sort by

33 publications mentioning ssc-mir-24-2

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-24-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 91
One possible function of miR-24 is to maintain reduced levels of IRG6 in healthy cells and then upon viral infection miR-24 expression is down-regulated resulting in increased IRG6 expression and subsequent induction of an anti-viral response. [score:8]
The results of the present study add to the already known complex regulation of NFκB expression during PRRSV infections by suggesting that this activation, in part, may be due to decreased expression of miR-24 in PRRSV- infected cells and thus results in an increase in expression of IL1A and IL1B. [score:8]
DF1 cells, a chicken embryonic fibroblast cell line, were infected with either the RCAS- miR-24 expressing virus or the RCAS- SC expressing virus were transfected with predicted target 3′ UTR luciferase constructs. [score:7]
Therefore, one of the possible functions of miR-24 down-regulation during PRRSV infections may be to increase the expression of FLVCR2 and subsequently modulate intracellular calcium levels. [score:6]
Three miRNAs, miR-24, miR-146a, and miR-147 were selected for target gene validation based on their expression profiles, predicted regulated pathways and/or their known involvement in immunity. [score:6]
The expression of the miRNA miR-24 was significantly down-regulated in PRRSV infected PAMs at 24 hpi (Figure 1). [score:6]
Therefore one possible explanation for the increased expression of IL1 during PRRSV infection [14] may be, in part, the down-regulation of miR-24. [score:6]
In silico target prediction for miRNAs differentially expressed in PRRSV-infected PAMs, identified two potential miR-24 binding sites within the 3′ UTR of FLVCR2. [score:5]
When cloned into the 3′UTR of Renilla luciferase these miR-24 binding sites were able to significantly reduce Renilla expression in DF1 cells over -expressing porcine miR-24 (Figure 2). [score:5]
When the CCR1 miR-24 binding site was inserted into the 3′UTR of Renilla luciferase there was a slight decrease in luciferase activity, suggesting that miR-24 may regulate CCR1 expression during the response to PRRSV infection. [score:4]
Target prediction analysis suggests that miR-24 is involved in the regulation of several immune -associated genes (Table 2, Figure 2). [score:4]
As miR-24 was found to be significantly down-regulated in PRRSV-infected PAMs compared to mock-infected cells it would be expected that IRG6 levels should be induced in PRRSV infected cells. [score:3]
Of the ten potential miR-24 regulated genes selected for binding site validation, the miR-24 binding sites of six genes (IRG6, IL1A, IL1B, IL13, GBP1, and ICAM1) significantly reduced Renilla luciferase expression in DF1 cells infected with RCAS- ssc-miR-24 compared to cells infected with RCAS- SC (Figure 2). [score:3]
Validation of predicted ssc-miR-24 target genes. [score:3]
0082054.g002 Figure 2Validation of predicted ssc-miR-24 target genes. [score:3]
Gateway cloning (Life Technologies) was used to create RCAS viruses expressing either the ssc-miR-24 hairpin or a scrambled control (SC) hairpin. [score:3]
Computationally predicted porcine miR-24 target sites chosen for in vitro validation. [score:3]
Two related cytokines, interleukin one alpha (IL1A) and interleukin one beta (IL1B), have potential miR-24 binding sites in their 3′UTRs (Table 2). [score:1]
The 3′UTR of IRG6 has three potential miR-24 binding sites (Table 2). [score:1]
CCR1 also contains a miR-24 binding site (Table 2). [score:1]
[b]This construct contains two miR-24 binding sites. [score:1]
