however, the exact role of miR-320 in glioma occurrence and development remains unknown. [score:4]
With former relevant researches, the present study suggested that miR-320 may acts as a tumor suppressor. [score:3]
c A representative result of western blot analysis for caspase-3 protein expression in glioma cells transfected with miR-320 mimics or NC. [score:3]
Fig.  1Altered expression of miR-320 and PBX3 in glioma tissues. [score:3]
We then explored the effect of miR-320 expression on cell cycle progression by flow cytometry methods. [score:3]
Mutations were introduced into the potential miR-320 binding sites using the QuikChange site-directed mutagenesis kit (Stratagene, Agilent, San Diego, CA, USA). [score:3]
Luciferase reporter assay showed that over -expression of miR-320 led to a marked decrease of Renilla luciferase activity, which was specifically abolished by the mutation of the corresponding anti-seed sequence in 3′ UTR of PBX3 (Fig.   2d). [score:3]
Wu et al. found miR-320 suppressed tumor angiogenesis driven by vascular endothelial cells in oral cancer by silencing neuropilin 1 [21]. [score:3]
MiR-320 may suppress glioma cells growth and induced apoptosis through the PBX3/Raf-1/MAPK axis, and miR-320 oligonucleotides may be a potential cancer therapeutic for glioma. [score:3]
c Western blot of PBX3 in U87 and U251 cells transfected with miR-320 mimics or NC, and protein expression of PBX3 was significantly reduced. [score:3]
PBX3 was negatively regulated by miR-320 in glioma cells. [score:2]
This study aimed to verify whether miR-320 influences glioma cells growth through regulating PBX3. [score:2]
Luciferase reporter assay was performed to verify the interaction between miR-320 and its targeting sequence in the 3′ UTR of PBX3 in glioma cells U87 and U251. [score:2]
Our results showed that either miR-320 mimics transfection or PBX3 knockdown significantly reduced the phosphorylation levels of Raf-1, p38, ERK1/2, ERK5 and JNK were in U87 and U251 cells. [score:2]
MiR-320 and PBX3 expression in glioma tissues and adjacent healthy tissues was determined using qRT-PCR. [score:2]
We identified PBX3 was regulated by miR-320 in glioma cells. [score:2]
In the present research we identified PBX3 was regulated by miR-320 in glioma cells. [score:2]
MiR-320 mimic transfection suppressed glioma cells proliferation, and induced cell cycle arrest and apoptosis. [score:2]
Twenty-four human glioma and paired adjacent nontumorous tissues were collected for determination of miR-320 and PBX3 expression using RT-qPCR and western blot assays. [score:2]
MiR-320 suppressed glioma cells proliferation through inducing cell cycle arrest at G0/G1 phase. [score:2]
a Growth curves of U87 and U251 cells transfected with miR-320 or NC. [score:1]
U87 and U251 cells were plated in six-well plates and transfected with miR-320 mimics. [score:1]
e Cell cycle distribution of U87 and U251 cells transfected with miR-320 mimics or NC. [score:1]
d Flow cytometric analysis of the indicated glioma cells transfected with NC or miR-320. [score:1]
a Annexin V/PI dual staining for U87 and U251 cells transfected with miR-320 mimics or NC. [score:1]
The results suggested miR-320 might functions through the PBX3/Raf-1/MAPK axis, and miR-320 oligonucleotides might be a potential cancer therapeutic for glioma. [score:1]
a and b Measurement of miR-320 and PBX3 expression in glioma and adjacent tissues of 24 patients using RT-qPCR. [score:1]
In addition, miR-320 transfection resulted in caspase-3 activation evidenced by the increased protein level of cleaved caspase-3 (Fig.   4c), suggesting miR-320 mediated glioma cell apoptosis is caspase enzyme dependent. [score:1]
b and c U87 and U251 cells transfected with miR-320 mimics were cultured for 2 weeks. [score:1]
The findings suggested miR-320 and PBX3 modulated MAPK pathway may contribute to their effect on the proliferation and apoptosis of glioma cells. [score:1]
d Computer prediction of miR-320 binding sites in the 3′UTR of PBX3 gene. [score:1]
Firefly luciferase reporters, Renilla luciferase pRL-TK vector (used as internal control, Promega, USA) and miR-320 mimics were co -transfected into the U87 and U251 cells. [score:1]
Luciferase reporter assays identified miR-320 directly blinds to the 3′ UTR of PBX3 in glioma cells. [score:1]
[1 to 20 of 56 sentences]
2
[+] score: 187
Histograms depicting six significantly different gene expression (A) and seven insignificant gene expression (B) within or regulate Wnt signaling pathway between miR-320 inhibitor -injected (n = 80) and NC inhibitor -injected (n = 50) groups. [score:10]
Knocking down miR-320 in mouse oocytes negatively affected embryonic developmental potential by inhibiting expression of Wnt signaling pathway. [score:7]
Significant and insignificant expression of Wnt signaling pathway genes in oocytes injected with either miR-320 inhibitor or NC inhibitor. [score:7]
Aspm, as reported as a positive regulator of Wnt signaling pathway 59, were down-regulated in the miR-320 inhibitor -injected group. [score:7]
We collected oocytes 8 hours (just before insemination) after injection with miR-320 inhibitor (n = 80) or NC inhibitor (n = 50) and measured the expression levels of 13 genes (Apc, Aspm, Btrc, Csnk1a1, Ctnna1, Ctnnb1, Dvl3, Gsk3b, Lef1, Lrp6, Numb, Tcf7 and Wnt7a) within or regulate Wnt signaling pathway by qRT-PCR. [score:6]
Down regulation of Aspm expression was reported to disrupt meiotic spindle organization in mouse oocytes 58, which may indicate that the low level of Aspm in miR-320 inhibitor -injected group may contribute to the damaged capacity of oocytes to fertilize and develop to 2-cell and blastocyst stage. [score:6]
However, in our study, the expression of Csnk1a1 were significantly increased in miR-320 inhibitor -injected group, which resembled the phenotypes of treatment of pyrvinium pamoate in MI oocyte 54 and therefore, may result in impairment of spindle structure and chromosome alignment and compromise its function during fertilization and embryo development. [score:6]
We found abnormal expression of Btrc, Csnk1a1, Gsk3b, Wnt7a, Dvl3 and Aspm in miR-320 inhibitor injected group. [score:5]
The MII oocytes microinjected with miR-320 inhibitor and its NC inhibitor were placed in 500 μL EmbryoMax® Human Tubal Fluid (HTF, Millipore, Billerica, MA, USA) medium in one well of a 4-well plate under mineral oil. [score:5]
Morphology of the 2-cell stage and blastocyst stage of miR-320 inhibitor -injected (n = 112), NC inhibitor -injected (n = 80) and non -treated (n = 180) in vitro fertilized mouse oocytes. [score:5]
Taken together, abnormal expression of Wnt signaling pathway related genes might contribute to the decreased 2-cell rate and blastocyst rate in the miR-320 inhibitor -injected oocytes. [score:5]
Expression of Wnt signaling pathway genes in miR-320 inhibitor -injected and control groups. [score:5]
The ligand, Wnt7a and the intracellular molecule Dvl3, were significantly decreased in the miR-320 inhibitor -injected, while other three genes as members of β-catenin degradation complex – Btrc, Csnk1a1 and Gsk3b were significantly increased in the miR-320 inhibitor -injected group. [score:5]
Supplementary Figure 2 shows that miR-320 expression was strongly reduced after injection of its inhibitor. [score:5]
The blastocyst stage of miR-320 inhibitor -injected oocytes (C) and NC inhibitor -injected oocytes (D). [score:5]
Another seven genes – Bmp15, Ctnnb1, Lef1, Lrp6, Apc, Numb and Tcf7 were found to have no significant difference between the miR-320 inhibitor -injected (n = 80) and NC inhibitor -injected (n = 50) groups (Figure 4B). [score:5]
Expression levels of Wnt signaling pathway components were abnormal in miR-320 inhibitor -injected oocytes. [score:5]
The proportions of MII oocytes in the miR-320 inhibitor and NC inhibitor -injected groups that developed into the 2-cell stage (E) were 16.41% ± 4.33%, 56.85% ± 5.71% and 75% ± 7.07%, respectively. [score:5]
The 2-cell stage of miR-320 inhibitor -injected oocytes (A) and NC inhibitor -injected oocytes (B). [score:5]
To further investigate the role of miR-320 in embryonic development, we knocked down its expression in mouse MII oocytes by injecting its inhibitor oligonucleotide. [score:5]
The proportions of MII oocytes in the miR-320 inhibitor and NC inhibitor -injected groups that developed into the blastocyst stage (F) were 11.70% ± 0.42%, 39.26% ± 5.37% and 56% ± 5.66%, respectively. [score:5]
Morphology and statistical results of the 2-cell stage and blastocyst stage of oocytes injected with either miR-320 inhibitor or negative control (NC) inhibitor and oocytes of non -treated control group. [score:5]
To investigate the mechanisms behind the impaired fertilization and development competence of miR-320 inhibitor -injected oocytes, we tested 13 genes of Wnt signaling pathway to see if there were any abnormal expression levels that might affect the oocyte (Figure 4A and 4B). [score:4]
As Figure 3 shows, mouse embryo development in the miR-320 inhibitor -injected group was significantly affected. [score:4]
As shown in Table 2, 15 miRNAs (miR-222, miR-320, miR-24, miR-132, let-7b, miR-106a, miR-19b, miR-16, miR-186, miR-339-3p, miR-17, miR-323-3p, miR-197, miR-20a, and miR-382) were down-regulated in Group 2 and were chosen for subsequent verification analysis. [score:4]
Most of the miR-320 inhibitor -injected embryos arrested at the 2-cell stage and only a few proceeded to develop into blastocysts indicating that miR-320 is essential for embryonic development. [score:4]
Thus the association between the miR-320 expression level in follicular fluid and embryonic development was supported in ICSI patients as well as the in vitro fertilization and cultivation of mouse oocytes. [score:4]
