sort by

19 publications mentioning cel-mir-58b

Open access articles that are associated with the species Caenorhabditis elegans and mention the gene name mir-58b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 240
In the TGF-β Dauer pathway, the miR-58 family targets receptors DAF-1 and DAF-4. This inhibition shall inactive DAF-14/DAF-8 dimers, which will allow the activation of downstream antagonistic DAF-3. Through DAF-3, DAF-8 and DAF-7 will be transcriptionally downregulated and therefore dauer entry will be promoted. [score:8]
org, Target Scan, PICTAR, mirWip, Diana Lab, RNA22 and mirSom) rendered three putative miR-58 target genes belonging to the TGF-β Sma/Mab pathway: dbl-1, daf-4 and sma-6. Genes daf-1 and daf-7 –apart from daf-4– all of the TGF-β Dauer pathway, also became predicted targets of miR-58. [score:7]
Role of mir-58 family in dauer formationOur finding that the TGF-β Dauer pathway, which represses dauer formation, is upregulated in mir-58f(-) opens up the question of whether it is that upregulation what makes the mir-58f(-) strain dauer defective. [score:7]
More importantly, no significant variation of the levels of miR-58 family members were detected in L1 larvae when the TGF-β Dauer pathway was either downregulated (in daf-1(m213) and daf-4(m63) backgrounds) or upregulated (with daf-3(ok3610) and P [daf-8]::daf-8::gfp; Supplementary Figure S2). [score:7]
Finally, the 3′UTR of daf-7 seemed unable to inhibit luciferase gene expression through any of the miRNAs (Figure 2), with the possible exception of miR-58, because of a small but statistically significant difference with respect to control miR-67. [score:5]
In the Sma/Mab branch, this inhibition goes through ligand DBL-1 and receptor proteins SMA-6 and DAF-4. Therefore, miR-58 family activity is growth -inhibitory through Sma/Mab. [score:5]
The 3′UTR of sma-6 could also inhibit luciferase expression with any of the miR-58 family members tested. [score:5]
On the other hand, miR-81 is much less expressed than miR-58 and -80 (21), and then this may restrict its potential to act as a dauer inhibitor in the company of the other members of the family. [score:5]
In vivo assays of 3′UTR inhibitory activity confirm that genes of the TGF-β Sma/Mab and Dauer pathways are regulated by miR-58 familyWith the possible exception of daf-7, all the other assayed TGF-β genes (dbl-1, sma-6, daf-4 and daf-1) have shown, according to qPCR and luciferase experiments, some degree of downregulation by mir-58 or other members of its family. [score:5]
Transcriptional regulation of P [miR-58]EUB0032 P [mir-58]::gfp was crossed with NU3 dbl-1(nk3), RB1739 sma-10(ok2224), RB2589 daf-3(ok3610), DR609 daf-1(m213) and DR63 daf-4(m63) to test whether the inhibition of the TGF-β pathways may regulate the activity of P [mir-58]. [score:5]
mRNA levels of dbl-1, sma-6, daf-4, daf-1 and daf-7 are upregulated in the mir-58 family mutantWe performed quantitative real-time PCR (qPCR) on mir-58f(-), the C. elegans strain missing four of the five miRNAs of the mir-58 family (see Materials and Methods). [score:4]
These results confirm that the absence of TGF-β Sma/Mab downregulates the mir-58 family. [score:4]
mRNA levels of dbl-1, sma-6, daf-4, daf-1 and daf-7 are upregulated in the mir-58 family mutant. [score:4]
EUB0032 P [mir-58]::gfp was crossed with NU3 dbl-1(nk3), RB1739 sma-10(ok2224), RB2589 daf-3(ok3610), DR609 daf-1(m213) and DR63 daf-4(m63) to test whether the inhibition of the TGF-β pathways may regulate the activity of P [mir-58]. [score:4]
TGF-β signalling is upregulated in miR-58 -family defective worms. [score:4]
We conclude that both TGF-β pathways, Sma/Mab and Dauer, are upregulated in the absence of miR-58 family members. [score:4]
We found that the downregulation of TGF-β Dauer receptors DAF-1 and DAF-4 (DAF-4 is shared between both TGF-β pathways) led to a decrease in P [mir-58] activity in L4 (Figure 9B). [score:4]
In consequence, mir-58(-) apparently develops normal and only shows a 20% shorter life span (19), which is surprising considering that miR-58 is the miRNA with the highest (20), or one of the highest levels of expression (21), at every developmental stage and across multiple tissues, with the significant exception of the nervous system (22). [score:4]
Figure 4. TGF-β Sma/Mab pathway activity is upregulated in the mir-58 family mutant. [score:4]
TGF-β Sma/Mab positively regulates mir-58 transcriptionIn Drosophila the Dpp pathway (TGF-β) controls bantam (mir-58 homolog) expression (32– 34). [score:4]
mir-58 family downregulates both TGF-β pathways, Sma/Mab and Dauer. [score:4]
miR-58 family mutants do not enter dauer due to upregulation of TGF-β Dauer pathway. [score:4]
Figure 1. dbl-1, sma-6, daf-4, daf-1 and daf-7 mRNA levels are upregulated in the mir-58 family mutant. [score:4]
Control of TGF-β genes by the mir-58 familyOur gene reporter assays strongly suggest that mir-58f directly downregulates four genes (sma-6, daf-4, daf-1 and dbl-1) from the TGF-β signalling pathways, Sma/Mab and Dauer, in C. elegans (Figures 2 and  3). [score:4]
Also, in support of the above, we know that miR-81, in contrast to miR-58, -80 and -82, is the only one that is not able to rescue the dauer defective phenotype of mir-58f(-) when expressed by itself (5). [score:3]
Figure 9. Deficient TGF-β Sma/Mab and Dauer pathways reduce the expression of mir-58 family. [score:3]
Figure 3. miR-58 family reduces the expression of dbl-1, sma-6, daf-4 and daf-1 through their 3′UTR binding sites in vivo. [score:3]
mir-58(n4640);ctIs40(dbl-1++) animals presented an intermediate size between the shorter mir-58(n4640) and the longer DBL-1 overexpressing worm ctIs40(dbl-1++). [score:3]
