sort by

28 publications mentioning ssc-mir-10b

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-10b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 55
MiR-10b takes part in carcinogenesis: miR-10b can suppress the translation of the HOXD10 gene leading to increased RHOC expression and AKT phosphorylation [27, 28]. [score:7]
MiRNA name Target gene in MAPK signaling pathway MiR-10b BDNF MiR-211 SOS1 MiR-143 CACNA1E, FGF1, MAPK7, MAP3K7, PDGFRA, KRAS MiR-30a RAP1B, RASA1, RAPGEF2, TAOK1, CACNB2, CASP3, CACNA1C, IL1A, MAP2K4, MAP3K1, MAP3K12, MAP3K2, MAP3K5, NF1, PPP3CA, PPP3CB, RPS6KA2, CRKL MiR-146a TRAF6 To gain an insight into the molecular functions of genes in biological processes, we annotated the genes targeted by differentially expressed miRNAs using GO categories (Table S5). [score:7]
MiRNA name Target gene in MAPK signaling pathway MiR-10b BDNF MiR-211 SOS1 MiR-143 CACNA1E, FGF1, MAPK7, MAP3K7, PDGFRA, KRAS MiR-30a RAP1B, RASA1, RAPGEF2, TAOK1, CACNB2, CASP3, CACNA1C, IL1A, MAP2K4, MAP3K1, MAP3K12, MAP3K2, MAP3K5, NF1, PPP3CA, PPP3CB, RPS6KA2, CRKL MiR-146a TRAF6 To gain an insight into the molecular functions of genes in biological processes, we annotated the genes targeted by differentially expressed miRNAs using GO categories (Table S5). [score:7]
In our study, the MAPK signaling pathway was the major pathway involving 27 genes, and targeted by five differentially expressed miRNAs including miR10b. [score:5]
MiR-211 had a similar expression pattern to miR-10b. [score:3]
MiR-10b was one of the most abundant and differentially expressed miRNA in black hair follicles, with approximately 64,534.56 reads. [score:3]
Figure 5The expression of miR-211 and miR-10b in two tissues. [score:3]
The expression levels of miR-10b and miR-211 were significantly higher in black follicles than in white follicles. [score:3]
Two differentially expressed miRNAs, miR-10b and miR-211, were verified by qPCR. [score:3]
The expressions of two miRNAs, miR-10b and miR-211, were confirmed (Figure 5). [score:3]
Our results showed that miR-10b regulates the DVL3 gene in the Notch pathway. [score:2]
Liu Y. Li M. Zhang G. Pang Z. MicroRNA-10b overexpression promotes non-small cell lung cancer cell proliferation and invasion Eur. [score:2]
Taken together, miR-10b could be an important regulator in goat coat color formation. [score:2]
MiRNA Primer sequences Goat-miR-211 Forward: TCGGCAGGTCCCTTTGTCATCC Reverse: TGCAGGTCAACTGGTGTCGT Loop prime: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGGGCAAA Goat-miR-10b Forward: TCGGCAGGACCCTGTAGAACCG Reverse: TGCAGGTCAACTGGTGTCGT Loop prime: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCACAAATT U6 Forward: CTCGCTTCGGCAGCACA Reverse: AACGCTTCACGAATTTGCGT The TargetScan website (http://www. [score:2]
Liu Z. Zhu J. Cao H. Ren H. Fang X. MiR-10b promotes cell invasion through RhoC-AKT signaling pathway by targeting HOXD10 in gastric cancer Int. [score:2]
MiR-10b is highly expressed in black hair follicles (BF) in compared with the white hair follicles (WF). [score:1]
[1 to 20 of 16 sentences]
2
[+] score: 42
Among them, let-7 g, miR-17-5p, miR-17-3p, miR-20a, miR-181a, miR-16, miR-146b, miR-10b, and miR-155-5p were upregulated; let-7c, miR-122, miR-18a, miR-19a, miR-19b, miR-196b, miR-21, and miR-9 were downregulated. [score:7]
miR-10 expression was upregulated in the infected cells. [score:6]
Mitogen-activated protein kinase kinase kinase 7 (MAP3K7), considered a target gene of miR-10, regulates the inhibitor of nuclear factor κB/nuclear factor κB (IκB/NF-κB) signaling pathway [18]. [score:5]