Altogether, these imply that Wnt signaling pathway might have effects in fertilization and early embryo development and it may be altered by knocking down the level of miR-320. [score:3]
We subsequently found that the proportions of mouse MII oocytes that developed into 2-cell and blastocyst-stage embryos were strongly affected by knockdown of miR-320, and this further indicated that miR-320 plays an important role in embryo development potential. [score:3]
The proportions of MII oocytes in the miR-320 inhibitor -injected group that developed into 2-cell stage and blastocyst-stage embryos were 16.41% ± 4.33% and 11.70% ± 0.42%, respectively (n = 112). [score:3]
A total of 5–10 pL of the miR-320 inhibitor (50 μmol·L−1) was injected into the cytoplasm of MII oocytes. [score:3]
MiRNA profiles of each group were determined, and miR-320 and miR-197 were found to have significantly different expression levels between the two groups. [score:3]
Knockdown of mmu-miR-320 in mouse MII oocytes affects embryonic development. [score:3]
In the negative control (NC) group, oocytes were injected with universal oligonucleotides provided by the manufacturer which is not homologous with any known mammal genes in the same dosage with miR-320 inhibitor. [score:3]
Microinjection of the miR-320 inhibitor was performed in M2 medium using a Leica Hoffman microscope (LSM6000) equipped with the TransferMan NK2 micromanipulator and InjectMan NI2 (Eppendorf, Hamburg, Germany). [score:3]
It is conceivable that the significant higher level of Gsk3b may have the opposite effect to reduce the embryo cell number after we injected the oocytes with miR-320 inhibitor, or further more might influence the Day 3 embryo cell number of our ICSI patients whose follilular fluids contained relatively low level of miR-320. [score:3]
Diez-fraile et al. demonstrate that miR-320 were among the top 10 highest expressed miRNAs in follicular fluid 19, while Santonocito et al. did not identify miRNA-320 in follicular fluid 20. [score:3]
It has been shown that miRNAs play key roles in a number of signaling pathways 14, and there is evidence to suggest that miR-320 participates in regulating multiple signaling pathways, including Wnt signaling and insulin–PI3K signaling 25 44. [score:2]
In addition, Hsieh et al. have indicated that Wnt signaling pathway could be regulated by miR-320 25. [score:2]
Hsieh et al. have indicated that Wnt signal pathway could be regulated by miR-320 25. [score:2]
In conclusion, we have found that miR-320 and miR-197 in human follicular fluid are associated with embryonic development potential. [score:2]
By miRNA profiling and qRT-PCR, we identified miR-320 and miR-197 in the follicular fluid as potential candidates for being associated with embryo development potential. [score:2]
Because there is no miR-197 or homologous miRNA in the mouse miRNA database, our in vitro experiments focused solely on studying the function of miR-320. [score:1]
As indicated in Figure 2, among the 15 candidate miRNAs, only miR-320 (p = 0.0073, Figure 2A) and miR-197 (p = 0.0080, Figure 2B) were found to be significantly different between the two groups. [score:1]
Scatter plots depicting significantly different levels of miR-320 (A) and miR-197 (B) between the two groups. [score:1]
[1 to 20 of 45 sentences]
3
[+] score: 150
To evaluate whether CD71 was a direct target of miR-320, we generated CMV -based expression constructs containing the miR-451 and miR-320 genomic sequences and then tested for their ability to specifically suppress expression from their respective “indicator” reporter constructs containing two copies of identical miR-451 or miR-320 target sequences in a specific manner (Fig 5F). [score:10]
While reticulocytes transfected with the scrambled sequence LNA oligonucleotide underwent normal CD71 downregulation, miR-320 inhibition by the antisense oligonucelotide led to a persistent high expression of CD71 (Fig 5C, D) in three separate experiments. [score:8]
Since miR-320 expression does not change during the transition between reticulocyte and erythrocytes, its upregulation is not likely to be a trigger for the loss of CD71 expression. [score:8]
Taken together, these results showed that miR-320 can directly regulate the expression of CD71 and suggested that the poor expression of miR-320 in HbSS cells is associated with their persistently high CD71 level during terminal differentiation. [score:7]
Poor expression of miR-320 in HbSS cells was associated with defective CD71 downregulation during terminal differentiation. [score:6]
We found that miR-320 played an important role for the down-regulation of its target gene, CD71 during reticulocyte terminal differentiation. [score:6]
Instead, miR-320 is likely to fine tune the translational activities of CD71 in reticulocytes and contribute to its loss of CD71 surface expression together with the exosome release. [score:5]
In addition to CD71, miR-320 was also predicted by TargetScanS [24] and PicTar to target other mRNAs (Table S1, S2 [1]), including ETS2 (v-ets erythroblastosis virus E26 oncogene homolog 2) and EPB41L5 (erythrocyte membrane protein band 4.1 like 5), two mRNA encoding proteins important for erythrocyte biology (A) HbSS reticulocytes exhibited defective terminal differentiation. [score:5]
This suppression was abolished when three nucleotides in the miR-320 predicted target site were mutated as indicated in the 3′UTR of CD71. [score:5]
CD71 downregulation during terminal differentiation is defective in HbSS reticulocytes and is a potential mRNA candidate for miR-320 regulation. [score:5]
To further validate the miR-320/CD71 interaction, we overexpressed miR-320 in K562 cells and examine their influence on surface CD71 expression. [score:5]
In addition to CD71, miR-320 was also predicted by TargetScanS [24] and PicTar to target other mRNAs (Table S1, S2 [1]), including ETS2 (v-ets erythroblastosis virus E26 oncogene homolog 2) and EPB41L5 (erythrocyte membrane protein band 4.1 like 5), two mRNA encoding proteins important for erythrocyte biology To test for the possibility that mature erythrocytes contain previously undetected RNAs, we developed a protocol to obtain a pure population of mature erythrocytes by removing other blood cells through a series of purification procedures (Fig 1A). [score:5]
MiR-320 was predicted to regulate CD71 by all three predictive algorithms (TargetScans [24], PicTar [25] and miRanda [26]) with a perfect match between its “seed” sequence (5′- GUCGAAAA-3′, nucleotides 2–8) and the regulatory region in the CD71 3′ UTR (CAGCTTTT, 2693 to 2700 of CD71 mRNA) that is conserved in five species (Fig 4B). [score:5]
Table S1 The mRNA targets for miR-320 predicted by TargetScanS. [score:5]
This suggested that low miR-320 expression may have a role in the dysregulated maturation and decreased cell survival seen in SCD [1]. [score:4]
Further investigation revealed that poor expression of miR-320 in HbSS cells was associated with their defective downregulation CD71 during terminal differentiation. [score:4]
Collectively, these results indicated that CD71 was a direct target of miR-320 via the interaction between its 3′UTR and the miR-320 seed sequence. [score:4]
The CD71 3′UTR miR-320 mutant reporters were constructed with QuikChange® II Site-Directed Mutagenesis Kits (Stratagene, CA), which created three base pair changes in the miR-320 seed sequence -targeted regions (underlined) (CTAGATGTCTTTAGGCAG GA TC CTTTAA to replace CTAGATGTCTTTAGGCA GCAGCTTTTAA). [score:4]
When synthesized mature miR-320 was transfected into reticulocytes, we detected a three-fold increase in miR-320 expression with real-time RT-PCR (Fig 5B). [score:3]
Furthermore, the miR-320 expression level, which was very high in HbAA erythrocytes, was dramatically reduced in HbSS erythrocytes (Fig 4C, D), consistent with a possible role in the defective repression of CD71 seen in HbSS cells. [score:3]
This miR-320 -mediated repression was dependent on the predicted miR-320 target site in the CD71 3′UTR since a three base pair change in this site abolished miR-320 -mediated repression (Fig 5G, right). [score:3]
These differences are likely to provide additional information about the disease phenotypes, similar to the miR-320::CD71 connection established in our current study. [score:3]
To assess the effect of miR-320 on CD71 3′UTR activity, expression constructs encoding miR-320 and miR-451 were inserted into a CMV -based pcDNA3 cloning vector (Invitrogen, CA). [score:3]
The reporter activities when empty vector or miR-451 and miR-320 expression constructs were co -transfected into K562 cells with respective indicator plasmids containing duplicated copies of sequences identical to miR-451 and mIR-320. [score:3]
When this reporter construct was co -transfected into K562 cells with expression constructs encoding miR-320, miR-451 or empty vectors, we found that only miR-320, but not miR-451 or empty vectors, repressed its activity (Fig 5G, left). [score:3]
The phenotype of miR-320 inhibited normal cells resembled that of HbSS cells, including defective maturation and decreased survival. [score:3]
The miR-320 expression level did not change significantly between reticulocyte and erythrocyte samples in our real-time RT-PCR analysis of HbAA cells (Fig 4E). [score:3]
Table S2 The mRNA targets for miR-320 predicted by PicTar (0.62 MB XLS) Click here for additional data file. [score:3]
Finally, microRNAs may have additional functional roles in erythrocytes via a mechanism independent of mRNA targeting as suggested in our observation that the blockage of mIR-320 leads to decreased erythrocyte survival. [score:2]
miR-320 dysregulation and CD71 phenotypes in HbSS individuals. [score:2]