In Drosophila the Dpp pathway (TGF-β) controls bantam (mir-58 homolog) expression (32– 34). [score:3]
Therefore, our results do not really support that mir-58 expression depends on TGF-β Dauer pathway activity, although we do not exclude it either. [score:3]
Then we first carried out a computational search looking for miR-58 targets related to these two pathways. [score:3]
With the possible exception of daf-7, all the other assayed TGF-β genes (dbl-1, sma-6, daf-4 and daf-1) have shown, according to qPCR and luciferase experiments, some degree of downregulation by mir-58 or other members of its family. [score:3]
In vivo assays of 3′UTR inhibitory activity confirm that genes of the TGF-β Sma/Mab and Dauer pathways are regulated by miR-58 family. [score:3]
Searching their data set, we found that miR-58, -80, -81 and -82, they all bind to a region in chromosome III that corresponds to the daf-4 3′UTR, and that perfectly match two of the three sites that we identified as target regions of miR-58 family (Supplementary Table S5). [score:3]
These tissue-specificity patterns of expression suggest that cel-miR-58 members could have redundant as well as divergent functions. [score:3]
Perhaps the overexpression of dbl-1(++) that we used exceeds what may be physiological in the wild-type, and that is why the miR-58/-80 promoters do not have a natural response for it. [score:3]
Our hypothesis was that the mir-58 family could regulate body size and dauer response through TGF-β Sma/Mab and TGF-β Dauer pathways, respectively. [score:2]
Our results showed that the double mutant mir-58(n4640);dbl-1(nk3) was significantly shorter than worms with either mutation alone (P < 0.001; Table 1). [score:2]
To check how the increase of Sma/Mab signalling affects P [mir-58] regulation, we microinjected the fosmid WRM0624CB02, which carries the dbl-1 gene, together with other DNAs (see Supplementary Table S4 for transgene details and concentrations) into EUB0032. [score:2]
In contrast, single or double mir-58- family deletions do not result in obvious developmental defects. [score:2]
When the three deletions were present the length reduction was even larger (P < 0.001 with respect to mir-58(n4640) alone or together with any of the other two mutations). [score:2]
Transcriptional regulation of P [miR-58]. [score:2]
And in humans, differentiation of smooth muscle cells is stimulated by TGF-β1's direct control over miR-143/145 transcription (65), which is a putative homologue of miR-58 (21). [score:2]
What our results suggest is that perhaps these other systems may conserve still undiscovered mechanisms of TGF-β regulation by the corresponding miR-58 orthologs. [score:2]
In order to confirm a direct regulation of those four genes by the miR-58 family, we performed in vivo assays. [score:2]
We here ask whether the miR-58 family could regulate one or both pathways in C. elegans. [score:2]
Additionally, TGF-β Sma/Mab positively regulates the transcription of mir-58 and mir-80, thus creating a negative feedback loop. [score:2]
Mo del for regulation of growth and dauer by miR-58 family. [score:2]
Luciferase reporter assays suggest that miR-58 family members directly regulate TGF-β genes. [score:2]
Worms homozygous for null mutations at several genes of this pathway show a Sma phenotype, that is, they are dwarfed, similar in length to worms defective in the mir-58 family (6). [score:2]
Figure 2. Luciferase reporter assays show that miR-58 family members effectively repress gene expression through the 3′UTRs of TGF-β genes. [score:2]
However, no P [mir-58] increase occurred when the negative regulator daf-3(ok3610) was tested (Figure 9B) (15). [score:2]
We also find a positive regulation of mir-58 transcription by TGF-β. [score:2]
TGF-β Sma/Mab positively regulates mir-58 transcription. [score:2]
This led us to ask whether TGF-β Sma/Mab and/or TGF-β Dauer may regulate mir-58 transcription. [score:2]
In this work, we primarily focus on the relationship between the mir-58 family and TGF-β, Sma/Mab and Dauer, in C. elegans. [score:1]
Figure 5. TGF-β Dauer pathway is activated in the mir-58 family mutant. [score:1]
Human HeLa cells were transiently transfected with psiCHECK-2 vector containing either wild-type (white) or mutated (grey) 3′UTRs from TGF-β genes dbl-1, sma-6, daf-4, daf-1 and daf-7, along with miR-58 family mimics of miR-58, miR-80, miR-81 and miR-1834, or the unrelated miR-67 as negative control. [score:1]
For estimating TGF-β Dauer pathway activity in mir-58 mutants, we used daf-7 and daf-8 that are known to respond positively to this pathway (45). [score:1]
All these miRNAs belong to the mir-58 family, having small differences among themselves (miR-81 and -82 differ only in one nucleotide, and therefore we only used miR-81). [score:1]
Apparently, the 3′UTRs of daf-1 and daf-4 are the most efficiently mediators of genetic repression by the miR-58 family, as their means were the lowest for any tested miRNA. [score:1]
Figure 7. daf-1 is epistatic to mir-58 family for the dauer -deficient phenotype. [score:1]
With the exception of daf-7 3′UTR, we confirmed that all the members of miR-58 family (including the uncharacterized miR-1834), but not our negative control miR-67, strongly reduced the expression of the luciferase when placed in front of dbl-1, sma-6, daf-4 and daf-1 3′UTRs (white bars in Figure 2). [score:1]
We conclude that miR-58 is the miRNA that contributes the most on body size, followed by miR-80 and the tandem miR-81/-82 (in that order). [score:1]
