sort by

14 publications mentioning ssc-mir-148b

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-148b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 29
This study used high-throughput sequencing to compare miRNA expression in pigs susceptible and resistant to E. coli F18 infection and identified 12 miRNAs with differential expression, including 11 upregulated in susceptible animals, ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and one down-regulated, ssc-miR-152. [score:11]
Moreover, miR-148b expression is low in gastric cancers and suppresses cell differentiation through its tumor suppressor function [24]. [score:7]
These included 11 with increased miRNA expression in E. coli F18-sensitive pigs, ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and one with reduced miRNA expression, ssc-miR-152. [score:5]
In another important human disease, diabetes, the study by Melkman et al. [5] into the effects of miRNAs on insulin synthesis revealed that knocking out miR-24, miR-26, miR-182, or miR-148 reduced the transcriptional activity of the insulin gene promoter, thereby reducing the level of insulin mRNA. [score:4]
As no commercial TaqMan miRNA assay kit is available for ssc-miR-30e, ssc-miR-148b, and ssc-miR-181a, we conducted qRT-PCR validation of the remaining nine target miRNAs between E coli F18-sensitive and -resistant groups with an increased sample size. [score:2]
[1 to 20 of 5 sentences]
2
[+] score: 14
As shown in Figure 6, qualitative qPCR validated that ssc-miR-146a-5p, ssc-miR-221-5p and ssc-miR-148b-3p were significantly upregulated by LPS, and ssc-miR-215 and ssc-miR-192 were downregulated. [score:7]
After normalization of the raw reads we found that four miRNAs (ssc-miR-146a-5p, ssc-miR-221-5p, ssc-miR-9860-5p and ssc-miR-148b-3p) were significantly upregulated in the LPS-challenged samples with a p-value cutoff of 0.05. [score:4]
Differential expressions of five selected miRNAs (ssc-miR-146a-5p, ssc-miR-221-5p, ssc-miR-148b-3p, ssc-miR-215 and ssc-miR-192) were validated by quantitative polymerase chain reaction (qPCR). [score:3]
[1 to 20 of 3 sentences]
3
[+] score: 12
miRNA Name Sequence (5'–3') Regulation p-Value ssc-miR-21 TAGCTTATCAGACTGATGTTGA Up 0 ssc-miR-148b-3p UCAGUGCAUCAGAACUUUGU Up 0 ssc-miR-92a TATTGCACTTGTCCCGGCCTGT Up3.4 × 10 [−135] ssc-miR-423-3p AGCUCGGCUGAGGCCCCUCAGU Up1.1 × 10 [−154] ssc-miR-26 TTCAAGTAATCCAGGATAGGCT Down4 × 10 [−155] ssc-miR-24-3p UGGCUCAGUUCAGCAGGAACAG Down1.37 × 10 [−81] ssc-miR-181a AACAUUCAACGCUGUCGGUGAGUU Down1.67 × 10 [−61] ssc-miR-151-5p UCGAGGAGCUCAGUCUAGU Down6.9 × 10 [−4] Target gene prediction was performed to further understand the physiological functions and biological processes involving these miRNAs during mammary gland development and lactation, (Figure 7) based on miRNA/mRNA interactions to provide some molecular insight into the processes. [score:5]
For example, DNMT1, PTEN and WNT1 were the putative target genes of miR-148/152 family. [score:3]
Furthermore, DNMT1 was found in breast cancer and verified as a target for miR-148 [30]. [score:3]
Chen Y. Song Y. X. Wang Z. N. The microRNA-148/152 family: Multi-faceted players Mol. [score:1]
[1 to 20 of 4 sentences]
4
[+] score: 12
Moreover, 13 miRNAs were differentially expressed: 8 were upregulated (ssc-miR-132, ssc-miR-146b, ssc-miR-215, ssc-miR-371, ssc-miR-27a, ssc-miR-331-3p, ssc-miR-432-5p and ssc-miR-199a/b-3p), while 5 were down-regulated after PRV infection (ssc-mir-10a-5p, ssc-mir-148-3p, ssc-mir-219a, ssc-mir-374b-3p and ssc-miR-532-5p) (Fig 7). [score:9]
Expression of miR-148 is regarded as a potential biomarker in non-small-cell lung cancer [45]. [score:3]
[1 to 20 of 2 sentences]
5
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, hsa-mir-1-1, hsa-mir-128-2, hsa-mir-29c, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-148b, hsa-mir-133b, hsa-mir-424, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-mir-181c, ssc-mir-214, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-128-1, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-503, hsa-mir-411, hsa-mir-378d-2, hsa-mir-208b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-221, ssc-mir-133a-1, ssc-mir-1, ssc-mir-503, ssc-mir-181a-1, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-29a, ssc-mir-199a-2, ssc-mir-128-2, ssc-mir-499, ssc-mir-143, ssc-mir-10a, ssc-mir-486-1, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-23b, ssc-mir-208b, ssc-mir-424, ssc-mir-127, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-411, ssc-mir-133a-2, ssc-mir-126, ssc-mir-199a-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-378j, ssc-let-7d, ssc-let-7f-2, ssc-mir-29b-2, hsa-mir-486-2, ssc-mir-378b
