sort by

12 publications mentioning ssc-mir-423

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-423. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 20
0057156.g005 Figure 5 Round boxes (let-7a,let-7c,miR-22-5p,miR-19b,miR-181d-5p,miR-338,miR-423-3p,miR-133b, miR-206,miR-1307, miR-130b,miR-425-3p, and miR-532-5p) represent up-regulated miRNAs, gray octangle boxes (miR-30e-3p, miR-320, miR-324, miR-361-3p, miR-152, miR-708-5p, and miR-22-3p) represent down-regulated miRNAs, black hexagon boxes(FSHβ, CREB, c-Jun, c-Fos) indicate target genes. [score:9]
Round boxes (let-7a,let-7c,miR-22-5p,miR-19b,miR-181d-5p,miR-338,miR-423-3p,miR-133b, miR-206,miR-1307, miR-130b,miR-425-3p, and miR-532-5p) represent up-regulated miRNAs, gray octangle boxes (miR-30e-3p, miR-320, miR-324, miR-361-3p, miR-152, miR-708-5p, and miR-22-3p) represent down-regulated miRNAs, black hexagon boxes(FSHβ, CREB, c-Jun, c-Fos) indicate target genes. [score:9]
h CAAAUGC ssc-miR-19b 1.50 miR-19 GUGCAAA ssc-miR-183 1.47 miR-183 AUGGCAC ssc-miR-423-3p 1.46 miR-423/423-3p GCUCGGU ssc-miR-206 1.46 miR-1/206 GGAAUGU ssc-miR-15a 1.42 miR-15/16/195/424/497 AGCAGCA ssc-miR-22-5p 1.39 miR-22-5p/3568 GUUCUUC ssc-miR-133a-3p 1.39 miR-133 UUGGUCC ssc-miR-340 1.37 miR-340/340-5p UAUAAAG ssc-let-7a 1.37 let-7/98 GAGGUAG ssc-miR-338 1.36 miR-338/338-3p CCAGCAU ssc-miR-361-5p 1.35 miR-361/361-5p UAUCAGA 10.1371/journal. [score:1]
h CAAAUGC ssc-miR-19b 1.50 miR-19 GUGCAAA ssc-miR-183 1.47 miR-183 AUGGCAC ssc-miR-423-3p 1.46 miR-423/423-3p GCUCGGU ssc-miR-206 1.46 miR-1/206 GGAAUGU ssc-miR-15a 1.42 miR-15/16/195/424/497 AGCAGCA ssc-miR-22-5p 1.39 miR-22-5p/3568 GUUCUUC ssc-miR-133a-3p 1.39 miR-133 UUGGUCC ssc-miR-340 1.37 miR-340/340-5p UAUAAAG ssc-let-7a 1.37 let-7/98 GAGGUAG ssc-miR-338 1.36 miR-338/338-3p CCAGCAU ssc-miR-361-5p 1.35 miR-361/361-5p UAUCAGA 10.1371/journal. [score:1]
[1 to 20 of 4 sentences]
2
[+] score: 15
According to sequence count, nine miRNAs highly expressed (Hsa-miR-200b-3p, Hsa-miR-200c-3p, Ssc-miR-126, Ssc-miR-126*, Ssc-miR-99a, Ssc-miR-532-5p, Ssc-miR-92a, Ssc-miR-26a and Bta-miR-193b, n>100) and four miRNAs lowly expressed (Ssc-miR-423-5p, Ssc-miR-29c, Ssc-miR-486 and Ssc-let-7f, n<100) in the kidney miRNAome were selected to measure their expression levels by RT-qPCR. [score:5]
Ssc-miR-99a, Bta-miR-193b and Ssc-miR-423-5p were selected to be up regulated in EU, Hsa-miR-200b-3p, Ssc-miR-532-5p and Ssc-let-7f to be up regulated in AS and, Hsa-miR-200c-3p, Ssc-miR-92a, Ssc-miR-26a, Ssc-miR-486 and Ssc-miR-29c to be up regulated in EA. [score:4]
Additionally, looking at normalised counts for each breed (Table S6), there were some miRNAs with low frequency which their expression was higher in some breed, such as Hsa-miR-193b-5p, Hsa-miR-140-5p, Ssc-miR-19b, Ssc-miR-423-5p and Ssc-miR-24 in Iberian breed, Ssc-miR-151-5p, Hsa-miR-4454, Ssc-miR-199a-3p and Ssc-miR-374b-5p in Landrace breed, Ssc-miR-486 in Piétrain breed and Ssc-let-7f and Hsa-let-7i-5p in Meishan breed. [score:3]
There are also few cases where the most expressed isomiR is different in almost each breed, such as in Ssc-miR-199a* and Ssc-miR-423-5p. [score:3]
[1 to 20 of 4 sentences]
3
[+] score: 12
In particular, ssc-miR-139-5p and its putative target SLA-DQB1 were co-expressed in the three tissues, and ssc-miR-423-5p and its putative target RNF5 were co-expressed in Abdominal Fat and Longissimus Dorsi muscle. [score:9]