Our system appears transcriptional because of our results with a P [mir-58]::gfp reporter (Figure 9B). [score:1]
As a first attempt to understand the relative importance of the various organs in relation to body size we performed rescue experiments using promoters specific of two of the tissues where miR-58 is present, gut and hypodermis, in mir-58f(-) worms. [score:1]
Role of mir-58 family in dauer formation. [score:1]
This is what we have done for the mir-58 family (or mir-58f), by using the strain MT15563 (mir-58f(-)), a C. elegans strain missing four members of that family: mir-58, -80, -81 and -82 (5). [score:1]
As described by Alvarez-Saavedra and Horvitz (5), the mir-58 family mutant presents a highly reduced body size, similar in length to TGF-β Sma/Mab depleted animals. [score:1]
We did not observe luciferase repression in the case of miR-58. [score:1]
To tackle this issue we first aimed to study how each of the mir-58 family members contributes to adult body size. [score:1]
All the four wild-type 3′UTR tested, dbl-1, sma-6, daf-4 and daf-1, rendered more mCherry activity in a mir-58f(-) background than in N2, suggesting that miR-58 -family members effectively bind to TGF-β 3′UTRs (Figure 3A and  C). [score:1]
According to some reports several human mir-58 orthologs also exist, although this is not firmly established (21, 26, 27). [score:1]
What should be the functional consequences of a negative feedback loop between TGF-β Sma/Mab and miR-58 in C. elegans? [score:1]
This family is made of five members, mir-58 (chromosome IV), mir-80 (III), mir-81 and mir-82 (approximately 4 kb apart from each other in chromosome X), and mir-1834, although this last one has not been fully validated as a functional miRNA (chromosome IV; >3 Mb apart from mir-58) (18). [score:1]
Using the same two previous approaches, we assessed the transcriptional levels of mir-58 in the context of TGF-β Dauer pathway. [score:1]
mir-58 family affects body size differently and independently of TGF-β Sma/Mab. [score:1]
We then asked whether double mutants for the TGF-β Sma/Mab pathway and the miR-58 family, both of a similar length on their own, would reach a similar size or become even smaller. [score:1]
Several independent transgenic lines generated in the wild-type background were repeatedly backcrossed to MT15563, to test whether the TGF-β Sma/Mab signalling is up or down in the mir-58 family mutant with respect to N2. [score:1]
Moreover, the miRNA posttranscriptional control involves the presence of Smad binding elements (SBE) in the premature sequence of miRNAs, and we have not found any SBE in the corresponding sequences of the mir-58 family. [score:1]
There are mir-58 orthologs in other invertebrates, like Drosophila, where it is known as bantam (24, 25). [score:1]
Cells were transfected in triplicate 24/48 h later with Lipofectamine 2000 (Invitrogen), 150 ng of a 3′UTR luciferase vector (see below), and 50 nmol of test miRNA mimic (miR-58, miR-80, miR-81 and miR-1834; miRIDIAN, Dharmacon) or the standard control miRNA mimic miR-67 provided by the manufacturer. [score:1]
Control of adult growth by mir-58 familyThe most striking and recognizable feature of mir-58f(-) worms is their small body size (5). [score:1]
In relation to the overall effect on growth of each miR-58 family member, we have shown that their contribution to body length is highest for miR-58, intermediate for miR-80 and lowest for miR-81 & -82 (Table 1). [score:1]
We performed quantitative real-time PCR (qPCR) on mir-58f(-), the C. elegans strain missing four of the five miRNAs of the mir-58 family (see Materials and Methods). [score:1]
We have shown that not only mir-58f negatively controls TGF-β Sma/Mab, but also that this pathway stimulates the transcription of mir-58 and mir-80. [score:1]
miR-58 family influences body size both dependent and independently of TGF-β Sma/Mab signalling pathway. [score:1]
What else do we know about the mir-58 family apart from the fact that its absence leads to a small and dauer-defective mutant? [score:1]
One of the aberrant family strains was a quadruple mutant for the cel-mir-58 family, which had small body size and was dauer defective. [score:1]
That is why we ligated the 3′UTR of each candidate gene to a plasmid downstream a luciferase coding sequence, and later transfected them into mammalian cell cultures together with synthetic miR-58, -80, -81 or -1834. [score:1]
Figure 8. sod-3, daf-16, ins-1 and ins-17 mRNAs are elevated in mir-58 family mutants. [score:1]
We conclude that the effect of the miR-58 family on body size is at least partly independent of TGF-β Sma/Mab pathway. [score:1]
In summary, the miR-58 family modulates both TGF-β routes, acting as a new hub that may coordinate growth and dauer decisions. [score:1]
Additionally, we used a P [mir-58]::gfp reporter to assess its transcriptional activity in various TGF-β altered backgrounds (Figure 9B). [score:1]
The control over mir-58 and mir-80 could be transcriptional or posttranscriptional. [score:1]
Figure 9A shows the levels of miR-58, miR-80 and miR-82 in dbl-1(++) and dbl-1(nk3) relative to N2, in synchronized L4 worms. [score:1]
However, mir-58(n4640) showed such a reduction (P < 0.001), which was even more pronounced in the company of mir-80(nDf53) (P < 0.001) but not of mir-81&mir-82(nDf54) (P = 0.2). [score:1]
[b]Referred to the length of mir-58(n4640);mir-80(nDf53);mir-81&mir-82(nDf54) treated with RNAi empty vector. [score:1]
We find that various genes from both TGF-β pathways are controlled by the mir-58 family. [score:1]
We detected a significant difference between N2 and dbl-1(nk3) at miR-58 (P = 0.001) and miR-80 (P = 0.007), but not at miR-82 (P = 0.078). [score:1]