The expression levels of ssc-miR-10b, ssc-miR-30a-5p, ssc-miR-16, ssc-miR-17-5p, and ssc-miR-192 in the PPV-infected cells were higher than in the uninfected cells, whereas ssc-miR-21, ssc-miR-19b, ssc-miR-18a, ssc-miR-152, and ssc-miR-novel-chr13_10861 were downregulated compared to the uninfected cells (Fig.   2). [score:5]
However, we did not detect differential expression of other previously identified miRNAs (miR-223, miR-150, miR-92a), although miR-10b, miR-20a, miR-30a-5p, miR-34a, miR-17—5p, miR-16, miR-146b, and miR-155-5p expression was significantly different. [score:5]
The most upregulated and downgulated miRNA were ssc-miR-10b (36-fold) and ssc-miR-18a (0.01-fold) (Table  2). [score:4]
We detected the expression of miR-10b, miR-20a, miR-19b, miR-181a, miR-146b, miR-18a, and other previously identified immune-related miRNAs. [score:3]
We surmise that a possible function of miR-10 in triggering an antiviral response is targeting the MAP3K7 and BDNF genes. [score:3]
In addition, miR-10 controls brain-derived neurotrophic factor (BDNF) levels via the miRNA–mRNA regulatory network [19]. [score:2]
We detected miR-10 and miR-30 in this study, suggesting that they are related to the cellular immune response to PPV infection. [score:1]
Many immune-related miRNAs have been identified in innate and adaptive immune systems, including the miR-17—92 cluster, miR-221, miR-10, miR-196b, miR-126, miR-155, miR-150; miR-181a, miR-326, miR-142-3p, miR-424, miR-21, miR-106a, miR-223, miR-146; the let-7 family, miR-9, and miR-34 [6]. [score:1]
[1 to 20 of 11 sentences]
3
[+] score: 41
The results of transient transfection assays demonstrated that (1) miR-21 negatively regulates the expression of Pitx2c (this work), (2) miR-1 suppresses Myocd expression [53], and (3) miR-10a and miR-10b both inhibit Tbx5 expression [54]. [score:11]
An aspect of particular interest of our study was the finding that the upregulation of miR-1, miR-10a, miR-10b, and miR-21 is negatively correlated with downregulation of, respectively, MYOCD, TBX5, and PITX2c in the paced LA (see Figure 5(e)). [score:7]
In transfection assays, miR-1 inhibits mouse Myocd expression at the transcript [52] and protein level [53], while both miR-10a and miR-10b negatively modulate human Tbx5 expression at the protein level [54]. [score:6]
Computational analysis (by miRanda and Targetscan) of the 3′ untranslated region of pig Pitx2, Tbx5, and Myocd genes revealed consensus sites for binding of, respectively, miR-21, miR-10a/miR-10b, and miR-1 (Figure 5(a)). [score:5]
Consistent with the results obtained and other reports [53, 54], the histogram plot (Figure 5(e)) exhibits a clear inverse correlation in the protein expression of Pitx2 versus miR-21, Tbx5 versus miR-10b, and Myocd versus miR-1 in the LA of paced animals, confirming thus our hypothesis. [score:3]
Pacing -induced alterations in the expression of other miRNAs with particular concern for their involvement in AF could not be determined by microarray hybridizations due to a high variability among replicates (miR-1, miR-21, miR-23a/b, miR-29a, and miR-133a) or very low hybridization signals (miR-10a, miR-10b; see the complete microarray data at NCBI through GEO accession number GSE65330). [score:3]
Our qPCR analysis showed that pacing resulted in a significant upregulation of a set of AF -associated miRNAs (i. e., miR-1, miR-10a, miR-10b, miR-21, miR-29a, and miR-208a) in the LA compared with the control (see Figure 3). [score:3]
Six miRNAs (miR-1, miR-10a-5p, miR-10b, miR-21, miR-29a, and miR-208a) showed a higher expression in paced as compared with nonpaced animals. [score:2]
From this perspective, our data would suggest that higher levels of miR-21, miR-10b, and miR-1 in the LA myocardium contribute to arrhythmogenesis via perturbation of Pitx2, Tbx5, and Myocd signaling pathways, respectively. [score:1]