Porcine inflammatory response protein 6 (IRG6; also known as RSAD2 or viperin) contains three potential miR-24 binding sites in its 3′UTR (Table 2). [score:1]
[a]This construct contains two miR-24 binding sites. [score:1]
DF1 cells were infected with either RCAS- ssc-miR-147, RCAS- ssc-miR-24, RCAS- ssc-miR146a or RCAS- SC (M. O. I. of 1) and maintained in a 96-well plate in RPMI 1640 with 1% heat-inactivated FBS, L-glutamine, penicillin (100 U/ml), streptomycin (100 µg/ml), and fungizone (4 µg/ml), at 37°C with 5% CO [2]. [score:1]
[c]This construct contains three miR-24 binding sites. [score:1]
[1 to 20 of 25 sentences]
2
[+] score: 30
As examples, the liver-specific miR-122 promotes the replication of hepatitis C virus (HCV) [17], [18], while miR-196, miR-199, miR-296, miR-351, miR-431 and miR-448 inhibit HCV genome propagation [19], [20]; miR-32 effectively restricts the accumulation of primate foamy virus type 1 (PFV-1) in human cells [21]; miR-323, miR-491 and miR-654 inhibit the replication of the H1N1 influenza A virus by binding to the viral PB1 gene [22]; miR-28, miR-125b, miR-150, miR-223 and miR-382 target the 3′ end of human immunodeficiency virus (HIV) mRNA, thereby restricting HIV production [23]; miR-199a-3p and miR-210 limit the hepatitis B virus (HBV) surface antigen and polymerase production by degrading and/or inhibiting translation of viral mRNAs encoding these proteins [24]; overexpression of miR-24 and miR-93 suppresses vesicular stomatitis virus (VSV) replication through targeting the viral genes encoding RNA -dependent RNA polymerase (L protein) and phosphoprotein (P protein), respectively [25]; in macrophages, upregulation of miR-155 suppresses VSV replication, while inhibition of miR-155 had the opposite effect. [score:24]
The mimics and inhibitors of miR-24, miR-93, miR-122, miR-125b, miR-146a, miR-155, miR-181, miR-196, miR-351, and miR-365 (shown in Table S1) were obtained from GenePharma (Shanghai, China). [score:3]
To screen the potential miRNAs which can reduce PRRSV replication, the mimics or inhibitors of 10 miRNAs (Table S1), including miR-24, miR-93, miR-122, miR-125b, miR-146a, miR-155, miR-181, miR-196, miR-351, and miR-365, were chosen and synthetized. [score:3]
[1 to 20 of 3 sentences]
3
[+] score: 20
A study on the expression profile of novel miRNAs in 11 pig tissues, including brain, liver, heart, muscle, colon, kidney, lung, spleen, stomach, cervix and fibroblasts, indicated that ssc-miR-15b, ssc-miR-23a, ssc-miR-23b, ssc-miR-24, ssc-miR-29a, ssc-miR-30b, ssc-miR-145, and ssc-miR-152 are expressed in all tissues; ssc-miR-210 is mainly expressed in the liver, spleen, and stomach; ssc-miR-34a and ssc-miR-130a are mainly expressed in the lungs; and ssc-miR-140 is highly expressed in the cervix. [score:11]
Sharbati et al. [13] conducted miRNA cDNA library sequencing on six different sections (duodenum, anterior segment of jejunum, posterior segment of jejunum, ileum, ascending colon, and transverse colon) of 31-day-old Euroc and Piétrain hybrid pig intestinal tissues, and found that miR-194 and miR-215 were highly expressed in the duodenum and posterior segment of the jejunum and that miR-19b, miR-23a, miR-24, and miR-30b expression was higher in the colon than in other sections of the intestinal tract. [score:5]
In another important human disease, diabetes, the study by Melkman et al. [5] into the effects of miRNAs on insulin synthesis revealed that knocking out miR-24, miR-26, miR-182, or miR-148 reduced the transcriptional activity of the insulin gene promoter, thereby reducing the level of insulin mRNA. [score:4]
[1 to 20 of 3 sentences]
4
[+] score: 13