Finally, the miR-423-5p target site in the 3′-UTR of human RNF5 was conserved in one porcine variant (i. e. one ‘created’ poly-miRTS) (Table S4). [score:3]
[1 to 20 of 2 sentences]
4
[+] score: 8
Among these, miR-363, miR-423 and miR-34 were the top three upregulated miRNAs in Duroc pigs with fold change ranging from 3.29 to 1.68. [score:4]
On the other hand, PiNN-up regulated genes SMAD3 and PFKFB2 were regulated by miR-423. [score:3]
Further, some miRNAs such as miR-363, miR-133 and miR-423 were identified in the network of both studies. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 7
Target prediction of the 29 differentially expressed miRNAs revealed that miR-148a-3p, miR-27b-3p, miR-423-5p, miR-125a, miR-181c, and miR-365-3p target TNF-α. [score:7]
[1 to 20 of 1 sentences]
6
[+] score: 5
Only four miRNAs (hsa-miR-223-5p, ssc-miR-31, ssc-miR-29a, and ssc-miR-182) were differentially expressed at 24 h pi, whereas 10 miRNAs were differentially expressed at 72 h pi (ssc-miR-29b, hsa-miR-203a-3p, hsa-miR-449a, ssc-miR-21, ssc-miR-29a, hsa-miR-23a-3p, ssc-miR-23b, ssc-miR-30c-5p, ssc-miR-423-5p, and hsa-miR-150-5p). [score:5]
[1 to 20 of 1 sentences]
7
[+] score: 5
miRNA Name Sequence (5'–3') Regulation p-Value ssc-miR-21 TAGCTTATCAGACTGATGTTGA Up 0 ssc-miR-148b-3p UCAGUGCAUCAGAACUUUGU Up 0 ssc-miR-92a TATTGCACTTGTCCCGGCCTGT Up3.4 × 10 [−135] ssc-miR-423-3p AGCUCGGCUGAGGCCCCUCAGU Up1.1 × 10 [−154] ssc-miR-26 TTCAAGTAATCCAGGATAGGCT Down4 × 10 [−155] ssc-miR-24-3p UGGCUCAGUUCAGCAGGAACAG Down1.37 × 10 [−81] ssc-miR-181a AACAUUCAACGCUGUCGGUGAGUU Down1.67 × 10 [−61] ssc-miR-151-5p UCGAGGAGCUCAGUCUAGU Down6.9 × 10 [−4] Target gene prediction was performed to further understand the physiological functions and biological processes involving these miRNAs during mammary gland development and lactation, (Figure 7) based on miRNA/mRNA interactions to provide some molecular insight into the processes. [score:5]
[1 to 20 of 1 sentences]
8
[+] score: 1
Using these probes, miR-145, miR-192, miR-320, and miR-423-5p showed signals that were approximately 22 nt in size, while the other probes detected not only the mature form but also the approximately 75-nt precursors on the same blots (Figure 4). [score:1]
[1 to 20 of 1 sentences]
9
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Sharbati-Tehrani et al., [67] have reported 4 new miRNAs (miR-326, miR-423-3p, miR-484 and miR-451,) that could not be identified in our study, which could be attributed to the use of very specialized tissues (Jejunium, spleen, ileum and kidney) for their study. [score:1]
[1 to 20 of 1 sentences]
10
[+] score: 1
In the F4 library, the 10 most abundant miRNAs (ssc-miR-320a, ssc-miR-21, ssc-miR-191, ssc-miR-143, ssc-miR-145, ssc-miR-423-5p, ssc-miR-7134-3p, ssc-miR-152, ssc-miR-195 and ssc-miR-193a) had reads numbering from 30,883 to 111,160, which contributed to 58.15% of the total miRNAs. [score:1]
[1 to 20 of 1 sentences]
11
[+] score: 1
Conversely, miR-24 and miR-27 exhibited greatest abundance in proliferating satellite cells and the adult, while abundance of miR-368, miR-376, and miR-423-5p was greatest in the neonate. [score:1]
[1 to 20 of 1 sentences]
12
[+] score: 1
Several miRNAs (i. e., let-7f, miR-21, miR-140, miR-185, miR-320, miR-423, miR-2476-1, miR-2476-2 and miR-2476-3) are indicated with arrows. [score:1]
[1 to 20 of 1 sentences]