Wild-type C. elegans N2 strain (Bristol) and the following mutant strains were obtained from Caenorhabditis Genetics Centre (CGC): BW1940 ctIs40 X [ZC421 (dbl-1(+)) + pTG96(sur-5::gfp)], CB1370 daf-2(e1370) III, DR63 daf-4(m63) III, DR609 daf-1(m213) IV, LT186 sma-6(wk7) II, MT13949 mir-80(nDf53) III, MT13954 mir-81&mir-82(nDf54) X, MT15024 mir-58(n4640) IV, MT15563 mir-80(nDf53) III; mir-58(n4640) IV; mir-81&mir-82(nDf54) X, NU3 dbl-1(nk3) V, RB1739 sma-10(ok2224) IV, and RB2589 daf-3(ok3610) X. DR2490 mIs27 [P [daf-8]::daf-8::gfp, rol-6(su1006)], EUB0032 P [mir-58]::gfp and pwIs922 [P [vha-6]::daf-4::gfp] were kindly provided by Drs D. Riddle, M. Isik and R. Padgett, respectively. [score:1]
Then, we checked whether mir-58(-) nematodes also have a proliferation defect, but actually these mutants contain the same number of hypodermal nuclei at adulthood as N2 do (Supplementary Figure S4). [score:1]
As previously mentioned, bantam is the sole mir-58 Drosophila ortholog, and the correspondent loss-of-function flies are small because of a reduction in cell number but not cell size (24, 28). [score:1]
Therefore, we suspect that miR-58 acts on body size through a combination of tissues. [score:1]
Control of TGF-β genes by the mir-58 family. [score:1]
Control of adult growth by mir-58 family. [score:1]
[1 to 20 of 106 sentences]
2
[+] score: 192
Taken together with our data, these reported expression data on the miR-58/80-82 family suggest that the tissue-specific expression of PMK-2 is a consequence of distinct tissue -expression patterns of the corresponding microRNAs that target pmk-2. MicroRNAs have been implicated to function both as a backup to reinforce transcriptional gene programs and as an instructive signal to shape gene expression patterns [22]. [score:11]
The switch-like “off” state of PMK-2 expression imposed by the miR-58/80-82 family in non-neuronal tissues in regulating the spatial expression of PMK-2 is reminiscent of the magnitude of target repression exhibited by lin-4 and let-7 microRNAs in the temporal control of developmental timing [2, 32]. [score:9]
Green fluorescent protein was engineered onto the C-terminal end of PMK-2. The red fluorescent protein mCherry was engineered onto the C-terminal end of PMK-1. (B-D) Confocal fluorescence microscopy of a representative wild type worm carrying the pmk operon translational reporter (B), a wild type worm carrying a mutated pmk operon translational reporter with specific mutations (indicated in Fig. 4A) engineered into the second and third miR-58 family seed match sites in the 3’UTR of pmk-2 (C), and a mir-80; mir-58; mir-81-82 mutant worm carrying the pmk operon translational reporter (D). [score:8]
We determined that the tissue-specific expression of PMK-2 is dependent on cis-regulatory sequences found within its 3’UTR and demonstrated that the miR-58/80-82 family is required to switch off expression of PMK-2 in non-neuronal tissues post-transcriptionally, thereby establishing its tissue-specific expression in C. elegans. [score:8]
We speculate that the defects in size, locomotion, and egg-laying behavior observed in the mir-58; mir-80; mir-81-82 mutant are due to the cumulative misexpression of miR-58/80-82 target genes in non-neuronal tissues, as pmk-2 loss-of-function alone cannot suppress these defects (D. J. P. and D. H. K., unpublished observations). [score:7]
To determine the spatial effect on expression of releasing pmk-2 from regulation by the miR-58/80-82 family, we engineered a new pmk operon translational reporter, qdEx102, which carries mutations in the second and third miR-58/80-82 seed match sites [20] in the 3’UTR of pmk-2 (Fig. 4A). [score:7]
Promoter and enhancer elements commonly direct tissue-specific gene expression in animals, and thus a role for miR-58 family -mediated post-transcriptional regulation in establishing the tissue expression pattern of pmk-2 might be somewhat unexpected. [score:7]
The broad and constitutive expression of mir-58/80-82 suggests a more general housekeeping role for this microRNA family in the establishment and maintenance of tissue-specific gene expression by repressing the expression of neuronal-specific genes in non-neuronal tissues. [score:7]
The miR-58 family restricts expression of PMK-2 in C. elegans We next sought to define the cis-regulatory determinants of the pmk-2 3’UTR that function to repress PMK-2 expression. [score:6]
In contrast to the highly selective expression and function of the lsy-6 microRNA in a pair of chemosensory neurons, the miR-58 family functions in a large number of cells and tissues to restrict expression of PMK-2 in non-neuronal tissues at all developmental stages. [score:6]
Our data on the regulation of PMK-2 tissue expression by the miR-58 family provide genetic evidence for this hypothesis and point to a more general role for the highly abundant miR-58 family in the maintenance of tissue-specific gene expression. [score:6]
Tissue-specific expression of PMK-2 is established by the miR-58 family, which switches off expression of PMK-2 in non-neuronal tissues. [score:5]
Our data suggest a housekeeping role for the miR-58/80-82 family in establishing and maintaining neuronal patterns of gene expression in C. elegans, and supports a more general role for microRNAs in establishing patterns of tissue expression. [score:5]
We show nonoverlapping expression of PMK-2 and miR-58/80-82, established not by the promoter of these genes, but rather complete destabilization of pmk-2 mRNA by miR-58/80-82, suggesting that the activity of microRNAs can define specific patterns of gene expression in different cell types. [score:5]
