sort by

8 publications mentioning sja-mir-125b

Open access articles that are associated with the species Schistosoma japonicum and mention the gene name mir-125b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 10
However, when using Vienna RNAfold method for structure prediction, mir-125 precursor showed acceptable bulges in their secondary structure while the bugles of bantam precursor remained (see figure S1). [score:1]
miRNA Sequence Size (nt) S. japonicum contig (LSBI, Shanghai) a S. mansoni shortgun reads (Sanger) b Clones c Δ G° [folding] (kcal/mol e) sja-let-7 GGAGGUAGUUCGUUGUGUGGU 21 CNUS0000067197: 5856–5876 shisto12670f07: 651–671 5 −30.8 sja-miR-71 UGAAAGACGAUGGUAGUGAGA 21CNUS0000007682(-) d: 3100–3120 shisto8708d10: 353–372 1 −34.5 sja-bantam UGAGAUCGCGAUUAAAGCUGGU 22 CNUS0000021739: 2223–2244shisto5226g02(-) d: 325–346 6 −22.9 sja-miR-125 UCCCUGAGACCCUUUGAUUGUC 22 CNUS0000024724:7691–7712 Smp_contig001766:3162–3183 2 −25.6 sja-miR-new1 UCCCUGAGACUGAUAAUUGCUC 22CCON0000000380 (-) d:353325–353346:15–36 shisto8125f02.p1k 4 −29.2 alocation of the miRNA sequence within the published chromosomal sequence of S. japonicum. [score:1]
In this study, we firstly identified five authentic miRNAs in S. japonicum by constructing and screening parasite cDNA library of size-fractionated RNAs: sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1. [score:1]
The novel miRNAs were designated as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. [score:1]
Hence, herein we have tentatively designated the five novel miRNAs from S. japonicum as sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1, respectively. [score:1]
Membranes were incubated with five different biotin-labeled probes (1: sja-let-7, 2: sja-miR-71, 3: sja-bantam, 4: sja-miR-125 and 5: sja-miR-new1). [score:1]
Figure S1 Predicted stem-loop structures for the mir-bantam and mir-125 precursors of S. japonicum and S. mansoni using Vienna RNAfold method. [score:1]
Alignments of the miRNAs with corresponding family members indicated that four of them belong to a metazoan miRNA family: let-7, miR-71, bantam and miR-125. [score:1]
Mir-bantam and mir-125 precursor from S. japonicum showed large bulges in their secondary structure predicted by Mfold RNA-fold software. [score:1]
Alignments with known miRNA sequences indicated that four of the five novel S. japonicum miRNAs belong to four different metazoan miRNA families, i. e. let-7, miR-71, bantam, and miR-125 (Figure 3, S3 and S4). [score:1]
[1 to 20 of 10 sentences]
2
[+] score: 9
The result showed that some miRNA genes, including miRNA-2e-5p, miRNA-2e-3p, miR-71b, miR-2a, miR-2f, miR-124 and miR-31, tended to be enriched in immature worms, whereas miR-125, miR-8 and bantam exhibited a higher abundance in mature adults (Figure 3D), suggesting that different miRNAs could play a distinct role in different development stages. [score:2]
Some miRNA genes, including miRNA-2e-5p, miRNA-2e-3p, miR-71b, miR-2a, miR-2f, miR-124 and miR-31, seem to be preferentially enriched in immature worms, whereas miR-125, miR-8 and bantam exhibited a higher abundance in mature adults (Figure 3D). [score:1]
Although 21 S. japonicum miRNAs are orthologs of known miRNAs within the metazoans, some nucleotides at many positions of Schistosoma miRNAs, such as miR-8, let-7, miR-10, miR-31, miR-92, miR-124, and miR-125, are indeed significantly distinct from other bilaterian orthologs. [score:1]
Similarly, we also aligned other highly conserved miRNAs, such as let-7, miR-10, miR-31, miR-92, miR-124 and miR-125, across bilaterian animals using WebLogo tool. [score:1]
Schisitosoma miR-10, miR-124, miR-125, miR-192, miR-31, and let-7 were analysed by comparing all known orthologs from bilaterian animals, excluding schistosomes, as described using WebLogo described above. [score:1]
According to the published criteria for distinguishing bilaterian miRNAs from other types of small RNAs [4], [28], [29], a bioinformatics pipeline (Figure 1) was performed and identified 176 S. japonicum miRNAs, including four known S. japonicum miRNAs, sja-let-7, sja-miR-71a, sja-miR-125 and sja-bantam [17]. [score:1]
Some of the common Schistosoma miRNAs, including let-7, miR-8, miR-10, miR-31, miR-92, miR-124 and miR-125, are evolutionally conserved across bilaterian animals (Figure 5A). [score:1]
In addition to known S. japonicum miRNAs, sja-let-7, sja-miR-71a, sja-miR-125 and sja-bantam [17], the remaining 172 miRNAs were first recognized in S. japonicum. [score:1]
[1 to 20 of 8 sentences]
3
[+] score: 7
We observed 2 miRNAs (mir-2 and mir-71) expressed in both life cycle stages tested, 7 in adult worms only (mir-4, mir-6, mir-9, mir-32, mir-125, mir-3, mir-5) and 5 in schistosomula only (mir-20, mir-18, mir-22, mir-26, Bantam). [score:3]
We also analyzed in S. mansoni the expression of the five novel miRNAs recently identified in S. japonicum (sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1) [37]. [score:3]
miR-71, miR-125 and Bantam are the miRNAs identified in S. mansoni homolog to miRNAs of S. japonicum [38]. [score:1]
[1 to 20 of 3 sentences]
4
[+] score: 6
In contrast, few target sites have been predicted for sja-miR-125b and sja-bantam, two miRNAs abundantly expressed in male and female worms, respectively, indicating that they may regulate non-gender -associated genes. [score:6]
[1 to 20 of 1 sentences]
5
[+] score: 3
The expression of a set of miRNAs, sja-miR-7-5p, sja-miR-61, sja-miR-219-5p, sja-miR-125a, sja-miR-125b, sja-miR-124-3p and sja-miR-1 were dominant in male worms, while sja-bantam, sja-miR-71b-5p, sja-miR-3479-5p, and sja-Novel-23-5p were predominantly found in the female parasites (Table S6 and S9). [score:3]
[1 to 20 of 1 sentences]
6
[+] score: 2
Indeed, most recently five miRNAs were found by direct cloning in S. japonicum that are also conserved in S. mansoni [55]: let-7, mir-71, bantam, mir-125, and a single schistosome-specific microRNA. [score:2]
[1 to 20 of 1 sentences]
7
[+] score: 2
In female worms, the most highly transcribed miRNAs were sha-mir-71a (3.6% of mapped sRNA reads), sha-mir-1 (2.0%), sha-mir-71b (0.7%), sha-mir-125b (0.7%) and sha-bantam (0.3%) (S1 Table). [score:1]
The most highly transcribed miRNAs in male worms were sha-mir-1 (5.9% of mapped sRNA reads), sha-mir-71a (5.8%), sha-mir-125b (1.6%), sha-mir-7a (1.0%) and sha-let-7 (0.6%). [score:1]
[1 to 20 of 2 sentences]
8
[+] score: 1
In S. japonicum, Cai et al demonstrated miR-7-5p, miR-61, miR-219-5p, miR-125a, miR-125b, miR-124-3p, and miR-1 were dominant in males, while bantam, miR-71b-5p, miR-3479-5p and miR-Novel-23-5p were predominantly found in the female parasites [45]. [score:1]
[1 to 20 of 1 sentences]