sort by

8 publications mentioning sma-mir-71a

Open access articles that are associated with the species Schistosoma mansoni and mention the gene name mir-71a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 12
The number of targets for mir-71a and mir-71b identified here was similar to that of a previous study of S. mansoni miRNAs [11], but overall, the number and identity of targets were discordant with results from the present study. [score:5]
Moreover, the four novel miRNAs transcribed principally in male adults, including one miRNA (sha-miR-new_46) encoded on the same scaffold as the mir-71/mir-2 cluster (KL250488.1) with a CPM more than 20-times higher than that in the library derived from adult female worms, suggest male-specific roles for these miRNAs in gene regulation. [score:2]
In female worms, the most highly transcribed miRNAs were sha-mir-71a (3.6% of mapped sRNA reads), sha-mir-1 (2.0%), sha-mir-71b (0.7%), sha-mir-125b (0.7%) and sha-bantam (0.3%) (S1 Table). [score:1]
Notably, among the female-biased transcripts were the three miRNAs, sha-mir-71b, sha-mir-2b and sha-mir-2c (encoded in a cluster on scaffold KL251164.1), whereas the related miRNAs sha-mir-71a and sha-mir-2a (encoded in a cluster on scaffold KL250488.1) did not show sex-biased transcription. [score:1]
The most highly transcribed miRNAs in male worms were sha-mir-1 (5.9% of mapped sRNA reads), sha-mir-71a (5.8%), sha-mir-125b (1.6%), sha-mir-7a (1.0%) and sha-let-7 (0.6%). [score:1]
The majority (n = 38; 82.6%) of miRNAs predicted to bind 3’-UTR elements were associated with more than one gene; these miRNAs included sha-miR-450_RF00708 (104 genes), sha-miR-71a (53 genes), sha-miR-71b (43 genes), sha-miR-new_38 (39 genes) and sha-miR-new_36 (37 genes). [score:1]
These results are consistent with reports of a mir-71/mir-2 cluster duplication in S. mansoni [10, 11] and S. japonicum [14, 34] on the female-sex (W) chromosome and on one autosome (chromosome 5), and further support roles in sex-specific traits, sexual differentiation, pairing of adult worms and reproductive processes in schistosomes. [score:1]
[1 to 20 of 7 sentences]
2
[+] score: 11
Although the expression of sja-miR-71 and sja-bantam dropped quickly in S. japonicum lung-stage schistosomulum, we observed a strong hybridization signal for both miRNAs in S. mansoni (Figure 1) [37]. [score:3]
We observed 2 miRNAs (mir-2 and mir-71) expressed in both life cycle stages tested, 7 in adult worms only (mir-4, mir-6, mir-9, mir-32, mir-125, mir-3, mir-5) and 5 in schistosomula only (mir-20, mir-18, mir-22, mir-26, Bantam). [score:3]
We also analyzed in S. mansoni the expression of the five novel miRNAs recently identified in S. japonicum (sja-let-7, sja-miR-71, sja-bantam, sja-miR-125 and sja-miR-new1) [37]. [score:3]
Forty-two sequences had at least one match with mature miRNAs from different metazoan miRNA families, such as miR-832, miR-71, miR-297, and let-7 (Table 1). [score:1]
miR-71, miR-125 and Bantam are the miRNAs identified in S. mansoni homolog to miRNAs of S. japonicum [38]. [score:1]
[1 to 20 of 5 sentences]
3
[+] score: 6
This has led some authors to postulate that the mir-71/mir-2 clusters may be involved in sexual maturation in Schistosoma [25]. [score:1]
File S4Phylogenetic relationships between mir-71 sequences in Schistosoma mansoni, S. japonicum and Schmidtea mediterranea. [score:1]
Indeed, only two of the reported 211 microRNAs were confirmed in our analyses (mir-71a and let-7). [score:1]
Duplication of a gene into an autosome has been recently proposed as a way to escape such conflict (reviewed in [36]), and the mir-71/mir-2 cluster duplication appears to be an example of this. [score:1]
The mir-71/mir-2 microRNA cluster is highly conserved in invertebrates, and it has been shown that this cluster is duplicated in Platyhelminthes [25], [28]. [score:1]