The following primers were used to amplified the expression constructs from the genomic DNA of K562 cells and cloned into the XhoI and EcoRI site of pcDNA3: miR-320 (forward: ccgaattccaggaaccagacagggacgc; reverse: ccctcgagccgactcttaagtccaggtc) and miR-451 (forward: ccgaattcacagtgcttttcaagccatgc; reverse: ccctcgagatcctcctgccttggcctctg). [score:2]
To directly test the functional role of miR-320 during terminal differentiation, we developed a transfection technique that allowed us to elevate and reduce the levels of selected microRNAs in reticulocytes. [score:2]
Overexpression of miR-320 in K562 cells led to a significantly lower level of CD71 when compared with control transfection with empty vectors (Fig 5H). [score:2]
In addition, miR-320 inhibition in reticulocytes caused significant cell death and led to fewer cell numbers when compared with cells transfected with the scrambled oligonucleotide or with miR-20a antisense oligonucleotides (Fig 5E, left). [score:2]
In vitro maturation assays of reticulocytes and miR-320 knockdown. [score:1]
0002360.g005 Figure 5(A) The histogram of the fluorescent intensity of reticulocytes transfected with unlabeled (black line) or fluorescently-labeled miR-320 (green line). [score:1]
These results indicated an essential role for miR-320 in maintaining erythrocyte homeostasis during terminal differentiation in normal reticulocytes. [score:1]
To investigate the function of miR-320 during reticulocyte terminal differentiation, we inhibited miR-320 function by transfecting either LNA antisense oligonucleotides against miR-320 or a scrambled sequence LNA oligonucleotide into HbAA reticulocytes before culturing them for in vitro terminal differentiation. [score:1]
On the other hand, the transfection of LNA antisense oligonucleotides against miR-320 led to 80% reduction in miR-320 levels (Fig 5B). [score:1]
Several microRNAs (miR-320, let-7s, miR-181, miR-141) were over-represented in the HbAA erythrocytes, while other microRNAs (miR-29a, miR-144, miR-451, miR-140) were over-represented in the HbSS erythrocytes (Fig. 3C). [score:1]
Locked Nucleic Acid (LNA) oligonucleotides against miR-320, mir-20a and scrambled control sequence (Exiqon, Denmark) were individually diluted in Opti-MEM and mixed with diluted Lipofectamine 2000 (Invitrogen) for 30 min at room temperature before transfecting into reticulocytes at a final concentration of 33 nM. [score:1]
[1 to 20 of 41 sentences]
4
[+] score: 50
The expression levels of selected group of miRNAs identified in the microarray experiment, miR−374−5p, −30b, −222, −320c, −186, −320a,−320e and −29c, were validated using quantitative real-time reverse transcription PCR (qRT-PCR) that confirmed the microarray results and showed upregulation of miR-30b, miR-320 family (320a/320c/ 320e) on day 7 post-AD differentiation induction and further increase in expression levels of the same miRNAs in addition to miR-186 on day 13 (Figure 1e). [score:8]
To confirm that RUNX2 is indeed a direct target for miR-320 family, we constructed reporter vector carrying the predicted binding site(s) of RUNX2 downstream of a firefly luciferase gene in the pMIR-REPORTER miRNA Expression Reporter vector (Figure 6c). [score:6]
We found that miR-320 family to be among the top 10% miRNAs predicted to regulate RUNX2, which further supports a role for miR-320 family in regulating RUNX2 expression during AD differentiation (Supplementary Table 5). [score:5]
Concordant with that, qRT-PCR indicated upregulation of several adipocytic markers, AdipoQ, PPAR γ (peroxisome proliferator-activated receptor- λ) and FABP4, in cells transfected with YWHAH, MIB1, RUNX2 and ZWILCH siRNAs, suggesting a plausible role for these genes in miR-320 -mediated effects on adipocytic differentiation of hMSC. [score:4]
Therefore, RUNX2 appears to be a key negative regulator of adipogenesis that seems to be targeted by several miRNA families, including the miR-320 family in our study. [score:4]
Interestingly, RUNX2 had four predicted miR-320 family binding sites on it 3′-untranslated region (3′UTR) located between nucleotides 1175 and 3142 (Figure 6a). [score:3]
Regulation of RUNX2 expression by miR-320 was subsequently confirmed using qRT-PCR and luciferase assay. [score:3]
In the present study, we have identified miR-320 family as novel regulator of bone marrow-derived hMSC differentiation into ADs. [score:2]
We identified miR-320 family as the most prominent novel regulator of hMSC differentiation into ADs. [score:2]
The interaction between miR-320 and RUNX2 3′ UTR was found to be specific, as mutating miR-320 seed region in the 3′UTR of RUNX2 completely abrogated its regulatory effects. [score:2]
Using Tri-Pronged approach combined with functional and biochemical assays, we identified several novel gene targets for miR-320 family during adipocytic differentiation of hMSC. [score:2]
To assess the direct interaction between miR-320 miRNA family and the 3′UTR from RUNX2, HEK-293 cells were co -transfected with 100 nM of pre-miR-Neg or pre-miR-320c and 100 ng of pMIR-REPORT carrying either wt or mutant 3′UTR sequences, along with 20 ng of pRL-SV40 vector (Promega, Madison, WI, USA) carrying the Renilla luciferase gene. [score:2]
As miR-320 family was the most novel family of miRNAs identified in current study as a possible regulator of adipocytic differentiation of hMSCs, all subsequent experiments focused on miR-320c member. [score:2]
Among the identified miRNAs, several members of the miR-320 (miR-320a, 320b, 320c, 320d and 320e) family were differentially expressed and were chosen for further investigation, as they have not previously been implicated in regulating the adipocytic differentiation of MSCs. [score:2]
[24] A mutant version of RUNX2 UTR reporter vector with mutations in the predicted miR-320 seed region(s) in the 3′UTRs was also generated using the primer combination listed in Table 2. The pRL-SV40 (encoding for renilla luciferase) was used for normalization. [score:1]
Bioinformatics analysis revealed that RUNX2 3′ UTR harbors four potential binding sites for miR-320 family. [score:1]
Therefore, it is plausible that miR-320 family promote adipogenesis via blocking other MSC differentiation pathways (i. e., osteoblast; Figure 6d). [score:1]
[1 to 20 of 17 sentences]
5
[+] score: 32
In order to further understand the role of aberrant miRNAs in physiological functions and biologic processes in arsenite -induced neoplastic transformation cells, 11 downregulated miRNAs (miR-197-3p, miR-192-5p, miR-127-3p, miR-139-5p, miR-490-3p, miR-196b-5p, miR-125a-3p, miR-298, miR-542-3p, miR-15b-5p, and miR-33b-5p) and six upregulated miRNAs (miR-200b-3p, miR-106b-5p, miR-574-5p, miR-320d, miR-200c-3p, and miR-141-3p) (Table S2) were selected, and their target genes were predicted with the TargetMiner, miRDB, and TarBase databases. [score:11]
Among the 191 dysregulated miRNAs, seventeen miRNAs (downregulation miRNAs: miR-197-3p, miR-192-5p, miR-127-3p, miR-139-5p, miR-490-3p, miR-196b-5p, miR-125a-3p, miR-298, miR-542-3p, miR-15b-5p, miR-33b-5p; upregulation miRNAs: miR-200b-3p, miR-106b-5p, miR-574-5p, miR-320d, miR-200c-3p, miR-141-3p, Table S2) were selected for bioinformatics analysis. [score:8]
As indicated in Figure 4, the target genes were mainly regulated by miR-15b-5p (338 genes), miR-106b-5p (316 genes), and miR-320d (177 genes), and these three miRNAs were the key node in the regulatory network. [score:5]
The miRNA-gene network illustrated that miR-15b-5p (338 regulated genes), as well as miR-106b-5p (316 regulated genes) and miR-320d (177 regulated genes), may play key roles in arsenite -induced carcinogenesis. [score:4]
The interactions of miRNAs and their target genes were shown in miRNA-gene regulatory network, in which miR-15b-5p, miR-106b-5p, and miR-320d were the core hubs. [score:4]
[1 to 20 of 5 sentences]
6
[+] score: 27
Notably, the Pten -deficient stromal fibroblasts upregulated Ets 2 expression and downregulated miR-320, a negative regulator of Ets 2 expression that contributed to increased mammary tumour growth [53]. [score:12]
Thus, inhibition of Ets2 expression by either its genetic deletion or miR-320 overexpression attenuated the promotion of tumour growth by these fibroblasts [48, 53]. [score:7]
Collectively, these findings suggest that Pten expression in FSP-1 [+] stromal fibroblasts serves as a negative regulator of Ets2 expression via miR-320 to inherently constrain mammary tumourigenesis. [score:6]
Bronisz A. Godlewski J. Wallace J. A. Merchant A. S. Nowicki M. O. Mathsyaraja H. Srinivasan R. Trimboli A. J. Martin C. K. Li F. Reprogramming of the tumour microenvironment by stromal pten-regulated mir-320 Nat. [score:2]
[1 to 20 of 4 sentences]
7
[+] score: 27
The results of the present study demonstrate that miR-152, in addition to miR-31, miR-210, and miR-320 miRNAs, targets TFRC directly, evidenced by functional miR-152-TFRC analyses and an inverse correlation between markedly decreased miR-152 level and TFRC up-regulation in human HCC cells and HCC tissue samples. [score:7]
Transfection with miR-152 efficiently down-regulated TFRC at both mRNA and protein levels (Figure 4D and 4E), while transfection with either miR-194 or miR-320 did not (data not shown). [score:4]
Likewise, Chen et al. [47] have reported a significant down-regulation of miR-320 in liver tumors. [score:4]
It has been reported previously that three miRNAs, miR-31, miR-210, and miR-320, in addition to miR-152, may target TFRC [43– 45]; however, considering a high degree of miRNA tissue specificity, the biological significance of any given miRNA-mRNA interaction should be evaluated in a specific target tissue context. [score:3]