While the pmk-2 gene is broadly transcribed, its tissue-specific expression is established by the redundant activities of miR-58, miR-80, miR-81, and miR-82, which switch off expression of PMK-2 through destabilization of pmk-2 mRNA in non-neuronal tissues. [score:5]
Our data on the tissue-specific genetic redundancy of p38 MAPK signaling in C. elegans define a role for the relatively abundant and constitutively expressed miR-58/80-82 family of microRNAs in establishing the tissue-specific expression of PMK-2 p38 MAPK. [score:5]
In this paper, we show that the miR-58/80-82 family of microRNAs, which accounts for roughly half of all C. elegans microRNAs at all developmental stages, defines the spatial expression pattern of PMK-2 p38 MAPK. [score:4]
Additionally, these data are consistent with the tissues that misexpress PMK-2 when miR-58/80-82 regulation is disabled (Fig. 2C-2D). [score:4]
The tissues in which these microRNAs are reportedly present are consistent with the absence of PMK-2 expression we observe in these tissues when miR-58/80-82 regulation is intact (Fig. 2B). [score:4]
Expression of PMK-2 in the distal tip cell and spermatheca, which was faint and diffuse with miR-58/80-82 regulation intact (Fig. 2B), was markedly elevated (Fig. 2C). [score:4]
The abundance of miR-58, along with the presence of multiple miR-58 binding sites in the 3’UTR of pmk-2, may contribute to the large increase of pmk-2 mRNA and protein levels when miR-58 family regulation is inhibited. [score:4]
A single microRNA, miR-58, constitutes nearly half of all microRNAs in C. elegans, with constitutive expression in non-neuronal tissues through all developmental stages [7, 8]. [score:4]
Differential RNA binding protein (RBP) immunoprecipitation with subsequent mRNA and protein quantification analyses (RIP-chip-SRM) has indicated the presence of hundreds of miR-58 targets [9]. [score:3]
The miR-58 family restricts expression of PMK-2 in C. elegans. [score:3]
mir-58 was inferred to be expressed in the intestine, hypodermis, pharynx, spermatheca, excretory canal, and excretory cell soma [8]. [score:3]
Similar misexpression of pmk-2 was observed when we crossed qdEx101 (pmk operon reporter with miR-58/80-82 seed match sites intact) into the mir-80; mir-58; mir-81-82 mutant (Fig. 2D). [score:3]
Supporting this hypothesis is the genome-wide analysis of tissue-specific gene expression in C. elegans, which revealed enrichment for miR-58 binding sites among neuronal genes [33]. [score:3]
Expression of mir-58 was not observed in the nervous system. [score:3]
Considering this and the lack of PMK-2 protein observed in non-neuronal tissues when miR-58 targeting is intact (i. e. wild type conditions), the magnitude of PMK-2 repression in non-neuronal tissues is likely much greater than six-fold. [score:3]
Mutants carrying deletions in mir-58, mir-80, and mir-81-82 [5] were used to assess whether the miR-58/80-82 family functions to repress the expression of pmk-2. Loss of any individual mir-58/80-82 family member had no effect on pmk-2 mRNA levels relative to wild type (Fig. 4B). [score:3]
Our data suggest a role for the relatively abundant miR-58 microRNA in the establishment of tissue-specific gene expression in C. elegans. [score:3]
These data suggest that the miR-58/80-82 family of microRNAs restricts expression of PMK-2 p38 MAPK through the post-transcriptional destabilization of pmk-2 mRNA in non-neuronal tissues (Fig. 4D). [score:3]
miR-58/80-82 seed match sites were identified using TargetScan [42]. [score:3]
The miR-58/80-82 family of microRNAs functions redundantly to restrict expression of PMK-2 to the nervous system. [score:3]
To confirm that a frameshift in the first exon of pmk-2 results in a null allele, the qd284 mutation was crossed into the mir-80; mir-58; mir-81-82 mutant and levels of activated PMK-2 protein were determined. [score:2]
Strain MT15563, carrying mutations in mir-58,80-82, grew slower than the other strains and therefore was harvested ~10 hr after the wild type strain. [score:2]
The following mutations were used in this study:LGI: kyIs140[str-2:: GFP, lin-15(+)] LGIII: agIs219[P [T24B8.5]:: GFP, P [ttx-3]:: GFP], tir-1(qd4), mir-80(nDf53) LGIV: mir-58(n4640), pmk-2(qd284), pmk-2(qd307), pmk-2(qd287), pmk-2(qd279), pmk-2(qd280), pmk-2(qd305), pmk-2(qd171), pmk-1(km25) LGX: mir-81-82(nDf54), sek-1(km4), nIs145[P [tph-1]:: GFP, lin-15(+)] Extrachromosomal arrays: qdEx101[P [operon]:: islo-1:: pmk-3:: pmk-2:: GFP:: pmk-1:: mCherry], qdEx102[P [operon]:: islo-1:: pmk-3:: pmk-2 [mut]:: GFP:: pmk-1:: mCherry] A list of all strains used in this study is provided in the (S1 Table). [score:2]
We examined the truncated region for cis-regulatory elements conserved among Caenorhabditis species and identified three seed match sites for the miR-58/80-82 family of microRNAs residing in this region absent from the 3’UTR of pmk-2 mRNA in the pmk-2(qd171) pmk-1(km25) mutant (Fig. 4A). [score:2]
The following mutations were used in this study: LGI: kyIs140[str-2:: GFP, lin-15(+)] LGIII: agIs219[P [T24B8.5]:: GFP, P [ttx-3]:: GFP], tir-1(qd4), mir-80(nDf53) LGIV: mir-58(n4640), pmk-2(qd284), pmk-2(qd307), pmk-2(qd287), pmk-2(qd279), pmk-2(qd280), pmk-2(qd305), pmk-2(qd171), pmk-1(km25) LGX: mir-81-82(nDf54), sek-1(km4), nIs145[P [tph-1]:: GFP, lin-15(+)] Extrachromosomal arrays: qdEx101[P [operon]:: islo-1:: pmk-3:: pmk-2:: GFP:: pmk-1:: mCherry], qdEx102[P [operon]:: islo-1:: pmk-3:: pmk-2 [mut]:: GFP:: pmk-1:: mCherry] A list of all strains used in this study is provided in the (S1 Table). [score:2]