For example, ssc-miR-19a targets TNFα, IL-12α, and IL-20; ssc-miR-19b targets TNFα and IL-20; ssc-miR-7 targets IL-1β, IL-2, and TGF-β1; ssc-let-7a targets IFN- delta-1; ssc-miR-30a-5p targets IL-12α and IL-12β; and ssc-miR-24-3p targets IL-1α. [score:13]
[1 to 20 of 1 sentences]
5
[+] score: 12
In total, 92, 107, 95, 77 and 111 miRNAs were identified as being differentially expressed in PCMV-infected lung, liver, spleen, kidney and thymus samples, compared with their levels in the uninfected controls (p < 0.0001) ssc-miR-24-3p (172% increase), ssc-miR-199a-5p (1000% increase), ssc-miR-214 (3012% increase), ssc-miR-425-5p (1750% increase) and ssc-miR-199a-5p (2270% increase) were the most upregulated in PCMV-infected lung, liver, spleen, kidney and thymus samples, respectively, compared with their levels in the uninfected samples. [score:4]
In total, 92, 107, 95, 77 and 111 miRNAs were identified as being differentially expressed in PCMV-infected lung, liver, spleen, kidney and thymus samples, compared with their levels in the uninfected controls (p < 0.0001) ssc-miR-24-3p (172% increase), ssc-miR-199a-5p (1000% increase), ssc-miR-214 (3012% increase), ssc-miR-425-5p (1750% increase) and ssc-miR-199a-5p (2270% increase) were the most upregulated in PCMV-infected lung, liver, spleen, kidney and thymus samples, respectively, compared with their levels in the uninfected samples. [score:4]
ssc-miR-106a (decrease of 97.1%), ssc-miR-214 (decrease of 97.8%), ssc-miR-425-5p (decrease of 96.2%), ssc-miR-126-3p (decrease of 84.7%) and ssc-miR-24-3p (decrease of 98.4%) were the most downregulated miRNAs in PCMV-infected lung, liver, spleen, kidney and thymus samples, respectively, compared with their levels in the uninfected samples (Additional file  1: Table S3). [score:3]
To verify the accuracy of the high-throughput sequencing results, stem-loop quantitative (q)RT-PCR was performed on 12 significantly DE miRNAs (ssc-miR-10b, ssc-miR-486, ssc-miR-24-3p, ssc-miR-195, ssc-miR-19b, ssc-let-7f, ssc-miR-146b, ssc-miR-novel-chr16_17559, ssc-miR-novel-GL892871-2_41708, ssc-miR-novel-chr2_21624, ssc-miR-novel-chr12_7961, and ssc-miR-26a). [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 10
et al. (2008) p16(INK4a) translation suppressed by miR-24. [score:5]
Some miRs differentially expressed during adipogenesis have been identified, including miR-24 [8, 9], miR-31 [9] and the miR-17-92 cluster which alter cell proliferation [10]; miR-8 which represses Wnt signaling [11]; and miR-27 [12– 14] and miR-130 which target PPARγ [15]. [score:5]
[1 to 20 of 2 sentences]
7
[+] score: 10
miRNA Name Sequence (5'–3') Regulation p-Value ssc-miR-21 TAGCTTATCAGACTGATGTTGA Up 0 ssc-miR-148b-3p UCAGUGCAUCAGAACUUUGU Up 0 ssc-miR-92a TATTGCACTTGTCCCGGCCTGT Up3.4 × 10 [−135] ssc-miR-423-3p AGCUCGGCUGAGGCCCCUCAGU Up1.1 × 10 [−154] ssc-miR-26 TTCAAGTAATCCAGGATAGGCT Down4 × 10 [−155] ssc-miR-24-3p UGGCUCAGUUCAGCAGGAACAG Down1.37 × 10 [−81] ssc-miR-181a AACAUUCAACGCUGUCGGUGAGUU Down1.67 × 10 [−61] ssc-miR-151-5p UCGAGGAGCUCAGUCUAGU Down6.9 × 10 [−4] Target gene prediction was performed to further understand the physiological functions and biological processes involving these miRNAs during mammary gland development and lactation, (Figure 7) based on miRNA/mRNA interactions to provide some molecular insight into the processes. [score:5]
STAT3 is a target gene of miR-21 and PCNA is the target of miR-24-3p. [score:5]
[1 to 20 of 2 sentences]
8
[+] score: 10
The known cardiac-expressed miRNAs (i. e., miR-24-2-5p, miR-542-5, miR-27b-5p, miR-7, and miR-30c-3p; see Table 1) were prominent among the miRNAs that showed a significant downregulated expression (~2-fold decrease) in the paced group compared with controls. [score:7]
The expression of miR-23a, miR-23b, and miR-24 was significantly reduced following pacing, while that of miR-133a, miR-125-3p, and miR-141 remained unchanged. [score:3]