In contrast, the expression of miR-194 in PLC/PRF/5, Hep3B, and HepG2 cells was substantially greater than in SK-HEP1 cells and there was no major difference in the level of miR-320 among cell lines (Supplementary Figure 1). [score:3]
The results of in silico screening analysis demonstrated that several miRNAs, including miR-152, miR-194, and miR-320, could target the 3′-UTR of TFRC mRNA. [score:3]
To confirm further the involvement of miR-152 in the regulation of TFRC at the post-transcriptional level, HepG2 cells were transfected with miR-152, miR-194, miR-320 microRNA mimics, or scrambled RNA oligonucleotide. [score:2]
HepG2 cells were seeded in 100 mm dishes at a density of 1 × 10 [6] cells/dish, and transfected with 20 nM of either miR-152, miR-194, or miR-320 microRNA mimics (Life Technologies), in three independent replicates, using Lipofectamin™ 2000 transfection reagent (Life Technologies) according to the manufacturer's instructions. [score:1]
[1 to 20 of 8 sentences]
8
[+] score: 27
The predicted target of miR-320 is methyl CpG -binding protein 2 (MECP2), which is up-regulated in BC and is an oncogene promoting cell proliferation [374]. [score:6]
The predicted target of miR-320 is MECP2 which is up-regulated in BC and serves as an oncogene promoting cell proliferation. [score:6]
miR-125b Deletions[373] mir-320d Deletions[374] let-7 g Deletions[378] miR-34a Deletions[376] miR-100 Deletions[375] miR-145 Deletions[112] miR-143 Deletions[112] OncomiR-1 Amplifications[367] miR-21 Amplifications[369] miR-155 Amplifications[368] miR-151a-5p Amplifications[370, 371] miRNAs that are silenced or amplified from CNA can have a cascade effect on the expression of different genes regulating entire pathways. [score:4]
miR-125b Deletions[373] mir-320d Deletions[374] let-7 g Deletions[378] miR-34a Deletions[376] miR-100 Deletions[375] miR-145 Deletions[112] miR-143 Deletions[112] OncomiR-1 Amplifications[367] miR-21 Amplifications[369] miR-155 Amplifications[368] miR-151a-5p Amplifications[370, 371] miRNAs that are silenced or amplified from CNA can have a cascade effect on the expression of different genes regulating entire pathways. [score:4]
In particular, it has been shown to be an important negative regulator of SOX4, and TENASCIN-C b) Amplifications of miR-33 produce effects that appear as dyseregulation of PTEN pathway mir-320 is found to be located in regions with CN loss in BC. [score:3]
In particular, it has been shown to be an important negative regulator of SOX4, and TENASCIN-C b) Amplifications of miR-33 produce effects that appear as dyseregulation of PTEN pathway mir-320 is found to be located in regions with CN loss in BC. [score:3]
In a study of Muller et al. [374], mir-320 has been found to be located in regions with DNA CN loss in BC. [score:1]
[1 to 20 of 7 sentences]
9
[+] score: 21
A study comparing miRNA expression in inflammatory breast cancer (IBC) with non-IBC also found miR-320 to be downregulated in the more aggressive IBC group of tumors [50]. [score:6]
miR-320 has been reported to be decreased in breast tumor tissue and downregulation of miR-320 - through loss of phosphatase and tensin homolog (PTEN) -has been shown to promote tumor proliferation and invasiveness in mouse mo dels; expression of miR-320 distinguished human normal breast stroma from tumor stroma and was correlated with recurrence [49]. [score:6]
Of these, miR-320 is of particular interest as we found three miR-320 family members (miR-320b, miR-320d, and miR320e) to be underexpressed in the serum of women who developed lymph node -positive breast tumors. [score:3]
Thus, loss of miR-320 expression may be associated with a higher likelihood of lymph node involvement and a more aggressive metastatic phenotype. [score:3]
Of the 10 miRNAs differentially expressed in the serum of women with tumors that spread to the lymph nodes (pN1 or higher), four (miR-145, miR-124, miR-125b, and miR-320) have been reported to be associated with breast cancer in previous studies [45- 48]. [score:3]
[1 to 20 of 5 sentences]
10
[+] score: 20
Schaar D. G. Medina D. J. Moore D. F. Strair R. K. Ting Y. miR-320 targets transferrin receptor 1 (CD71) and inhibits cell proliferation Exp. [score:5]
The importance of miRNA similar to miR-210 and miR-320 in the regulation of iron metabolism in vivo and in non-cancerous cell lines remains to be established, though these findings may represent potential therapeutic targets for sequestering iron from cancerous and tumorigenic cell types. [score:4]
miRNA Target mRNA Reference(s) miR-Let-7d DMT (∆IRE), BACH1Andolfo et al. (2010) [42], Hou et al. (2012) [43] miR-122 HFE, HJVCastoldi et al. (2009) [44] miR-196 BACH1Hou et al. (2010) [45] miR-200b FTHShpyleva et al. (2009) [46] miR-210 ISCU, TFRChan et al. (2009) [47], Yoshioka et al. (2012) [48] miR-214 LactoferrinLiao et al. (2010) [49] miR-320 TFRSchaar et al. (2009) [50] miR-485-3p FPNSangokoya et al. (2013) [51] miR-584 Lactoferrin ReceptorLiao et al. (2010) [52] Whereas hepcidin is considered to be the primary means of regulating systemic iron homeostasis, a family of cytosolic RNA binding proteins known as Iron Regulatory Proteins (IRP) is considered to be the global regulators of cellular iron homeostasis. [score:4]
Furthermore, enhanced expression of miR-320 decreases the abundance of TfR on the plasma membrane and limits iron uptake in the lung carcinoma cell line A549 [50]. [score:3]
MiR-320 contributes to the regulation of cellular iron uptake by repressing TfR translation to decrease transferrin -dependent iron uptake. [score:3]
Finally, it remains to be established whether many of the miRNA demonstrated to affect iron metabolism using cell -based or other genetic approaches, such as miR-320 and miR-200b, have physiological roles in vivo or in non-transformed cell types, especially in response to physiologically-relevant alterations in nutrient intake. [score:1]
[1 to 20 of 6 sentences]
11
[+] score: 20
To the best of our knowledge, we initially detected a decreased expression pattern of miR-320c in human bladder cancer tissue compared with its normal adjacent tissue in the study, Recent miRNA microarray analyses demonstrated that miR-320 was down-regulated in many types of cancer, including breast cancer, acute myelogenous leukemia and colon cancer, indicating that miR-320 could act as a tumor suppressor in cancer, which was similar to our results [16]¿[18]. [score:7]
Previous miRNA microarray analysis illustrated that miR-320 is down-regulated in breast cancer, acute myelogenous leukemia and colon cancer, revealing that miR-320 could probably act as a tumor suppressor in prohibiting the behavior of cancer [16]¿[18]. [score:6]
It was reported that miR-320 could inhibit prostate cancer cell proliferation by down -regulating the Wnt/beta-catenin signaling pathway [19]. [score:4]
Therefore, we identified CDK6 as a new target of miR-320. [score:3]
[1 to 20 of 4 sentences]
12
[+] score: 19
Supporting the notion of disease relevance, this network included several known PD-related genes such as the transcriptional regulator FOXP1 (Kim et al., 2007), that promotes midbrain dopaminergic identity in stem cells (Konstantoulas et al., 2010), which was identified as alternatively spliced in this study and was predicted as targeted by the PD dys-regulated hsa-miR-320 cluster. [score:7]
Statistical significance enrichment analysis identified nine miRNAs as frequently targeted at detected spliced transcripts: hsa-miR-769-3p (predicted to target four transcripts), hsa-miR-378 (with six targets) as well as hsa-mir-320, hsa-miR-92b-5p, hsa-miR-16, hsa-miR-150, hsa-miR-671, hsa-miR-20a, and hsa-miR-18b (The full list and adjusted p-values are given under Table S10). [score:7]
The modified leukocyte miRNAs also differed in their copy numbers (for example, hsa-miR-20a expressed higher as compared with hsa-miR-320, Figure 2G). [score:2]
Intriguing, miR-320, which was modified in PD patients as compared with matched healthy control volunteers is included in a miRNA signature of prion -induced neurodegeneration (Saba et al., 2008), perhaps reflecting a feedback response aimed to avoid disease symptoms that was potentiated by DBS. [score:2]
Enrichment analysis detected 6 of the DBS -modified miRNAs as modified (having adjusted p-value < 0.05): hsa-miR-320 (a, b, and c) as predicted to bind 4 spliced transcripts including hnRNPA2B1, hsa-miR-378 (predicted to bind 6 spliced transcripts), hsa-miR-92b (predicted to bind 4 spliced transcripts), hsa-mir-150, hsa-miR-20a, and hsa-miR-18b (where hsa-miR-18b-3′ changed). [score:1]
[1 to 20 of 5 sentences]
13
[+] score: 19
miR-320 was shown to be involved in the regulation of cardiac ischemia/reperpusion injury through targeting heat-shock protein 20: over -expression enhanced cardiomyocyte apoptosis, whereas knockdown was cytoprotective [30]. [score:7]
Ten miRNAs were used for further in silico validation: one predicted by using above programs with elevated expression in microarray analysis (hsa-miR-574-3p; miRBase accession number: MIMAT0003239) and nine up-regulated in microarray analysis but not predicted by the algorithms used (hsa-miR-122, hsa-miR-199a-3p, hsa-miR-140-3p, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-483-5p, hsa-miR-574-5p; miRBase accession numbers: MIMAT0000421, MIMAT0000232, MIMAT0004597, MIMAT0000510, MIMAT0005792, MIMAT0005793, MIMAT0006764, MIMAT0004761, MIMAT0004795, respectively). [score:6]
Other up-regulated and in silico validated miRNAs were miR-199a, four members of miR-320 family and miR-483. [score:4]
2−4.7−9.865-86partially (1–4) −23.7−8.2−8.2687-708no −21.8−9.1−11.9123-144partially (1–6) miR-320c−19.1−8.00.3800-819no −24.0−12.4−8.2689-708no −21.1−11.4−9.2650-669no miR-320d−23.4−13.2−8.2690-708no −24.3−12.2−9.0709-727partially (1–4, 6–7) miR-483-5p−23.8−13.1−9.0705-726no −21.8−4.7−8.563-84no −22.7−9.1−9. [score:1]