[1 to 20 of 9 sentences]
4
[+] score: 17
Of these, 10 miRNAs (ssc-miR-210, ssc-miR-1343, 12_3058, ssc-miR-676-5p, GL894044.2_23796, 1_4279, 13_5125, ssc-miR-194b-5p, ssc-miR-142-5p, and ssc-miR-421-5p) were up-regulated and 10 (ssc-miR-101, 1_1126, 4_13655, GL892805.1_27591, ssc-miR-320, ssc-miR-7136-5p, ssc-miR-214, ssc-miR-10b, 7_17790, and ssc-miR-206) were downregulated in the TP relative to the YP. [score:7]
In our study, 19 putative target genes that are regulated by downregulated miRNAs (ssc-miR-101, ssc-miR-7136-5p, ssc-miR-214, ssc-miR-10b, ssc-miR-206, and ssc-miR-320) were found to be involved in the VEGF signaling pathway (Fig 4). [score:7]
Expression levels of five miRNAs (ssc-miR-10b, ssc-miR-206, ssc-miR-214, ssc-miR-320, and ssc-miR-7136-5p) in the cardiac tissues of TPs and YPs were assessed by stem-loop qPCR. [score:3]
[1 to 20 of 3 sentences]
5
[+] score: 16
Mir-10b is, apart from being the most expressed miRNA with more than 32% of the total read count in the sequencing study (Fig 1), also differentially expressed in the obese female pigs (Tables 5 and 6) where it is down regulated in female obesity according to the sequencing study and up regulated in the qPCR study. [score:7]
Mir-10b is up regulated in adipocyte differentiation [67], which together with the high expression in adipose tissue suggests a housekeeping regulatory function in this tissue. [score:4]
In the female pigs mir-9, mir-124a, mir-103, mir-10b and mir-99a were differentially expressed (Table 6). [score:3]
In the present study the top 10 most abundant miRNAs represent 74% of the read counts, and one miRNA (mir-10b) account for more than 32% of the reads. [score:1]
This result, together with the results on mir-10b are examples of inconsistent results between NGS and qPCR as has also reported by others [19]. [score:1]
[1 to 20 of 5 sentences]
6
[+] score: 13
Ssc-miR-10b was expressed in the kidney; ssc-miR-181a was expressed in the spleen, kidney, small intestine and colon; and ssc-miR-127 was also expressed in the spleen. [score:7]
Moreover, other miRNAs were also expressed abundantly in skeletal muscles, including ssc-let-7a, ssc-let-7c, ssc-let-7f, ssc-miR-143-3p, ssc-miR-10b, ssc-miR-148a, ssc-miR-127, ssc-miR-30d, ssc-miR-30a-5p, and ssc-miR-181a. [score:3]
Other miRNAs, such as ssc-miR-10b, ssc-miR-181a, ssc-miR-30d and ssc-miR-127, were also expressed at a high level in skeletal muscles, but they were not myomiRs. [score:3]
[1 to 20 of 3 sentences]
7
[+] score: 12
As presented in Table 2, one class showed 100-fold greater levels of expression at E90 compared to D100, which included ssc-miR-126, ssc-miR-143-3p, ssc-miR-127, ssc-miR-148a, ssc-miR-196b-5p, and ssc-miR-369; another class exhibited expression levels of were slightly lower than 100-fold, which included ssc-miR-542-3p, ssc-miR-99b, ssc-miR-378, ssc-miR-30a-5p, ssc-miR-10b, and ssc-miR-21. [score:4]
The expression patterns of the miRNAs assayed by RT-qPCR were in accordance with the Solexa sequencing results with the exception of ssc-miR-10b, which showed opposite results, being expressed at higher levels in the skeletal muscle at D100 than at E90 (Fig 2). [score:4]
Nine differentially expressed miRNAs (ssc-miR-7a, ssc-miR-10b, ssc-miR-21, ssc-miR-30d, ssc-miR-127, ssc-miR-148a, ssc-miR-181, ssc-miR-199*, and ssc-miR-378) were chosen for the validation of the Solexa sequencing data via RT-qPCR. [score:3]
Aside from ssc-miR-206 and ssc-miR-1, ssc-miR-378 was the most abundant at E90, followed by ssc-miR-143-3p, ssc-let-7a, ssc-let-7f, ssc-let-7c, ssc-miR-30d, ssc-miR-30a-5p, ssc-miR-10b, ssc-miR-127, ssc-miR-148a, ssc-miR-126, ssc-miR-7i, and ssc-miR-21. [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 9