Interestingly, one of the clusters (mir-71/2a/2b/2e) is on the sex chromosomes while the other (mir-71b/2f/2d/2c) is on chromosome 5 [25], [29]. [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-9-2, mmu-mir-151, mmu-mir-10b, hsa-mir-192, mmu-mir-194-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-122, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-210, hsa-mir-214, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-194-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-10a, mmu-mir-210, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-151a, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-16-1, gga-mir-194, gga-mir-10b, gga-mir-199-2, gga-mir-16-2, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-199-1, gga-let-7a-2, gga-let-7j, gga-let-7k, gga-mir-122-1, gga-mir-122-2, gga-mir-9-2, mmu-mir-365-2, gga-mir-9-1, gga-mir-365-1, gga-mir-365-2, hsa-mir-151b, mmu-mir-744, gga-mir-21, hsa-mir-744, gga-mir-199b, gga-mir-122b, gga-mir-10a, gga-mir-16c, gga-mir-214, sma-let-7, sma-bantam, sma-mir-10, sma-mir-2a, sma-mir-3479, sma-mir-71b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, gga-mir-365b, sma-mir-8437, sma-mir-2162, gga-mir-9-3, gga-mir-210a, gga-mir-9-4, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3, gga-mir-9b-1, gga-mir-10c, gga-mir-210b, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-9b-2, gga-mir-122b-2
Interestingly, Xue et al. (2008) showed that three of the miRNAs that we find in serum (sja-bantam, sja-miR-71 and sja-let-7) are expressed during all the stages of parasite development but are enriched in the cercariae, suggesting that they may be important during the initial stages of schistosome infection [65]. [score:4]
5118860:+ 2 sma-miR-71a-3p UGAAAGACGAUGGUAGUGAGAU S_mansoni. [score:1]
Six of the nine parasite miRNA probes tested (miR-277, bantam, miR-3479-3p, miR-2a-3p, miR-n1, miR-n2) showed a statistically significant signal over noise at 8 or 12 weeks post infection (Fig. 4, p<0.05); the three miRNAs that were not reliably detected (miR-n3, miR-71a-3p, miR-2162-3p) were not analysed further. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 4
Some, however, are present at the same or even higher levels; two of the more abundant miRNAs, sma-miR-71a and sma-miR-125b, were both present at about the same level in the two samples, and other miRNAs, such as sma-bantam and sma-miR-36-3P, were moderately enriched in vesicles. [score:1]
In contrast, the stem-loop TaqMan probe method was able to specifically detect sma-miR-125a, sma-miR-125b, sma-bantam, sma- miR-71a (Fig.   5). [score:1]
RNA was extracted from the purified exosomes and then used for amplification of four S. mansoni miRNAs (Sma-mir-125a, Sma-mir-125b, Sma-mir-71a, Sma-bantam) by qRT-PCR. [score:1]
Five highly abundant schistosome-derived miRNA sequences (Sma-Bantam, Sma-miR-71a, Sma-miR-36-3p, Sma-miR-125a and Sma-miR-125b) were selected for PCR amplification. [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 3
Two of the miRNAs, miR-71 and lin-4, are detected in infected samples from both Ghana and Cameroon but neither endemic nor European controls. [score:1]
We recently identified 16 miRNAs in the serum of mice infected with the filarial nematode L. sigmodontis and four of these are identical to the O. volvulus miRNAs detected in human serum (mir-71, two miR-100 members, and one bantam family member) and one is derived from the other arm of the hairpin of a O. volvulus miRNA (miR-87). [score:1]
A common feature in all the infections is the presence of miR-71, bantam family and miR-100 family miRNAs (where family is defined based on identical seed sequences, nucleotides 2–8). [score:1]
[1 to 20 of 3 sentences]
7
[+] score: 2
Indeed, most recently five miRNAs were found by direct cloning in S. japonicum that are also conserved in S. mansoni [55]: let-7, mir-71, bantam, mir-125, and a single schistosome-specific microRNA. [score:2]
[1 to 20 of 1 sentences]
8
[+] score: 1
Besides the miR-2 family, another two miRNAs, miR-71 and miR-71b-5p, were also found from one family, which is located on two different scaffolds named as SJC_S000054 and SJC_S000102. [score:1]
[1 to 20 of 1 sentences]