5−5.3711-732no miR-320b−24.6−10.9−7.1117-138partially (1–5, 7–12) −21.7−6.9−11.1536-557partially (1–2, 4–8) −25.8−12.3−11.4505-526partially (1–4, 7–8) −25.5−6.9−12.9229-250no miR-320c−23.2−6.9−12.9230-249no −23.3−12.3−11.4507-526partially (1–4, 7–8) −19.5−7.7−5.3713-732no miR-320d−24.4−10.1−7.1120-138partially (1–5, 7–13) −19.4−6.9−11.1539-557partially (1–2, 4–8) −22.8−6.9−12.9231-249no −23. [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 18
In this current study, we show that miR-320 expression is markedly decreased in NSCLC, which in turn facilitates the development of NSCLC through increasing VDAC1 expression. [score:6]
The upper panel shows one potential target site on 3′-UTR of VDAC1 and the lower panel shows multiple sequence alignment of miR-320 with the binding site on 3′UTR of VDAC1. [score:3]
All primers were listed in Table 2. U6 small RNA was used as an internal control for normalization and quantification of miR-320 expression. [score:2]
Based on the relative expression levels of miR-320 family in lung tissues, miR-320a was further selected to investigate its role in the development and progression of NSCLC. [score:2]
Recently, miR-320 has been shown to be decreased in the squamous cell lung carcinoma tissues [25]. [score:1]
In the present report, using computational analysis we found that miR-320 family has a potential binding site on VDAC1 mRNA 3′-UTR. [score:1]
A conserved miR-320 (miR-320a, 320b, 320c and 320d) binding site exists in the 3′-UTR of VDAC1 across human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR)), gorilla (Gorilla gorilla) and etc (Figure 1). [score:1]
Bioinformatic analysis of miR-320 binding site in VDAC1 mRNA 3′-UTR. [score:1]
To determine the levels of miR-320 family in lung tissues, total RNAs were extracted from 60 adjacent non-tumor tissues from NSCLC patients. [score:1]
[1 to 20 of 9 sentences]
15
[+] score: 18
In this study we observed miR-320 and 486-5p to be downregulated with the exposure and both activating the expression and translation of the forkhead box transcription Factor FOXP1. [score:8]
Zhang, T. et al. Down-regulation of miR-320 associated with cancer progression and cell apoptosis via targeting Mcl-1 in cervical cancer. [score:6]
Furthermore, both miRNAs miR-320 and miR-486 have been reported to be downregulated in many types of cancer 26, 27. [score:4]
[1 to 20 of 3 sentences]
16
[+] score: 18
Overexpression of Nucleolin and NLC1-C decreased the activity of the miR-320/SGCZ (miR-383) promoter region (−1050/+50 bp), which contains a putative NLC1-C binding site located at −225  to −153 bp (miR-320 promoter) or −793  to −740 bp (SGCZ (miR-383) promoter), by about 50 and 50%, respectively (Figure 4k and l). [score:3]
To verify that these potential NLC1-C/Nucleolin -binding sites were important for the transcriptional activity of miR-320 and miR-383, expression vectors encoding Nucleolin and/or NLC1-C were transiently co -transfected with miR-320 or SGCZ (miR-383) promoter reporter plasmids into 293 T cells. [score:3]
WT miR320 promoter and miR-383 promoter were obtained by amplifying two −1000 /+50 bp fragments of miR320 promoter and miR-383 promoter harbouring the NLC1-C -binding sites, whereas mutated miR320 promoter and miR-383 promoter were generated by PCR -based site-directed mutagenesis. [score:2]
These results indicate that the miR-320 and SGCZ promoter region might contain a critical Nucleolin-responsive regulatory element. [score:2]
Conversely, Mutation of putative NLC1-C binding site in the miR-320/SGCZ (miR-383) promoter region recued the luciferase activity repression induced by Nucleolin and NLC1-C (Figure 4k and l). [score:2]
For NLC1-C, β-actin, miR-320, miR-383 NB, total RNAs collected from transfected cells were resolved on 1.5% denatured agarose gels ands were carried out according to the manufacturer's protocol (DIG Northern Starter Kit, Roche). [score:1]
Antibodies to normal IgG failed to immunoprecipitate miR-320 and SGCZ promoter (Figure 4m and n). [score:1]
Digoxigenin (DIG) -labelled antisense of NLC1-C and β-actin probes were made using either SP6 or T7 RNA polymerases by in vitro transcription with the DIG Northern Starter Kit (Roche) and 5'-end DIG -labelled LNA modified DNA oligonucleotides (LNAs) complementary to the mature miR-320 and miR-383 were supplied by Exiqon A/S (Vedbaek, Denmark). [score:1]
Analysis of bioinformatics data revealed that there is one binding site of NLC1-C on the miR-320 and SGCZ (miR-383) promoter (Figure 4j). [score:1]
WT and mutated miR320 promoter and miR-383 promoter sequences were inserted into the KpnI and XhoI sites of the pGL3-basic vector. [score:1]
The probes sequences of miR-320 and miR-383 are listed in Supplementary Table S3. [score:1]
[1 to 20 of 11 sentences]
17
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Uptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
OsmoticUptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
[1 to 20 of 2 sentences]
18
[+] score: 18
Furthermore, gene expression profiling of miR-320 -overexpressing PCa cells showed a significant decrease in downstream target genes of the Wnt/β-catenin pathway and CSC markers (Hsieh et al., 2013). [score:7]
Another miRNA that regulates CSC properties is miR-320, which acts by directly targeting β-catenin in PCa cells (Hsieh et al., 2013). [score:5]
miR-320 and β-catenin expression is inversely correlated in CD44 [+] PCa cells. [score:3]
MicroRNA-320 suppresses the stem cell-like characteristics of prostate cancer cells by downregulating the Wnt/beta-catenin signaling pathway. [score:3]
[1 to 20 of 4 sentences]
19
[+] score: 18
Notably, our interaction network analysis of miRNA-overtargeted genes showed that miR-320 is involved in several interactions that target important tumor suppressor genes such as CDKN2A and PTEN (Figure 4). [score:7]
Alternatively, miR-320 might perform as an oncomir under certain conditions (e. g., distinct miRNA partners involved in cooperative gene targeting could inhibit the activity of distinct subsets of genes). [score:5]
This may indicate that miR-320 overexpression in the circulation of our HNSCC patients is part of an adaptive response against the cancer. [score:3]
The report by Kim and Choi [52] supports the oncogenic potential of miR-320. [score:1]
These authors found that miR-320 promotes proliferation of Dgcr8 -deficient embryonic stem cells (ESCs) by releasing them from G1 arrest. [score:1]
In contrast to the clear oncogenic role demonstrated for miR-103a and miR-107, miR-320 has been mainly reported as an anti-angiogenic miRNA in breast cancer [51] and oral squamous cell carcinoma [43]. [score:1]
[1 to 20 of 6 sentences]
20
[+] score: 17
Song C. L. Liu B. Diao H. Y. Shi Y. F. Zhang J. C. Li Y. X. Liu N. Yu Y. P. Wang G. Wang J. P. Down-regulation of microrna-320 suppresses cardiomyocyte apoptosis and protects against myocardial ischemia and reperfusion injury by targeting IGF-1 Oncotarget 2016 10.18632/oncotarget. [score:11]
miRNA-320, which targets ASK1, suppressed cardiomyocyte apoptosis by down -regulating ASK1/JNK phosphorylation under ischemia/reperfusion injury [33]. [score:6]
[1 to 20 of 2 sentences]
21
[+] score: 17
Down-regulation of miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a separated melanoma from normal skin; and down-regulation of miR-203, miR-205, miR-211 (and its homologue, miR-204), miR-23b, miR-26a and miR-26 distinguished melanoma from nevus. [score:7]
Using DIANA mirPath software [36], gene targets were interrogated for miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a down-regulated in PCM vs. [score:6]
miR-144-3p, miR-181b-5p, miR-320a, miR-320c, miR-320d and miR-451a were down-regulated in PCM vs. [score:4]
[1 to 20 of 3 sentences]
22
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Interestingly, the miR-320 was differently expressed in the follicular fluid of women with PCOS in still one study [53] and was along miR-383 upregulated in comparison with healthy (control) women. [score:6]
This study demonstrated that miR-320 regulates the proliferation and steroid production by targeting E2F1 and SF-1 in granulosa cells and is involved in the follicular development. [score:5]
In another study, it has been found that two miRNAs, miR-132 and miR-320, were expressed at significantly lower levels in the follicular fluid of women with PCOS than in a group of healthy women, as can be seen in Figure 3. In addition, it has been evidenced that miR-132, miR-320, miR-520c-3p, miR-24, and miR-222 that are present in the follicular fluid regulate estradiol concentrations and miR-24, miR-193b, and miR-483-5p progesterone concentrations [52]. [score:4]
[1 to 20 of 3 sentences]
23
[+] score: 15
In AGS, BGC-823, and HGC-27 cells, the overexpression of miR-320 resulted in the inhibition of FoxM1 mRNA expression and the recovery of P27 [KIP1] expression (Figure 2A, 2B and 2C). [score:9]
The results of clone genetics and the recovery experiment showed that the inhibition of cell proliferation with miR-320 overexpression was through the regulation on FoxM1- P27 [KIP1] axis. [score:6]
[1 to 20 of 2 sentences]
24
[+] score: 14
The relative expression levels of 62 miRNA (out of 366 human miRNAs tested) expressed substantially in these cells are shown in Figure 6. The most abundant miRNAs expressed in ARPE-19 cells were let-7b, let-7a, miR-125b, miR-24, miR-320, miR-23b, let-7e, and let-7d. [score:7]
MiR-320 regulates cardiac ischemia/reperfusion injury and cell proliferation by targeting heat-shock protein 20 and transferrin receptor 1, respectively [52, 53]. [score:3]
Microarray hybridization analysis identified let-7b, let-7a, miR-125b, miR-24, miR-320, miR-23b, let-7e, and let-7d as the most abundant miRNAs normally expressed in ARPE-19 cells. [score:3]