In total, the QPCR results have consisted with RNA-Seq results, three TDETGs (COL6A2, ITGB1 and CD34) and four DE miRNAs (miR-10b, miR-148a-3p, miR-181d-5p, miR-181a) were down-regulated; four TDETGs (SPATA24, KHDBPS3, TSGA10, GGNBP) and one DE miRNA (miR-133a-3p) were up-regulated by two methods. [score:7]
Nine TDETGs (CCNI, SPATA24, NEURL, KHDBPS3, TSGA10, GGNBP2, COL6A2, ITGB1 and CD34) and eight DE miRNAs (miR-301, miR-194b-5p, miR-10b, miR-148a-3p, miR-181d-5p, miR-181a, miR-133a-3p and miR-145-5p) from Table 3 were confirmed via real-time RT-PCR to be involved in spermatogenesis and testicular development. [score:2]
[1 to 20 of 2 sentences]
9
[+] score: 8
The unified set of top 10 unique miRNAs over the two pig breeds correspond to 15 unique miRNAs, 11 of which (ssc-let-7a-1/2-5p, ssc-let-7c-5p, ssc-let-7e-5p, ssc-miR-10a-5p, ssc-miR-10b-5p, ssc-miR-127-3p, ssc-miR-148a-3p, ssc-miR-199a-1/2-5p, ssc-miR-21-5p, ssc-miR-26a-5p, ssc-miR-125b-1-5p) had been frequently reported highly expressed in skeletal muscle during porcine prenatal and postnatal developmental stages. [score:4]
In addition, miR-127, miR-99b and miR-10b are important regulators in various cancers [32– 34]. [score:2]
For example, Qin et al. had reported that ssc-let-7a, ssc-miR-10a, ssc-miR-10b, ssc-miR-127, ssc-miR-148a, ssc-miR-21, ssc-miR-26a were the most abundant miRNAs during porcine skeletal muscle developmental stages from 35 days post coitum to postnatal day 180 [25]. [score:2]
[1 to 20 of 3 sentences]
10
[+] score: 7
Compared to RFI_H muscles, expression of miR-1 and miR-30e miRNAs was higher, whereas expression of miR-10b, and miR-145 was lower in RFI_L muscles (Fig. 1c). [score:4]
To validate the differential expression identified by the miRNA sequencing, miR-1, miR-30e, miR-10b and miR-145 were selected for qRT-PCR analysis. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 6
Other miRNAs from this paper: ssc-mir-122, ssc-mir-214, ssc-mir-1, ssc-mir-206
For instance, miR-214 differentially expressed in LD enables precisely specific the muscle cell types by sharpening cellular responses to Hedgehog in Zebrafish [39]; a liver-differentially expressed miRNA of miR-10b is predicted to regulate genes in pathways relevant to type 2 diabetes [40]. [score:6]
[1 to 20 of 1 sentences]
12
[+] score: 6
miR-10b has also been observed in relatively high abundance in skeletal muscles [25] and, although little is known about its functional role in myoblast growth, an analysis of its target genes demonstrated that it was involved in myogenesis regulation and participates in muscle development regulation [38]. [score:6]
[1 to 20 of 1 sentences]
13
[+] score: 6
According to the high-throughput sequencing data, the let-7 family (let-7a, let-7f, let-7 g), the miR-10 family (miR-10b, miR-10a-3p, miR-10a-5p), miR-21, miR-143-3p, miR-30a-5p, miR-16 and miR-192 had the highest expression levels among the 10 expression profiles (Additional file  1: Figure S3), which suggests that these miRNAs are highly conserved among different organs in the same species. [score:5]
To verify the accuracy of the high-throughput sequencing results, stem-loop quantitative (q)RT-PCR was performed on 12 significantly DE miRNAs (ssc-miR-10b, ssc-miR-486, ssc-miR-24-3p, ssc-miR-195, ssc-miR-19b, ssc-let-7f, ssc-miR-146b, ssc-miR-novel-chr16_17559, ssc-miR-novel-GL892871-2_41708, ssc-miR-novel-chr2_21624, ssc-miR-novel-chr12_7961, and ssc-miR-26a). [score:1]
[1 to 20 of 2 sentences]
14
[+] score: 5
We observed high expression of miR-10b, which regulates the activity of the homeobox genes hox1a and hox1b. [score:4]
Notably, the abundance of miR10b was similar in female and male gonads (Table S2). [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 4