[1 to 20 of 2 sentences]
9
[+] score: 9
The second group, e. g. ; the miR-29 family (containing miR-29a –b –c) and miR-22, miR-24, miR-27b and miR-142-5p showed increasing expression with age progression, with a particularly high expression in the adult tissues. [score:5]
Therefore, it is plausible that miRNAs prominently expressed at this time (for instance miR-24 and the miR-29 family members) might regulate this process. [score:4]
[1 to 20 of 2 sentences]
10
[+] score: 9
For example, hsa-miR-133a, hsa-miR-200b, hsa-miR-206, and hsa-miR-218 were considered as tooth tissue-specific miRNAs [4]; eight differentially expressed miRNAs were expressed during morphogenesis and seven were expressed in the incisor cervical loop containing the stem cell niche [1]; the three most highly expressed microRNAs in dental epithelium were identified as mmu-miR-24, mmu-miR-200c, and mmu-miR-205, while mmu-miR-199a-3p and mmu-miR-705 were found in dental mesenchyme [2]; and miR-200 was suggested to play an important role in the formation of incisor cervical loop during stem cell–fueled incisor growth [5]. [score:8]
Porcine ssc-miR-24 [14] was used as an internal control. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 9
Those genes targeted by several miRNAs including miR-28, miR-363, miR-2020, miR-24, miR-1207, miR-345 and miR-58 may be the cause of fluctuation of the UPS degradation for ubiquitin proteasome -dependent molecules [94] such as transcriptional coactivator PGC-1α which acts as a master regulator for mitochondrial biogenesis, to control mitochondrial gene expression indirectly. [score:7]
The correlation coefficient between qPCR and miChip data ranged from 0.543 (p = 0.0134) to 0.6833 (p = 0.0009), suggesting a good concordance between miChip and qPCR results, as shown in Fig.   4. Fig. 4qPCR validation of miChip results for four microRNAs: ssc-miR-24-3p, ssc-miR-30a-5p, ssc-miR-126 and ssc-miR-145. [score:1]
Four miRNAs (ssc-miR-24-3p, ssc-miR-30a-5p, ssc-miR-126 and ssc-miR-145) related to energy metabolism were validated by qPCR of each individual sample (n = 20). [score:1]
[1 to 20 of 3 sentences]
12
[+] score: 9
Conserved miRNAs showed comparable expression patterns and clustering revealed consistency between both approaches, e. g. miR-126, miR-24 and miR-22 were combined in the same cluster and together with miR-16, miR-21 and let-7d showed increased expression in colon compared with other loci (Figure 4). [score:4]
Interestingly, in another epithelial cell mo del it was shown that miR-19, miR-23 and miR-24 contribute to lower cell growth when inhibited [33]. [score:3]
In addition to miR-214 and MDM288, miR-19b, miR-23a, miR-24, miR-30b possessed increased expression in colon compared with other parts of the porcine intestine. [score:2]
[1 to 20 of 3 sentences]
13
[+] score: 8
For example, miR-24-3p downregulates HO-1 expression through both mRNA degradation and translational repression in MARC-145 cells 20. [score:8]
[1 to 20 of 1 sentences]
14
[+] score: 7
For example, gga-miR-18, gga-miR-193a, gga-miR-193b, gga-miR-30b, gga-miR-146a, gga-miR-24, gga-miR-92, gga-miR-7b, gga-miR-7-1, and gga-miR-7-2 are up-regulated after avian influenza virus infection in previous studies whereas in our results these miRNAs are down-regulated on PID 4 33. [score:7]
[1 to 20 of 1 sentences]
15
[+] score: 5
Further, miR-18a, miR-24, miR-146a, miR-148a and miR-214 were predicted to target the apoptosis pathway (Table 3). [score:3]
For example, miR-24, miR-146a, miR-155 and miR-214 were predicted to be involved in regulation of the Toll-like receptor (TLR) signaling pathway (Table 3). [score:2]
[1 to 20 of 2 sentences]