Activated PMK-2 protein was not detected in the mir-80; mir-58 pmk-2(qd284); mir-81-82 mutant, indicating that these mutations are null (S2 Fig. ). [score:2]
The systematic identification of microRNAs of C. elegans by deep sequencing determined that miR-58 is the most abundant microRNA, accounting for nearly half of all microRNAs present in C. elegans at all developmental stages [7]. [score:2]
The miR-58/80-82 family consists of miR-58, miR-80, miR-81, miR-82, and miR-1834. [score:1]
These miR-58/80-82 seed match sites are also absent in the pmk-2(qd305) mutant (S1A Fig. ). [score:1]
These data suggest that the miR-58/80-82 family acts redundantly to destabilize pmk-2 mRNA. [score:1]
In addition, our data corroborate prior phenotypic analysis suggestive of redundancy among members of the miR-58 family [5, 6], demonstrating redundant roles for miR-58, miR-80, miR-81, and miR-82 in the destabilization of pmk-2 mRNA and corresponding repression of activated PMK-2 protein levels. [score:1]
For experiments with mir-58/80-82 family microRNA deletion strains (Fig. 4C and S2 Fig. ) and pmk-2(qd305) (S1C Fig. ), hypochlorite-synchronized populations of L4 larval worms were used for Western analysis. [score:1]
Bold font, miR-58/80-82 family seed match site. [score:1]
However, loss of both mir-58 and mir-80 resulted in a 3-fold increase in pmk-2 mRNA levels relative to wild type, and loss of mir-58/80-82 led to an even further increase in pmk-2 mRNA to a level 6.3-fold greater than wild type (Fig. 4B), without altering levels of pmk-3 mRNA. [score:1]
miR-58/80-82 seed match sites are annotated. [score:1]
Corroborating the mRNA analysis, we observed at least similar increases in activated PMK-2 protein levels in both mir-80; mir-58 and mir-80; mir-58; mir-81-82 mutants, but not in other mutants (Fig. 4C). [score:1]
Whereas deletion of miR-58 does not cause any apparent defects, a strain carrying deletions in the miR-58 family, comprised of miR-58 and the homologous microRNAs miR-80, miR-81, and miR-82, exhibits multiple mutant phenotypes, including defects in size, locomotion, and reproductive egg-laying [6]. [score:1]
Immunoblot analysis of lysates from L4 larval stage wild type worms, mir-80; mir-58; mir-81-82 mutant animals, and mir-80; mir-58 pmk-2(qd284); mir-81-82 mutant animals using antibodies that recognize activated p38 MAPK and β-tubulin. [score:1]
[1 to 20 of 52 sentences]
3
[+] score: 21
The expression of miR-58-3p was used as an endogenous control. [score:3]
For these experiments, we used miR-58-3p as loading control, since its expression was not significantly changed under starvation conditions. [score:3]
In C. elegans, miR-58-3p is a member of a highly expressed family that also includes miR-80, miR-81, miR-82 and miR-1834 [60]. [score:3]
By far, the most highly-expressed miRNAs were miR-58-3p and miR-1-3p, accounting for 50.1% and 19.8%, respectively, of the reads that mapped to miRNAs in well-fed larvae and 48.5% and 18.2%, under starvation (Fig 5). [score:3]
While miR-58-3p single mutants show no developmental, functional or viability deficits, mutants deleted for four members of the mir-58 family are deficient in body size, egg laying, locomotion and cannot form dauer larvae [60]. [score:2]
It is interesting to note that other members of the mir-58 family are also amongst the top 10 most abundant in our analysis, with miR-80-3p and miR-81-3p each contributing about 1% of the miRNA-mapping reads. [score:1]
For Reverse Transcription of miRNAs (miR-35-3p, miR-36-3p, miR-39-3p, miR-240-5p, miR-246-3p, and miR-58-3p) and mRNAs (gld-1, lin-23 and β-actin), a total of 2000 ng and 300 ng were used, respectively. [score:1]
For miR-240-5p, miR-246-3p, miR-35-3p, miR-36-3p, miR-39-3p quantification, miR-58-3p was used as a control. [score:1]
The quantification of miR-35-3p, miR-36-3p, miR-39-3p, miR-240-5p, and miR-246-3p expression relative to miR-58-3p was calculated as in Pfaffl, 2001[47]. [score:1]
Comparing the abundances of miR-58-3p to that of miR-81-3p and miR-80-3p, it is clear that the first dominates, contributing more than 90% of the reads assigned to the whole family, as reported by Kato et al. [57]. [score:1]
C. elegans miR-58-3p is homologous to bantam in Drosophila that has the role of scaling dendrite growth to larval growth in epithelial cells and also controls dendrite/axon regeneration in the peripheral nervous system [58, 59]. [score:1]
In particular, the expression of miR-58-3p was found to be in the range of 44–54% and that of miR-1-3p was between 22%-32%, when measured in embryo, L1, L2, L3, L4 and adult worms [57]. [score:1]
[1 to 20 of 12 sentences]
4
[+] score: 19
In addition, we observed a very strong expression of mir-58 at all developmental stages in excretory cells, epidermis and intestine of C. elegans (Table 1), whereas Martinez et al. did not detect expression of the Promoter::gfp fusion for this miRNA [36]. [score:6]
The small RNA cloning data suggest that miR-58 is the most abundant miRNA expressed at all developmental stages of C. elegans and presumably plays a housekeeping role [41], which fits with the Pmir-58::gfp expression patterns observed in our transgenic lines. [score:6]
The latter include mir-58, which is expressed in multiple tissues but not in the nervous system, while the host gene Y67D8A. [score:3]
At the same time, small RNA cloning data from various developmental stages of C. elegans [41] support expression patterns derived from the intronic promoters rather than from the host genes for several investigated miRNAs (mir-71, mir-58). [score:2]