The most abundant miRNAs that were detected in ARPE-19 cells were let-7b, let-7a, miR-125b, miR-24, miR-320, miR-23b, let-7e, and let-7d. [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
The expression of miR-320d was increased in AML patients [125] and higher expression of miR-124-1 was associated with shorter overall survival and relapse-free survival [126]. [score:5]
The potential targets of the miRNAs listed above are c-IAP-1 and MCL1, which are important for tumor cell survival following treatment, while miR-23a, miR-30a, miR-30e, miR-203, miR-320 and miR424 are known to target BCR-ABL [48– 52]. [score:5]
Increased miR-124, miR-128-1, miR-194, miR-219–5p, miR-220a and miR-320 expression are associated with increased risk in AML, however the role of microRNAs in the development of AML is unclear [101]. [score:4]
[1 to 20 of 3 sentences]
26
[+] score: 13
Hypoxia suppressed miR-320 expression through HIF-1 α and increased the expression of neuropilin 1 (NRP1) and promoted the motility and tube formation ability of endothelial cells via vascular endothelial growth factor (VEGF) signaling pathway, resulting in tumor angiogenesis [41]. [score:7]
miR-320 was downregulated in OSCC-derived cell-lines and tissue specimens, with its expression correlating inversely with the vascularity. [score:6]
[1 to 20 of 2 sentences]
27
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
Meanwhile, miR-320 is able to inhibit HL-60 cell proliferation by suppressing receptor 1 (TfR-1; CD71) [72], and miR-181a was believed to act as an intrinsic antigen sensitivity “rheostat” during T cell development [73]. [score:6]
MiR-320, miR-181a, miR-30a-3p and let-7 were shown to be downregulated in colorectal cancer [74]. [score:4]
Notably, some miRNAs among the top 10 identified here have been reported to be related to immunity (miR-320, miR-181a, miR-30a-3p, let-7a, let-7f and let-7c) and development (miR-193a-3p, miR-378 and miR-191). [score:2]
The top 10 miRNAs were ssc-miR-193a-3p, ssc-miR-423-5p, ssc-miR-320, ssc-miR-181a, ssc-miR-30a-3p, ssc-miR-378, ssc-miR-191, ssc-let-7a, ssc-let-7f and ssc-let-7c. [score:1]
[1 to 20 of 4 sentences]
28
[+] score: 13
Twelve of them (miR-10b, miR-15a, miR-19a, miR-26b, miR-30a, miR-30c, miR-125a, miR-125b, miR-148a, miR-148b, miR-195 and miR-320) are down-regulated both in dogs and in humans whereas one (miR-494) is up-regulated in both species and four (miR-29a, miR-181a, miR-196a and miR-374a) are down-regulated in dogs but up-regulated in humans. [score:13]
[1 to 20 of 1 sentences]
29
[+] score: 13
Our results showed that miR-320 cluster (miR-320a, miR-320b, miR-320c and miR-320d) could down regulated MICB expression in human cancer cells, especially miR-320a that was highly expressed in a CCA cell line (KKU-214). [score:6]
The study of miRNA expression pattern in intrahepatic cholangiocarcinoma (ICC) by Chen et al. [34], indicated that miR-320 was down expressed in ICC. [score:5]
Nevertheless, our study could support the role of miR-320 in cancer. [score:1]
One type of constructs contained the mutated binding sites of both known miRNAs (miR-20a, miR-93 and miR-106b) and nine novel miRNAs (our candidate miRNAs, miR-320c, miR-320a, miR-320b, miR-320c, miR-320d, miR-542-3p, miR-641, miR-661 and miR-940) and another type contained only the mutated binding sites of known miRNAs as a positive control (Figure 3A). [score:1]
[1 to 20 of 4 sentences]
30
[+] score: 12
Song, C. L. et al. Down-regulation of microRNA-320 suppresses cardiomyocyte apoptosis and protects against myocardial ischemia and reperfusion injury by targeting IGF-1. Oncotarget, doi:10.18632/oncotarget. [score:12]
[1 to 20 of 1 sentences]
31
[+] score: 12
Expression of miR-320 was up-regulated in the diabetic rat mo del, impairing angiogenesis by repressing IGF-I expression [15]. [score:8]
IGF-I was downregulated by miR-320 in myocardial microvascular endothelial cells of type 2 diabetic rats. [score:4]
[1 to 20 of 2 sentences]
32
[+] score: 11
The expression levels of nine miRNAs, such as miR-16, miR-92a, miR-130b, miR-21, miR-320, and miR-106b, were significantly upregulated in the PDV group (Fig 1C and 1E). [score:6]
Although we emphasized the expression of miR-21 in this study, we also observed a significant increase in the expression of miR-16, miR-92a, miR-130b, and miR-320. [score:5]
[1 to 20 of 2 sentences]
33
[+] score: 11
One functional network connected up-regulation of the differentiation inhibitor ID2 mRNA to down-regulation of the hematopoiesis- or cell cycle regulating miR-125b-5p, miR-181a-5p, miR-196a-5p, miR-24-3p and miR-320d in adult PreBII large cells. [score:10]
Notably, the network also included the hematopoiesis associated miR-181a-5p [17] and miR-196a-5p [33], and the cell cycle associated miR-24-3p [34] and finally miR-320d. [score:1]
[1 to 20 of 2 sentences]
34
[+] score: 11
Namely, hsa-miR-22, a cell growth inhibitor, hsa-miR-181b, hsa-miR-320 and hsa-let-7e, all tumor suppressor miRNAs, were all upregulated in the first 6 h post-infection as part of the host-cell immune response to the virus. [score:8]
Among them are hsa-miR-22, hsa-miR-181b and hsa-miR-320 that were overexpressed at 6 and 12 h post-infection as part of the host immune response to the virus. [score:3]
[1 to 20 of 2 sentences]
35
[+] score: 11
Overexpression of miR-320-3p did not significantly affect CYP17A1 mRNA levels but inhibition enhanced levels of both mRNAs; this implies that CYP17A1 is already under maximal inhibition at the miR-320-3p target site. [score:9]
Like most miRNAs characterised to date, miR-320-3p has been reported to have multiple mRNA targets and regulate different pathways in different cell types. [score:2]
[1 to 20 of 2 sentences]
36
[+] score: 10
Among those upregulated, we may mention hsa-miR-17-5p, hsa-miR-320, hsa-miR-652, while the downregulated miRNAs were hsa-miR-15a, hsa-miR-16, hsa-miR-23a/b, and hsa-miR-200c [119]. [score:7]
Additionally, two other cellular miRNAs were able to target RTA 3′UTR (i. e., hsa-miR-498 and hsa-miR-320d), promoting KSHV latency by repressing the RTA [195]. [score:3]
[1 to 20 of 2 sentences]
37
[+] score: 9
Inhibition of miR-320 in insulin resistance 3T3-L1 adipocytes was found to improve insulin sensitivity and insulin-stimulated glucose uptake via modulation of p85 expression, phosphorylation of Akt and GLUT4 protein levels [91]. [score:5]
A further study reported miR-320 along with fifty other was upregulated in response to hyperglycemia and hyperinsulinemia in 3T3-L1 adipocytes [91]. [score:4]
[1 to 20 of 2 sentences]
38
[+] score: 9
Among 20 expressed miRNAs, the expression levels of hsa-mir-25, hsa-mir-221, hsa-mir-302b, hsa-mir-363, hsa-mir-372, hsa-mir-199a, hsa-mir-302d, hsa-mir-26a, hsa-mir-320, hsa-mir-744, hsa-mir-152 and hsa-let-7e in the study of Morin et al. exceed those obtained with miRExpress, but the levels of hsa-mir-423, hsa-let-7a, hsa-mir-1, hsa-mir-340, hsa-mir-302a, hsa-mir-130a, hsa-let-7f and hsa-mir-122 in the work by Morin et al. are lower than those obtained from miRExpress (Table 6) (full data are available in additional file 7). [score:9]
[1 to 20 of 1 sentences]
39
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-210, hsa-mir-215, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-369, hsa-mir-371a, hsa-mir-340, hsa-mir-335, hsa-mir-133b, hsa-mir-146b, hsa-mir-519e, hsa-mir-519c, hsa-mir-519b, hsa-mir-519d, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-499a, hsa-mir-504, hsa-mir-421, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-190b, hsa-mir-301b, hsa-mir-302e, hsa-mir-302f, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320e, hsa-mir-371b, hsa-mir-499b
MicroRNAs are known to regulate the chaperone network in several conditions including cerebral ischemia; miR-320 has been demonstrated to regulate HSP20 transcripts during cardiac injury [66] and miR-1 is known to target HSP72 mRNAs in cardiac ischemia [67]. [score:5]
MicroRNA miR-1 has also been documented to directly target IGF1 transcripts in cardiac and skeletal muscle [72], as have miR-320 and miR-206 in a rat mo del of myocardial infarction [73]. [score:4]
[1 to 20 of 2 sentences]
40
[+] score: 9
FOXM1 is targeted by miR-1260 and miR-320, which were downregulated in our analysis, suggesting abnormal (increased) FOXM1 expression in DLBCL. [score:8]
MiRs identified in this analysis include miR-320, 34a, 155, 21 and miR-210, which have been previously reported as potential biomarkers in other cancers such as osteosarcoma, lung cancer, breast cancer, myeloid leukemia, high-grade glioma, colon cancer and hepatoma [13– 19]. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 9
Meanwhile, heat shock factor 1-regulated HuR and let-7/miR-320 could contribute to the translation of β-catenin through down-regulation of lincRNA-p21 expression [19]. [score:9]
[1 to 20 of 1 sentences]
42
[+] score: 8
There has been reports showing that miR-320 is down regulated in several tumor types [12– 15], and one of miR-320 ‘s downstream effects was inhibiting cell proliferation by targeting transferrin receptor 1 (CD71) in human leukemia cell line HL-60 [19]. [score:6]
Additionally, it is known that miR-320 suppresses the stem cell like characteristics of prostate cancer cells by down regulating the Wnt/beta-catenin signaling pathway [20]. [score:2]
[1 to 20 of 2 sentences]
43
[+] score: 8
For instance, miR-378 inhibits insulin signaling by targeting p110α in hepatocytes of ob/ob mice [47], and miR-320 decreases insulin sensitivity in 3T3-L1 adipocytes by targeting the p85 unit of PI3K [48]. [score:7]