Similarly, miR-199a, miR-195, miR-10 and miR-23 expression were correlated with TG and haematological traits. [score:3]
For example, serum TG was correlated with miR-744, miR-199, miR-10, miR-23, miR-195 and miR-155, which were also correlated with erythrocyte-related traits (RBC, MCHC, HGB and MCV). [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 4
Other miRNAs from this paper: ssc-mir-122, ssc-mir-125b-2, ssc-mir-181b-2, ssc-mir-20a, ssc-mir-23a, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-21, ssc-mir-29c, ssc-mir-30c-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-20a, bta-mir-21, bta-mir-26b, bta-mir-30d, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-199a-1, bta-mir-30b, bta-mir-107, bta-mir-10a, bta-mir-127, bta-mir-142, bta-mir-181b-2, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-132, bta-mir-138-2, bta-mir-17, bta-mir-181c, bta-mir-192, bta-mir-199b, bta-mir-200a, bta-mir-200c, bta-mir-214, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-455, bta-let-7g, bta-mir-10b, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-mir-30c, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-99b, ssc-mir-99b, ssc-mir-17, ssc-mir-30b, ssc-mir-199b, bta-mir-1-2, bta-mir-1-1, bta-mir-129-1, bta-mir-129-2, bta-mir-133a-2, bta-mir-133a-1, bta-mir-133b, bta-mir-135b, bta-mir-138-1, bta-mir-143, bta-mir-144, bta-mir-146b, bta-mir-146a, bta-mir-181d, bta-mir-190a, bta-mir-199a-2, bta-mir-202, bta-mir-206, bta-mir-211, bta-mir-212, bta-mir-223, bta-mir-26a-1, bta-mir-29d, bta-mir-30f, bta-mir-338, bta-mir-33a, bta-mir-33b, bta-mir-375, bta-mir-429, bta-mir-451, bta-mir-92a-1, bta-mir-92b, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, ssc-mir-133a-1, ssc-mir-1, ssc-mir-146b, ssc-mir-181a-1, ssc-mir-30a, bta-mir-199c, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-133b, ssc-mir-29a, ssc-mir-30d, ssc-mir-30e, ssc-mir-199a-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-99a, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-192, ssc-mir-142, ssc-mir-127, ssc-mir-202, ssc-mir-129a, ssc-mir-455, ssc-mir-125b-1, ssc-mir-338, ssc-mir-133a-2, ssc-mir-146a, bta-mir-26c, ssc-mir-30c-1, ssc-mir-126, ssc-mir-199a-1, ssc-mir-451, ssc-let-7a-2, ssc-mir-129b, ssc-mir-429, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-132, ssc-mir-138, ssc-mir-144, ssc-mir-190a, ssc-mir-212, bta-mir-133c, ssc-mir-26b, ssc-mir-200b, ssc-mir-223, ssc-mir-375, ssc-mir-33b
MicroRNA-10 modulates Hox genes expression during Nile tilapia embryonic development. [score:3]
Sea louse Caligus rogercresseyi, which affects Chilean aquaculture, were studied during infestation in Atlantic salmon and the most abundant families were mir-10, mir-21, mir-30, mir-181, and let7 in skin, head and kidney (Valenzuela-Muñoz et al., 2017). [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 4
This observation is not in agreement with other studies of miRNAs in pig skeletal muscle [32, 33]; instead, miR-10b had the highest expression in both groups of our study, accounting for 36% and 26% of total normalized miRNA reads, respectively. [score:3]
The top nine most abundant miRNAs shared between the two groups were ssc-miR-10b, ssc-miR-22-3p, ssc-miR-486, ssc-miR-26a, ssc-miR-27b-3p, ssc-miR-191, ssc-miR-378, ssc-126-5p and ssc-miR-181. [score:1]
[1 to 20 of 2 sentences]
18
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
Ssc-miR-182, ssc-miR-187, ssc-miR-136, ssc-miR-210, ssc-miR-217 and ssc-miR-10b participate in regulation Neurotrophin signaling pathway by targeting corresponding genes, including BNDF, SHC4, KRAS and FOXO3. [score:4]
[1 to 20 of 1 sentences]
19
[+] score: 3