Regions selected for testing included five miRNAs that were not previously studied (mir-67, mir-71, mir-86, mir-87 and mir-124) and two miRNAs (mir-58 and mir-82) for which GFP fusions were published [36] (Figure 1 and Additional file 2). [score:1]
Interestingly, the mir-58 promoter region tested by Martinez et al. spans 2 kb upstream of pre-miRNA and includes short upstream exon and part of another intron [36], whereas the sequence used in our study is 350 bases shorter and spans the region between pre-miRNA and the upstream exon. [score:1]
[1 to 20 of 6 sentences]
5
[+] score: 11
Hypoxia N2 +  hif-1: For the hypoxia -treated samples including the hif-1 mutant, we chose mir-58-3p as highly expressed (375488,779 reads), mir-230-3p as intermediately expressed (2681,376 reads) and mir-357-3p as lowly expressed (1287,386 reads) to validate by qPCR (Figure 4). [score:7]
All the miRNAs tested in our study showed an M value less than 0.5 (excluding mir-58-3p - M value equals 0.573), which is the suggested cut-off of geNorm corresponding to high expression stability. [score:3]
mir-58-3p, mir-230-3p and mir-357-3p are stable upon hypoxia regardless of HIF-1 presence, V. mir-241-3p, mir-254 and mir-52-5p are stable upon hypoxia. [score:1]
[1 to 20 of 3 sentences]
6
[+] score: 11
Combined with the observation of a previous study, our data suggests that the differing spatial expression of miR-58 family members may allow for opposing biological functions, adding to the complexity of the system [2]. [score:3]
A previous study found that the mir-58 family is required for dauer formation, as deletion of the entire family (mir-58, -80, -81, -82) resulted in an inability to form dauer larvae (Daf-d) [2], which is opposed to the function of the miRNAs discussed above. [score:1]
Mutant alleles used were ain-1(ku322)X, ain-1(tm3681)X, unc-3(e151)X, ain-2(tm2432)I, ain-2(tm1863)I, unc-31(e928)IV, daf-5(e1386)II, daf-16(mu86)I, tph-1(mg280)II, lim-4(yz12)X, tax-2(p691)I, unc-119(ed3)III (for single-copy integration), miR-58(n4640)IV, miR-81/82(nDf54)X, miR-124(n4255)IV, miR-234(n4520)II, and miR-235(n4504)I. The transgenic strains used to perform immunoprecipitations were constructed as previously described, with the addition of a 3 kb region upstream of rgef-1 used as a pan-neuronal promoter [4], [10]. [score:1]
Because of the effect of mir-81/82 in repressing aberrant dauer formation in an unc-3(lf) mutant background, we tested mir-58, a family member of mir-81/82. [score:1]
We found that unc-3(lf); mir-58(lf) mutants behaved similarly to the unc-3(lf) mutant and that unc-3(lf) ain-1(lf); mir-58(lf) mutants were similar to unc-3(lf) ain-1(lf) mutants in dauer formation (Figure 4B, 4D). [score:1]
Alleles used are unc-3(e151 lf), ain-1(ku322 lf), miR-58(n4640 lf), miR-81/82(nDf54 lf), miR-124(n4255 lf), miR-234(n4520 lf), and miR-235(n4504 lf). [score:1]
Few miRNAs have been functionally linked to dauer formation, except for the miR-58 and let-7 family of miRNAs [2], [38]. [score:1]
Moreover, we found mir-58 to be 19-fold depleted from neuronal miRISC (p = 0.00124) while mir-81 was enriched in neuronal miRISC (Figure 4C). [score:1]
Total) of miR-58 family members and statistical significance determined by a student's t-test from deep-sequencing experiments. [score:1]
[1 to 20 of 9 sentences]
7
[+] score: 10
Two miRNAs, miR-58 and miR-1, which showed the highest expression in our total libraries, were abundantly expressed in animals of all developmental stages we examined, from embryo to young adult of hermaphrodites, and in young adult males (Figure 2). [score:6]
Conversely, the maximum number of clones we obtained for a single miRNA was 12,295,951 (miR-58;), which highlights the high dynamic range of miRNA expression that can be surveyed using deep-sequencing technology such as that from Solexa. [score:3]
Although the function of mir-58 in C. elegans remains unknown, we speculate that it has a general housekeeping role. [score:1]
[1 to 20 of 3 sentences]
8
[+] score: 8
We analyzed levels of the let-7 miRNA, a developmentally-regulated miRNA that functions in the developmental timing pathway in the hypodermis [5], miR-58, a highly abundant miRNA [26], miR-62, a miRtron that displays Drosha independent biogenesis [41], and miR-244, a miRNA that is expressed at lower levels primarily in hypodermal seam cells [29]. [score:6]
0037185.g004 Figure 4Levels of mature let-7, miR-58, miR-62, and miR-244 are unchanged in the absence of mir-51 family members. [score:1]
Levels of mature let-7, miR-58, miR-62, and miR-244 are unchanged in the absence of mir-51 family members. [score:1]
[1 to 20 of 3 sentences]
9
[+] score: 5
For example, C. elegans lin-4 and let-7 family members are important for correct larval development, the mir-36 family is essential for embryonic development, the mir-51 family is required for pharynx attachment during embryogenesis and the mir-58 family is involved in regulating locomotion, growth and development of arrested dauer stage larvae (Alvarez-Saavedra and Horvitz, 2010). [score:5]
[1 to 20 of 1 sentences]
10
[+] score: 5
Other miRNAs from this paper: cel-let-7, cel-mir-1, cel-mir-35, cel-mir-52, cel-mir-58a, dme-mir-1, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, dme-bantam, mmu-let-7d, dme-let-7, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-1a-2, cel-lsy-6, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-1b, mmu-let-7j, mmu-let-7k, cel-mir-58c
Translational activity was monitored through measurement of RL activity in the presence of miR-52 2′- O-Me inhibitor or a non-cognate miR-58 2′- O-Me inhibitor. [score:5]
[1 to 20 of 1 sentences]
11
[+] score: 5