16
[+] score: 5
It seems that miR-24 has a functional role in the regulation of differentiation, as it can be upregulated during the early stages of differentiation but is maintained in adult terminally differentiated cardiac and skeletal muscles. [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 5
Sharbati et al. (2010) conducted miRNA cDNA library sequencing on six different sections (duodenum, anterior segment of jejunum, posterior segment of jejunum, ileum, ascending colon and transverse colon) of 31-day-old healthy piglet (EUROC × Pietrain) intestinal tissues and found that miR-194 and miR-215 were highly expressed in the duodenum and posterior segment of the jejunum and that miR-19b, miR-23a, miR-24 and miR-30b expression was higher in the colon than in other sections of the intestinal tract [29]. [score:5]
[1 to 20 of 1 sentences]
18
[+] score: 5
These miR have been implicated in multiple cellular processes including cell growth (miR-24), apoptosis (miR-16, miR-24 and miR-29), and cell cycle regulation in normal (miR-16) and cancerous cells (miR-24, miR-27, miR-29 and miR-34) [9, 40- 46]. [score:2]
Slightly below the factor-of-ten cut-off included miR-24 at 9.2. [score:1]
Conversely, miR-24 and miR-27 exhibited greatest abundance in proliferating satellite cells and the adult, while abundance of miR-368, miR-376, and miR-423-5p was greatest in the neonate. [score:1]
Conversely, research has reported low abundance during proliferation and differentiation in cell culture for these miR with the exception of miR-24, which has a moderately high abundance level during late differentiation [16]. [score:1]
[1 to 20 of 4 sentences]
19
[+] score: 5
Our previous work demonstrated yet another strategy, that miR-24-3p promotes PRRSV replication through suppression of heme oxygenase-1 (HO-1) expression [19]. [score:5]
[1 to 20 of 1 sentences]
20
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 2 sentences]
21
[+] score: 4
Moreover, several hypoxia-regulated miRNAs play roles in cell survival in hypoxic environments and have been implicated in the regulation of both upstream and downstream HIF signaling pathways, e. g., miR-20b and miR-17-92 clusters, while miR-199a regulates HIF-1α under hypoxic conditions [8– 10], and miR-107, miR-210, miR-373, miR-23, miR-24, and miR-26 are induced by HIFs [7, 11, 12]. [score:4]
[1 to 20 of 1 sentences]
22
[+] score: 3
Additionally, looking at normalised counts for each breed (Table S6), there were some miRNAs with low frequency which their expression was higher in some breed, such as Hsa-miR-193b-5p, Hsa-miR-140-5p, Ssc-miR-19b, Ssc-miR-423-5p and Ssc-miR-24 in Iberian breed, Ssc-miR-151-5p, Hsa-miR-4454, Ssc-miR-199a-3p and Ssc-miR-374b-5p in Landrace breed, Ssc-miR-486 in Piétrain breed and Ssc-let-7f and Hsa-let-7i-5p in Meishan breed. [score:3]
[1 to 20 of 1 sentences]
23
[+] score: 3
There was no target for mmu-miR-1, mmu-miR-135a-1, mmu-miR-2145, mmu-miR-24-2 or mmu-miR-29b-1 in the database. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
The top 10 highest expressed miRNAs detected by deep sequencing were miR-148a, miR-101, miR-143-3p, miR-122, miR-30a-5p, miR-21, miR-30c, miR-192, miR-27b and miR-24 (Table S1). [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
Using miRNA microarray analysis and RT-PCR, some researchers have found that miR-24, miR-31, miR-140, miR-141, miR-205, miR-200c, miR-875-5p, miR-455, miR-689, miR-711, and miR-720 may regulate tooth epithelial stem cell differentiation [6], [7]; others identified miR-133a, miR-200b, miR-206, and miR-218 as tooth-specific miRNAs, and that miR-141, miR-199b*, miR-200a, miR-200b, miR-200c, and miR-429 likely play a role in the renewal and differentiation of adult stem cells during stem cell-fueled incisor growth [8], [9]. [score:2]