Similarly, ssc-miR-148b, -542-3p and -30 family (a-5p/d/e-5p) showed similar expression patterns with ssc-miR-148a and -126, highly expressed and down-regulated at 77 dpc to 180 dpn (Figure 5E), making it possible that they belong to the candidate myogenic miRNAs. [score:8]
[1 to 20 of 1 sentences]
6
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Ye et al. (2012) examined miRNA expression in the duodenum of E. coli F18-sensitive and -resistant weaned piglets and identified 12 candidate miRNA (ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and ssc-miR-152) disease markers. [score:5]
Similarly, Jin et al. (2014a) demonstrated a differential expression of nine miRNAs (bta-miR-184, miR-24-3p, miR-148, miR-486, and let-7a-5p, miR-2339, miR-499, miR-23a, and miR-99b) upon challenge of MACT-cells (bovine mammary epithelia cell line) with heat inactivated E. coli and S. aureus bacteria. [score:3]
[1 to 20 of 2 sentences]
7
[+] score: 6
The miR-148 family, including miR-148a and miR-148b, has been reported to be negative regulators of the innate immune response, which in turn inhibit the production of cytokines including TNF-α in dendritic cells (53). [score:4]
Liu X., Zhan Z., Xu L., Ma F., Li D., Guo Z., Li N., and Cao X. 2010 MicroRNA-148/152 impair innate response and antigen presentation of TLR-triggered dendritic cells by targeting CaMKIIα. [score:2]
[1 to 20 of 2 sentences]
8
[+] score: 5
Healthy trophoblast expressed 1 miRNA, miR-148b, which approached significance (p<0.10), at a higher level than arresting trophoblast. [score:3]
ssc-miR-10a (JX185556); ssc-miR-29a (JX185557); ssc-miR-30b-5p (JX185558); ssc-miR-99a (JX185559); ssc-miR-148b (JX185560); ssc-miR-323 (JX185552); ssc-miR-331-5p (JX185553); ssc-miR-339-3p (JX185554); ssc-miR-374b-5p (JX185562); RNU1A (JN617883); AhR (KC012627), CCNG1 (KC012621); CDC42 (KC012622); DNMT3A (KC012620); FADD (KC012625); FOXO1 (KC012619); GPR37 (KC012626); IFI30 (KC012618); MMD (KC012628); USF2 (KC012623); USP46 (KC012624). [score:1]
While no significant differences were observed by microarray between healthy and arresting trophoblast, miR-148b verged on significance (p<0.10), and was assessed by Real-Time PCR but the results did not significantly differ. [score:1]
[1 to 20 of 3 sentences]
9
[+] score: 5
Allele-specific targeting of HLA-G, a non-classical HLA class I locus, by miR-148a and miR-148b, is associated with risk of asthma [41]. [score:3]
This can be explained by the additional accessibility criterion of PACMIT as sites considered as created or disrupted by PACMIT may only reveal changes in secondary structures which are not predicted by TargetScan (e. g. the created ssc-miR-339-5p and ssc-miR-4334-3p sites in CREBL1 3′-UTR, and the disrupted ssc-miR-148a, ssc-miR-148b and ssc-miR-152 sites in HSPA1A). [score:2]
[1 to 20 of 2 sentences]
10
[+] score: 4
MiR-30a and miR-148 are both involved in adipocyte differentiation, downregulated in obese adipose tissue in mice and are involved in myogenic differentiation [37– 39]. [score:4]
[1 to 20 of 1 sentences]
11
[+] score: 3
Our results were consistent with previous studies, which demonstrated miR-29 targeting to the collagen family members such as COL4A1, COL1A2 and COL1A1 at ADU time points, miR-148 to the MITF and EIF4BP2 genes at early embryonic stage, and miR-487 to the IRS1 gene at the middle stage [23, 24]. [score:3]
[1 to 20 of 1 sentences]
12
[+] score: 2
Some miRNAs, which were involved in similar regulation patterns or pathway functions, were clustered together, such as miR-148b-3p and miR-152. [score:2]
[1 to 20 of 1 sentences]
13
[+] score: 2
The genetic regulated miRNAs miR-34a, miR-30e, miR-148-3p, miR-204, miR-181-5p, miR-143-5p and let-7g were also correlated with haematological and biochemical traits. [score:2]
[1 to 20 of 1 sentences]
14
[+] score: 1
Based on the RPKM values, the top four of the DE miRNAs were miR-let-7a, miR-99a, miR-374a-5p, and miR-148b-3p, whose sum of RPKM varied from approximately 2,035 to 9,865. [score:1]
[1 to 20 of 1 sentences]