We found that 13 miRNAs (ssc-miR-10b, -21, -26a, -99a, -126-3p, -143-3p, -148a-3p, -199a-3p, -199b-3p, -let-7i, -let-7g, -let-7f, and -let-7a) were highly expressed in both subcutaneous and abdominal adipose tissues from deep sequencing. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
The expression levels of 17 immune-related miRNAs, including miR-10b, miR-20a, miR-19b, miR-181a, miR-146b, and miR-18a were found to be significantly altered in PK-15 cells during PPV infection. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 3
In this sense, variants expression followed two main patterns: according to those miRNAs with more than 1,000 total reads, they were distributed in those miRNAs with a strong predominant isomiR, such as Hsa-miR-200b-3p, Ssc-miR-125b, Ssc-miR-23b, Ssc-miR-23a, Ssc-miR-192, Ssc-miR-10b, Ssc-miR-126* and Ssc-miR-10a, and those miRNAs where there is not a really strong predominant isomiR, like Ssc-miR-126, Ssc-miR-99a, Hsa-miR-200c-3p, Ssc-miR-30d and Ssc-miR-125a (Table S3). [score:3]
[1 to 20 of 1 sentences]
22
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Additionally, a number of miRNAs including miR-148a, miR-26a, miR-21-5p, miR-27b, miR-143, bta-miR-30a-5p, let-7a-5p, let-7f, miR-10b, and miR-99a-5p are highly expressed in bovine mammary gland/mammary epithelial cells (Li et al., 2012a, 2014a; Jin et al., 2014a; Le Guillou et al., 2014) suggesting roles in the lactation process and mammary gland functions. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 2
1504/fig-3 Figure 3 Furthermore, nine representative DE miRNAs (miR-133a-5p, miR-181a-1-3p, miR-499-5p, miR-320-3p, miR-24-1-3p, miR-214-3p, let-7g-5p, miR-23a-3p, and miR-10b-3p) were chosen for validation by the stem–loop real time (RT)-PCR -based method using three independent samples. [score:1]
1504/fig-3 Figure 3Furthermore, nine representative DE miRNAs (miR-133a-5p, miR-181a-1-3p, miR-499-5p, miR-320-3p, miR-24-1-3p, miR-214-3p, let-7g-5p, miR-23a-3p, and miR-10b-3p) were chosen for validation by the stem–loop real time (RT)-PCR -based method using three independent samples. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 2
These include miR-214, miR-140, miR-150, miR-10, as well as miR-181. [score:1]
In the zebrafish, miR-214 can modulate hedgehog signaling, thus changing muscle cell fate [18], and miR-10 was shown to represses HoxB1a and HoxB3a, which are involved in patterning the anterior-posterior axis [19]. [score:1]
[1 to 20 of 2 sentences]
25
[+] score: 2
Notably, prv-miR-10 and prv-miR-11 are each present in two copies in the PRV genome, and those located in the intron of LLT were designated as prv-miR-10-1 and prv-miR-11-1, while the homologous miRNAs in the terminal repeat region (TR) were named as prv-miR-10-2 and prv-miR-11-2. All 11 LLV intronic miRNA genes are interspersed and arranged in the same transcriptional orientation. [score:1]
Prv-miR-10 and prv-miR-11 are located in the repeat regions; therefore they both have two reverse copies. [score:1]
[1 to 20 of 2 sentences]
26
[+] score: 2
Gastroenterology 139: 1654–1664, 1664 e1651 3 Lund AH 2010 miR-10 in development and cancer. [score:2]
[1 to 20 of 1 sentences]
27
[+] score: 1
569 AMP miR-10, miR-126, let-7, miR-27, miR-450 9.860E-05–5.804E-04 0.789–0.730 ADP miR-15, miR-885, miR-322, miR-450, miR-338 1.316E-04–4.540E-03 0.781–0.636 ATP miR-15, miR-450, miR-210, miR-885, miR-451 4.811E-04–9.562E-03 0.737–0.593 Correlations between gene expression derived from post quality-filtered 17,820 mRNA probes and each phenotypic- trait were calculated for both Duroc and PiNN pigs. [score:1]
[1 to 20 of 1 sentences]
28
[+] score: 1
The five most abundant miRNAs represented 47.9% of the total cpm in the dataset including ssc-miR-1, ssc-miR-133a­3p, ssc­miR-378, ssc-miR-206, and ssc-miR-10b. [score:1]
[1 to 20 of 1 sentences]