Ling H. Y. Ou H. S. Feng S. D. Zhang X. Y. Tuo Q. H. Chen L. X. Zhu B. Y. Gao Z. P. Tang C. K. Yin W. D. Changes in microRNA (miR) profile and effects of miR-320 in insulin-resistant 3T3-L1 adipocytes Clin. [score:1]
[1 to 20 of 2 sentences]
44
[+] score: 8
Among these, the over -expression of miR-21, miR-34a, miR-155, miR-320 and the under -expression of miR-122, miR-181a, miR-199a, miR-200a were reported by more than one publication. [score:5]
miRNA Chromosome location Dysregulation References miR-122 18q21.3 Decreased/Increased 52, 103 miR-125b 11q24.1 Decreased 103 miR-126 9q34.3 Decreased 98 miR-155 21q21.3 Increased 31, 99 miR-181a 1q32.1 Decreased 52, 100 miR-199a 1q24.3 Decreased 99, 100 miR-200a 1p36.33 Decreased 100, 103 miR-21 17q23.2 Increased 52, 102 miR-217 2p16.1 Increased 91 miR-320 8p21.3 Increased 100, 103 miR-34a 1p36.22 Increased 52, 103 miR-375 2q35 Increased 101 miR-486 8p11.21 Increased 100 let-7b 22q13 Decreased 52 miRNA is a known regulator of Kupffer cell response to. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 7
Some of the EV miRNAs (miR-181d-3p, miR-155-3p, miR-185-5p, miR-3940-3p, miR-4532, miR-7107-5p miR-504-3p, miR-320d, miR-19b-3p and miR-22-3p) up-regulated in female OA synovial fluid were down-regulated in response to estrogen treatment in human and mouse cells 51– 54. [score:7]
[1 to 20 of 1 sentences]
46
[+] score: 7
The down-regulated miRNAs were highly enriched for LCL specific miRNAs (miR-155, let-7a-i, miR-21, miR-142, miR103, miR-320, miR-146a-b) and the up-regulated miRNAs were highly enriched for iPSC specific miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, miR-18a). [score:7]
[1 to 20 of 1 sentences]
47
[+] score: 7
Eighteen miRNAs, including miR-34b, miR-326, miR-432, miR-548c-3p, miR-570, and miR-603, were drastically and constantly downregulated in GH adenomas, whereas only miR-320 was significantly upregulated. [score:7]
[1 to 20 of 1 sentences]
48
[+] score: 7
MiRNA-378 and miRNA-101 target the MAPA1 signaling while miRNA-483-5p, miRNA-320, miRNA-22 affect AKT-3, and BCL9L signaling to develop tuberculosis infection (Zhang et al., 2013). [score:3]
Altered expression of miRNA-365, miRNA-483-5p, miRNA-22, miRNA-29c, miRNA-101, and miRNA-320 are reported in tuberculosis and affect the mitogen-activated protein kinases (MAPK) and transforming growth factor beta (TGF-β) signaling to develop tuberculosis infection (Zhang et al., 2013). [score:3]
Alteration in miRNA-378, miRNA-483-5p, miRNA-22, miRNA-29c, miRNA-101, and miRNA-320 are specific for pulmonary tuberculosis and non-tuberculosis infections. [score:1]
[1 to 20 of 3 sentences]
49
[+] score: 7
The four studies considered for the comparison, including the present study, demonstrated the higher expression in naïve B-cells of mir-320, the up-regulation of mir-181b, mir-25, miR-130b in GC B cells as well as the greater expression of both mir-29a and seven members linked to the cluster miR-17/92 in mature B cells. [score:7]
[1 to 20 of 1 sentences]
50
[+] score: 7
The top 8 downregulated (hsa-miR-200c, hsa-miR-212, hsa-miR-29a, hsa-miR-532, hsa-miR-141, hsa-miR-1, hsa-miR-363, hsa-miR-187) and 8 upregulated (hsa-miR-487, hsa-miR-452, hsa-miR-1233, hsa-miR-92a, hsa-miR-106b, hsa-miR-1290, hsa-miR-320, hsa-miR-26a) miRNAs were presented in Figure 1A. [score:7]
[1 to 20 of 1 sentences]
51
[+] score: 7
MicroRNA-320 inhibits osteosarcoma cells proliferation by directly targeting fatty acid synthase. [score:5]
miR-320 regulates tumor angiogenesis driven by vascular endothelial cells in oral cancer by silencing neuropilin 1. Angiogenesis. [score:2]
[1 to 20 of 2 sentences]
52
[+] score: 6
In comparison with uninfected reads, highly expressed aae-mir-23, aae-mir-576 and aae-mir-320 were upregulated in CHIKV-infected Ae. [score:6]
[1 to 20 of 1 sentences]
53
[+] score: 6
Recent studies on miRNAs have shown that the expression levels of different miRNAs, such as miR-21, miR-320, miR-498, miR-106a and miR-200c correlate with the probability of recurrence-free survival in CRC stage II-III. [score:3]
Schepeler and colleagues [103] showed that miR-320 or miR-498 expression was significantly associated with progression-free survival in stage II CRC. [score:3]
[1 to 20 of 2 sentences]
54
[+] score: 6
Scatter plots showing the number of miRNAs targeting an mRNA (Y axis) versus the correlation between miRNAs and mRNA expression (Y axis) for selected miRNA families within the integrated data set for neuroblastoma (a) the let-7 family and (b) and mir-302 family, and human immune cells (c) the let-7 family and (d) the mir-320 family. [score:5]
In some cases, there is limited evidence of a greater effect, such as in the plots of the mir-302 family in the neuroblastoma data set (Figure 5b) and the mir-320 family in the human immune cells data set (Figure 5d). [score:1]
[1 to 20 of 2 sentences]
55
[+] score: 6
They function by binding to target sites in 3'' UTRs of messenger RNAs (mRNAs) to repress translation or mediate mRNA degradation, although alternative modes of action have been reported recently, such as direct transcriptional silencing of POLR3D by miR-320 [2]. [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
Vishnubalaji R Hamam R Yue S Al-Obeed O Kassem M Liu FF Aldahmash A Alajez NM MicroRNA-320 suppresses colorectal cancer by targeting SOX4, FOXM1, and FOXQ1Oncotarget. [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
By analysis of the genome-wide expression profiling of miRNAs, Yan and his colleagues showed that seven miRNAs of hsa-miR-497, hsa-miR-31, hsa-miR-355, hsa-miR-320, rno-mir-140, hsa-miR-127 and hsa-miR-30a-3p were significantly downregulated in BC [20]. [score:6]
[1 to 20 of 1 sentences]
58
[+] score: 6
Using a step-wise approach, we selected five exosomal miRNAs (miR-320c, miR-1202, miR-1225-5p, miR-1207-5p, and miR-7270) and validated miR-320 and miR1225-5p expression in the PLF of 18 CG patients by qRT-PCR. [score:3]
Mir-1225-5p showed higher expression in T4 than in T1–T3 stage CG patients, confirming the results obtained by microarray, whereas there was no difference in miR-320 levels between patient groups. [score:3]
[1 to 20 of 2 sentences]
59
[+] score: 6
These data further demonstrated that miR-320/429 could directly target IL-4 to suppress tumor progression and metastasis. [score:6]
[1 to 20 of 1 sentences]
60
[+] score: 6
In this context, Hamam et al. [20] observed that miR-320 family (miR-320a, 320b, 320c, 320d and 320e) were upregulated during adipogenesis suggesting the miR-320 family as possible molecular switch promoting adipocytic differentiation of hMSC by targeting RUNX2, MIB1, PAX6, YWHAH and ZWILCH. [score:6]
[1 to 20 of 1 sentences]
61
[+] score: 6
Furthermore, several of the dysregulated miRNAs in the HD monkeys are also predicted to target the insulin like growth factor −1 gene (IGF1) or its receptor (IGF1-R), including; miR-128a, miR940, miR-320, and miR133. [score:4]
Correspondingly, although we examined miR-128a regulation of the SP1 transcription factor, other miRNAS identified in this study also bioinformatically bind to SP1 (such as miR-320, miR-133, and miR-181). [score:2]
[1 to 20 of 2 sentences]
62
[+] score: 6
Specifically, miR-320 and miR-21 can participate in ischemia-reperfusion injury by targeting corresponding genes [27, 28]. [score:3]
In addition, many miRNAs showed overexpression in DM rats, including miR-320, miR-291-5P, miR-129, etc. [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 5
Three miRNA RNA-immunoprecipitated in GW/P bodies were predicted to regulate VHL (von Hippel-Lindau tumor suppressor) and include miR-320, miR-368 and miR-143 and one miRNA RNA-immunoprecipitated in GW/P bodies was predicted to regulate ODF2 (outer dense fiber of sperm tails 2), KIF3Aand VHL and include miR-154. [score:5]
[1 to 20 of 1 sentences]
64
[+] score: 5
By analysis of the global expression profile of miRNAs in primary breast cancer and normal adjacent tumor tissues (NATs), Yan et al. showed that seven miRNAs (miR-497, miR-31, miR-355, miR-320, mir-140, miR-127, and miR-30a-3p) were downregulated more than twofold in BC tissue compared with normal adjacent tissues [14]. [score:5]
[1 to 20 of 1 sentences]
65
[+] score: 5
For miR-33 and miR-320, we found strong associations between miRNA expression and genomic alterations (p < 0.001), suggesting chromosomal change is a possible mechanism for mis -expression of these genes in primary human breast cancers. [score:5]
[1 to 20 of 1 sentences]
66
[+] score: 5
Kaplan-Meier survival curves showed that patients who had stage II CRC tumors with high expression of miR-320 or miR-498 had significantly shorter progression-free survival than did patients whose tumors showed low expression. [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 5
The miRNA expression databases further show that miR-214-3p, miR-212-5p, miR-204-3p, miR-362-3p, miR-450a and miR-320 are expressed in the brain. [score:5]
[1 to 20 of 1 sentences]
68
[+] score: 5
Downregulation of selected miRNAs induced by C. parvum, including miR-98, miR-320 and miR-424, was further confirmed by bead -based multiplexed miRNA expression assay using the FlexmiR™ Select kit (Figure 2D). [score:5]
[1 to 20 of 1 sentences]
69
[+] score: 5
In insulin resistant 3T3-L1 adipocytes, approximately 80 miRNAs have been found to be up- or downregulated [8], while miR-320 and miR-29 have been demonstrated to regulate insulin action through the PI3K/AKT pathway [5, 8]. [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 5
Five of the miRNAs (miR-320c, miR-320d, miR-365a-3p, miR-494, and miR-1305) did not have detectable expression when using the platform. [score:3]
In evaluating early passage MSCs (13 cell lines) against the 4 cell lines of the mesoderm lineage, 5 miRNAs (miR-15b-5p, miR-25-3p, miR-320d, miR-324-3p, and miR-494-3p) were observed to be significantly upregulated (p < 0.05) in the non-MSC lines. [score:2]