Other miRNAs from this paper: cel-let-7, cel-mir-58a, cel-mir-80, cel-mir-81, cel-mir-82, cel-mir-58c
The most conserved mir-80 family members encoded in the C. elegans genome are mir-80, mir-58, mir-81 and mir-82 [12], [18]. [score:1]
Interestingly, however, the quadruple mutant mir-80; mir-58; mir-81-82 has a very small body size, more severe than the scrawny body type we documented for mir-80(Δ) (Fig. 2C), which can be rescued by a mir-80 high copy number transgene [18] suggesting some functional redundancy among mir-80 family members. [score:1]
Note that there are 4 close members of the miR-80 family encoded in the C. elegans genome (mir-58, mir-81, mir-82; see [12], 2008, for alignments and discussion). [score:1]
C. elegans miR-80 familyThe most conserved mir-80 family members encoded in the C. elegans genome are mir-80, mir-58, mir-81 and mir-82 [12], [18]. [score:1]
We did not find an Ex [max] shift in mir-58(Δ) or in the double mir-81(Δ) mir-82(Δ) mutant (data not shown) and thus mir-80 is the sole family member that can be deleted to induce the DR Ex [max] shift. [score:1]
[1 to 20 of 5 sentences]
12
[+] score: 4
Other miRNAs from this paper: cel-mir-1, cel-mir-58a, cel-mir-243, cel-mir-58c
Probes used in this study were: miR-243 – 5′ ATATCCCGCCGCGATCGTACCG 3′; miR-58 – 5′ TTGCCGTCTGCGTCTC 3′; Y47H10A. [score:1]
1000903.g003 Figure 3 RNAs from input extract (In), empty-beads supernatant (Sup EB), HA-beads supernatant (Sup HA), empty-beads immunoprecipitates (IP EB), or HA immunoprecipitates (IP HA) from HA::RDE-1 or HA::ALG-1 worms were extracted and checked by northern blot for the presence of miR-243 or miR-58. [score:1]
As expected, when membranes were probed for miR-58, a microRNA derived from a mismatched precursor, the results were inverted: efficient precipitation was observed with ALG-1, but only weak with RDE-1 (Figure 3). [score:1]
RNAs from input extract (In), empty-beads supernatant (Sup EB), HA-beads supernatant (Sup HA), empty-beads immunoprecipitates (IP EB), or HA immunoprecipitates (IP HA) from HA::RDE-1 or HA::ALG-1 worms were extracted and checked by northern blot for the presence of miR-243 or miR-58. [score:1]
[1 to 20 of 4 sentences]
13
[+] score: 4
Consistent with the observation that alg-1(ma192) mutations broadly affect miRNA expression, the abundance of all miRNAs tested (lin-4, miR-48, miR-241, miR-84, let-7, miR-1, miR-46, miR-58 and miR-79) was decreased in alg-1(ma192) mutants (Figure 2B). [score:4]
[1 to 20 of 1 sentences]
14
[+] score: 4
Other miRNAs from this paper: cel-let-7, cel-lin-4, cel-mir-2, cel-mir-58a, cel-mir-238, cel-mir-58c
Sequences for oligo probes used for the detection of endogenous small RNAs were: miR-238, CTGAATGGCATCGGAGTACAAA; miR-58, ATTGCCGTACTGAACGATCTCA; miR-2, GCACATCAAAGCTGGCTGTGATA; lin-4, TCACACTTGAGGTCTCAGGGA; Let-7, AACTATACAACCTACTACCTCA; X-cluster siRNA, CGCGTATCTATTCAATTGAAT; K02E2.6 siRNA, ATCAGTTACTTGCCAATTTC; and 21U-1, CACGGTTAACGTACGTACCA Transgenic lines in either drh-1(tm1329) or drh-2(ok951) background that carried an extrachromosomal array corresponding to WRW0640F2 were produced with microinjection, and were crossed respectively with drh-1(tm1329) and drh-2(ok951) animals homozygous for FR1gfp transgene. [score:1]
1000286.g004 Figure 4(A) Accumulation of K02E2.6 and X-cluster siRNAs as well as miR-58, miR-238, and let-7 and lin-4 miRNAs in wildtype and mutant worm strains with (lane 1) or without the FR1gfp transgene (lanes 2–9). [score:1]
Sequences for oligo probes used for the detection of endogenous small RNAs were: miR-238, CTGAATGGCATCGGAGTACAAA; miR-58, ATTGCCGTACTGAACGATCTCA; miR-2, GCACATCAAAGCTGGCTGTGATA; lin-4, TCACACTTGAGGTCTCAGGGA; Let-7, AACTATACAACCTACTACCTCA; X-cluster siRNA, CGCGTATCTATTCAATTGAAT; K02E2.6 siRNA, ATCAGTTACTTGCCAATTTC; and 21U-1, CACGGTTAACGTACGTACCA drh-1 and drh-2 functional rescue experimentsTransgenic lines in either drh-1(tm1329) or drh-2(ok951) background that carried an extrachromosomal array corresponding to WRW0640F2 were produced with microinjection, and were crossed respectively with drh-1(tm1329) and drh-2(ok951) animals homozygous for FR1gfp transgene. [score:1]
The same filters were probed for miR-58 after stripping as the loading control. [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 3
As a corollary, only cel-miR-58 had the opposite expression pattern-decreased in WT but increased in eat-2(ad1116). [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
Other miRNAs from this paper: cel-mir-58a, cel-mir-58c
Tissue expression pattern of PMK-2 p38 MAPK is established by the miR-58 family in C. elegans. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 2
Exceptions are the early lethality phenotypes resulting from both the combined loss of mir-35- mir-42 [24] and of mir-51-mir-56, [24, 25], as well as the movement and body size defect resulting from combined mutation of mir-58, -80, -81 and -82 [24]. [score:2]
[1 to 20 of 1 sentences]
18
[+] score: 1
Other miRNAs from this paper: cel-mir-1, cel-mir-35, cel-mir-58a, cel-mir-243, cel-mir-58c
In henn-1 mutant L4 larvae, which are enriched for ALG-3/4 class 26G siRNAs, the levels of three miRNAs (miR-1, miR-35 and miR-58) and an ALG-3/4 class 26G siRNA (26G siR-S5) derived from ssp-16 were each indistinguishable from wild type (Figure 6D and 6E). [score:1]
[1 to 20 of 1 sentences]
19
[+] score: 1
Loss of certain miRNAs or miRNA families led to hypoxia sensitivity (mir-2, mir-35, mir-44, mir-49, mir-51, mir-60, mir-63 and mir-67) and others to hypoxia resistance (let-7, mir-58, mir-67, mir-79, mir-237, mir-246, mir-359). [score:1]
[1 to 20 of 1 sentences]