Porcine ssc-miR-24 [31] was used as an internal control, and all reactions were run in triplicate. [score:1]
[1 to 20 of 2 sentences]
26
[+] score: 3
Notably, prv-miR-1, prv-miR-14a, prv-miR-17a, prv-miR-21, prv-miR-24 and prv-miR-25 were encoded directly antisense to the individually corresponding coding gene, which could theoretically lead to the cleavage of the transcript and negative regulation of the gene. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 3
0024883.g003 Figure 3 The selected miRNAs for the analysis include: miR-99b, miR-204, miR-27a, miR-24, miR-7, miR-145, miR-124, miR-21, miR-125b, miR-30b, miR-128a, miR-122, miR-183, and miR-103. [score:1]
The selected miRNAs for the analysis include: miR-99b, miR-204, miR-27a, miR-24, miR-7, miR-145, miR-124, miR-21, miR-125b, miR-30b, miR-128a, miR-122, miR-183, and miR-103. [score:1]
0024883.g002 Figure 2 The selected miRNAs for the analysis include: miR-99b, miR-204, miR-27a, miR-24, miR-7, miR-145, miR-124, miR-21, miR-125b, miR-30b, miR-128a, miR-122, miR-183, and miR-103. [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Similarly, Jin et al. (2014a) demonstrated a differential expression of nine miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486, and let-7a-5p, miR-2339, miR-499, miR-23a, and miR-99b) upon challenge of MACT-cells (bovine mammary epithelia cell line) with heat inactivated E. coli and S. aureus bacteria. [score:3]
[1 to 20 of 1 sentences]
29
[+] score: 2
MiR-24 has been linked to the inhibition of skeletal muscle differentiation by transforming TGF-β [46]. [score:2]
[1 to 20 of 1 sentences]
30
[+] score: 1
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-15a, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
Obviously, high-abundant miRNAs (let-7c, let-7f, miR-148a, miR-21 and miR-24) had higher edited probability in backfat tissue. [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
Consequently, while the endogenous porcine miRNAs (ssc-miR-16, ssc-miR-24 and ssc-miR-25) were completely degraded (Fig.   2B and Supplementary Fig.   S2B,C), the maize-derived miRNAs (zma-miR164a-5p, zma-miR167e-5p, zma-miR168a-5p, zma-miR319a-3p and zma-miR408a-3p) exhibited similar abundance to synthetic miRNA with 2′-O-methylated 3′ ends, implying resistance to periodate oxidation, and thus were bona fide plant miRNAs (Fig.   2C–G). [score:1]
[1 to 20 of 1 sentences]
32
[+] score: 1
Finally, it is worth noting that many others important for vascular remo deling and smooth muscle phenotypic control, such as miR-133 [88], miR-143 [91], miR-99b [92], miR-23a [93], miR-138 (ENSSSCT00000021566) [94], miR-29c [95], miR-125a (ENSSSCT00000020936) [95], and miR-24 [96]), are included in this network. [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, hsa-mir-1-1, hsa-mir-128-2, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-133b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-23b, ssc-mir-148b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-378j, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
In addition to the best-studied myomiRs (miR-1, -206 and miR-133 families), 11 other DE muscle-related miRNAs (miR-378 [24], miR-148a [27], miR-26a [28, 29], miR-27a/b [30, 31], miR-23a [32, 33], miR-125b [34], miR-24 [35], miR-128 [36], miR-199a [37] and miR-424 [38]) with high abundance (average RPM >1,000) and another 14 (miR-181a/b/c/d-5p [26], miR-499-5p [11], miR-503 [38], miR-486 [39], miR-214 [40], miR-29a/b/c [41– 43], miR-221/222 [44] and miR-208 [11] with low abundance (average RPM <1,000) were detected in myogenesis of pig. [score:1]
[1 to 20 of 1 sentences]