[1 to 20 of 2 sentences]
71
[+] score: 5
Several researchers had reported that, by targeting β-catenin, miR-320 suppresses the proliferation of colon cancer cells [58] and has potential as a prognostic biomarker for colorectal cancer [59]. [score:5]
[1 to 20 of 1 sentences]
72
[+] score: 5
PSD95 is a high-ranking target of miR-125, miR-135, miR-320, and miR-327, all of which are either exclusively expressed in brain or enriched in brain tissue (Lagos-Quintana et al. 2002; Krichevsky et al. 2003; Sempere et al. 2004). [score:5]
[1 to 20 of 1 sentences]
73
[+] score: 5
Conversely, miR-320 is down-regulated after ischemia-reperfusion injury. [score:4]
Gain- and loss-of-function studies demonstrated that miR-320 promotes cardiomyocyte apoptosis via maintaining HSP20 levels [41]. [score:1]
[1 to 20 of 2 sentences]
74
[+] score: 4
miR-320 is an anti-angiogenic factor that inhibits endothelial cell growth and migration 51. [score:3]
However, miR-320a, along with other members of the miR-320 family (miR-320b, -320c, and -320d) increased in abundance during infection. [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 4
Figure 4SRF is a target of miR-320. [score:3]
Since hsa-miR-320 participates in cardiac ischemia/reperfusion injury and lipid/glucose metabolism 7, 28, 29. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 4
One of our largest homology groups was composed of the miRNA-320 paralogs (Fig 11). [score:1]
Blastn results for miR-320 paralogs. [score:1]
miR-320. [score:1]
Phylogenetic tree of the predicted pre-miRNAs of the miR-320 family, based on experimentally determined mature sequences. [score:1]
[1 to 20 of 4 sentences]
77
[+] score: 4
The expression of miR-320, miR-489, miR-572 and miR-663a were further compared between 10 μM fluoxetine (6 wells each) treated SK-N-SH and SH-SY5Y cells and their control cells. [score:2]
Confirmation qPCR experimental data with four miRNAs (miR-320, miR-489, miR-572 and miR-663a) of SK-N-SH cells with 10-μM Fluoxetine and equal concentration of DMSO control. [score:1]
Confirmation qPCR experimental data with four miRNAs (miR-320, miR-489, miR-572 and miR-663a) of SH-SY5Y cells with 10-μM Fluoxetine and equal concentration of DMSO control. [score:1]
[1 to 20 of 3 sentences]
78
[+] score: 4
Among others, such as hsa-miR-191, hsa-miR-200b, hsa-miR-320 and several members of let-7 family we found that hsa-miR-342-3p was regulated at a late stage of disease in both, Scrapie-infected mice and BSE-infected macaques. [score:4]
[1 to 20 of 1 sentences]
79
[+] score: 4
Furthermore, another cell-cycle associated miRNA, miR-320 [36], was down-regulated (~1.8 fold, P = 1.1e-2) in HCV+ samples. [score:4]
[1 to 20 of 1 sentences]
80
[+] score: 4
Kim et al. [14] reported the cis-regulatory role of miR-320 in targeting its own genomic location, which resulted in transcriptional silencing of an adjacent downstream gene, POLR3D through an AGO1 -dependent mechanism. [score:4]
[1 to 20 of 1 sentences]
81
[+] score: 4
However, similar statistical trend was not observed between MiR-9-1, miR-320d and cancer subtype. [score:1]
MiR-9-1, miR-320d, miR-125-3p, and miR-320c were the only four miRNAs that could be stably amplified. [score:1]
In this follow up study, we selected nine miRNA candidates (miR-125-3p, miR-320c, miR-320d, miR-9-1, miR-139, miR-125a-5p, miR-4792, miR-376, miR-543, miRNA-381) for validation in the independently recruited patients with early-stage (I, II) colon cancer. [score:1]
MiR-9-1, miR-125a-3p, miR-125a-5p, miR-320c, miR-320d, miR-4792, miR-376, miR-139, miR-543, and miR-381(MS00010752, MS00008554, MS00003423, MS00041867, MS00031710, MS00045087, MS00007392, MS00003493, MS00010080, MS00004116, QIAGEN, Valencia, CA) were selected for downstream validation. [score:1]
[1 to 20 of 4 sentences]
82
[+] score: 4
miRNA profiling of 80 type 2 diabetic patients compared with age and gender matched controls showed overexpression of miR-28-3p and underexpression of 12 miRNAs (miR-223, miR-320, miR-486, miR-150, miR-24, miR-21, miR-29b, miR-20b, miR-15a, miR-126, miR-191, and miR-197). [score:4]
[1 to 20 of 1 sentences]
83
[+] score: 4
In reticulocytes, miR-320 was shown to regulate the expression of the transferrin receptor CD71 [16]. [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
In addition, miR-320 regulates insulin resistance in adipocytes 35; miR-140 promotes adipogenesis 36 and miR-483-3p inhibits 3T3-L1 adipogenesis and gradually decreases during differentiation 22. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 3
The presence of blastocyst induces the expression of miR-320 and let-7a in the rat uterus during the implantation window [16], [17]. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
Only four miRNA families were expressed at a minimum of 10 reads/million mapped: miR-145, miR-101, miR-320, and miR-30 (Fig. 1 a). [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
Alveolar macrophages possessed the highest number of highly expressed miRNAs than the other cell types and included miR-92, miR-223, miR-191, miR-30a-5p, miR-320, miR-342, miR-146b and miR-142-3p. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
Next, to further explore the functions of these miRNAs in HCC, we selected miRNAs with a fold change >5, namely hsa-miR-636, hsa-miR-671, hsa-miR-489, hsa-miR-26a, hsa-miR-320, hsa-miR-628, hsa-miR-505, hsa-miR-100, hsa-miR-664, hsa-miR-942, hsa-miR-192, hsa-miR-99b, hsa-miR-125b, hsa-miR-10b, hsa-miR-30b, and hsa-miR-145, for GO (Gene Ontology) enrichment analysis [21] of their target genes using the web -based software WebGestalt 2.0 [22]. [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
Wu PY Zhang XD Zhu J Guo XY Wang JF Low expression of microRNA-146b-5p and microRNA-320d predicts poor outcome of large B-cell lymphoma treated with cyclophosphamide, doxorubicin, vincristine, and prednisoneHum. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
We found that, regardless of the infection, 270 of 2,600 detectable miRNAs were expressed in at least 50% of analyzed samples (Table S1 in), and the most represented miRNA families were let-7, miR-17, miR-30, and miR-320 (Table S2 in). [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
Among these 54 miRNAs, miR-16, miR-20a, miR-20b, let-7b, miR-17-5p, miR-27a, miR-106a, miR-106b, miR-107, miR-193a, miR-210, miR-320, and miR-361 were predicted to target VEGF. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
miRNA BN BC Fold change mir-200b 22.8 (1) 27122.2 (2325) 1189.6 mir-200c 45.5 (2) 44072.2 (3778) 968.6 mir-21 22.8 (1) 15363.4 (1317) 673.8 mir-378 68944.3 (3027) 466.6 (40) -147.8 let-7a 2186.5 (96) 50313.2 (4313) 23.0 mir-320 136180.4 (5979) 19376.4 (1661) -7.0 mir-23a 11319.9 (497) 44748.8 (3836) 4.0 mir-22 25646.3 (1126) 7150.9 (613) -3.6 MiRNAs significantly differentially expressed in normal breast (BN) and breast cancer (BC) samples, with False Discovery Rate of 0.05. [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
As an example, exosomes from diabetic cardiomyocytes reportedly inhibited endothelial cell (EC) survival and angiogenesis by the transfer of miRNA-320. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Six miRNAs were altered in expression due to exhaustive exercise in controls, namely hsa-miR-1260, hsa-miR-27a, hsa-miR-30e, hsa-miR-320c, hsa-miR-320d, and hsa-miR-320e. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
For example, miR-320 and miR-702 target p21 and p57 [76]. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
The grey rectangle evidences the association to mir-320 -RNASEN(1) with histological normal samples Figure 4 Table of biclustering results. [score:1]
The data showed an exclusive association between these samples and the miRNA cluster sf-hsa-miR-320 -RNASEN (green rectangle on Figure 3 and Figure 4). [score:1]
The grey rectangle evidences the association to mir-320 -RNASEN(1) with histological normal samples Figure 4 Table of biclustering results. [score:1]
[1 to 20 of 3 sentences]
97
[+] score: 3
miR-320 could be a novel diagnosis and treatment target in renal ischemic reperfusion injury [19]. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
Spearman correlation was applied to assess the correlation between miR-320 a and MTDH expression. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
In addition, MMP9 was directly declined by miR-320 via its 3′ UTR target sequences as assessed by luciferase reporter gene assays [34]. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-30c-2, hsa-mir-199a-2, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-141, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-149, hsa-mir-150, hsa-mir-320a, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-379, hsa-mir-423, hsa-mir-451a, hsa-mir-486-1, hsa-mir-496, hsa-mir-520a, hsa-mir-525, hsa-mir-518b, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, bta-mir-26a-2, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-20a, bta-mir-21, bta-mir-27a, bta-mir-320a-2, bta-mir-125a, bta-mir-125b-1, bta-mir-199a-1, bta-mir-31, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-150, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, hsa-mir-1249, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-141, bta-mir-152, bta-mir-16a, bta-mir-24-1, bta-mir-199a-2, bta-mir-223, bta-mir-26a-1, bta-mir-379, bta-mir-451, bta-mir-486, bta-mir-496, bta-mir-92a-1, bta-mir-92b, bta-mir-1249, bta-mir-320b, bta-mir-320a-1, hsa-mir-320e, hsa-mir-23c, hsa-mir-451b, bta-mir-149, hsa-mir-486-2
In sheep, miR-30c, miR-132, miR-379, miR-199a-3p and miR-320 are differentially expressed in serum on Days 30 or 60 of pregnancy [27]. [score:3]
[1 to 20 of 1 sentences]