sort by

18 publications mentioning zma-MIR528b

Open access articles that are associated with the species Zea mays and mention the gene name MIR528b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 67
Here we tested the mRNA levels for maize GRMZM2G146152_T01 (laccase-like, LAC2) as target for miR397, GRMZM2G058522_T01 (SOD9) as validated target for miR398 (Shen et al., 2013), GRMZM2G106928_T01 (SOD-1A) and GRMZM2G107562_T01 (plastocyanin-like protein, PLC) as targets for miR528, and GRMZM2G384327_T03 (Gamma Response 1 protein, GR1), as previously predicted miR408 target (Li et al., 2013a). [score:9]
miR397 target: GRMZM2G146152_T01 (LAC2); miR398 target: GRMZM2G058522_T01 (SOD9); miR408 target: GRMZM2G384327_T03 (GR1); miR528 targets: GRMZM2G106928_T01 (SOD1A) and GRMZM2G107562_T01 (PLC). [score:9]
Our finding on miR528 distribution in maize EC polysomal fractions supports the notion that target regulation is probably exerted at multiple levels depending on the developmental process, miRNA, and analyzed target. [score:7]
Only miR528 was detected in polyribosomal fractions (F 10–18) suggesting this miRNA could regulate some of its targets at translation level. [score:6]
In agreement, we observed such expected inverse correlation between miR528 and SOD1A target, but not for PLC target. [score:5]
The authors suggested miR164, miR169, miR528, and miR529 might be primarily participating in the process of EC induction through the regulation of targets involved in auxin and gibberellin signaling. [score:4]
In a previous study performed on VS-535-derived EC, we found that development-related miRNAs such as miR156, miR159, miR164 and miR168 decreased as the length of subculture increased, while stress-related miRNAs such as miR397, miR398, miR408, and miR528 remained highly expressed (Dinkova and Alejandri-Ramirez, 2014). [score:4]
Taking into account the expected relevance for miR528 -mediated regulation in SE, we tested, in addition to SOD1A, the expression levels of GRMZM2G107562_T01 that codes for a plastocyanin-like protein (PLC). [score:4]
Others represent enzymes involved in plant stress response (targets of miR397, miR398, miR408, miR528) or the miRNA biogenesis pathway itself (miR168). [score:3]
To assess the possible role of some conserved miRNAs at translation level, polyribosomal fractions were obtained from 2 years-subcultured VS-535 EC and the presence of miR159, miR168, miR398, and miR528 was analyzed (Figure 5). [score:3]
For other stress-related miRNA targets, such as SOD9 (miR398), SOD1A (miR528) and GR1 (miR408), lower levels were also detected in H-565 than in VS-535, particularly in differentiating tissues under light (Figure 4A vs. [score:3]
They identified miR528, miR156, miR166, miR168, miR390, miR164, miR167, miR398, miR397, miR408, and miR319 as the most abundant during dedifferentiation. [score:1]
Figure 4B, lower panels corresponding to miR528). [score:1]
Unlike SOD1A, PLC showed a very weak correspondence with miR528 changes. [score:1]
On the other hand, the stress-related miR397, miR398, miR408 and miR528, become enriched upon callus induction and remain at high levels once the proliferation is established. [score:1]
Similarly, SOD1A showed a clear inverse correlation with miR528 levels for both, VS-535 and H-565, in darkness but not in light (Figure 4, upper panels corresponding to miR528). [score:1]
In our miR528 target prediction analysis, several copper -binding protein encoding transcripts, many uncharacterized genes and even transcription factors were found (Supplementary Material, Table S2). [score:1]
miR528 is one of the most abundant, stress-related miRNAs in SE for maize (Shen et al., 2013), rice (Luo et al., 2006; Chen et al., 2011), and citrus (Wu et al., 2015). [score:1]
Figure 5 miR528 is localized on polyribosomes. [score:1]
Particularly, the stress-related miR397, miR398, miR408, and miR528 showed about two-fold reduction in VS-535 fully developed plantlets with respect to dedifferentiated tissues (100% hormones). [score:1]
Polyribosomal distribution of miR528 in maize EC. [score:1]
[1 to 20 of 21 sentences]
2
[+] score: 56
In the expression analysis of miRNA targets, the following primers were used: miR397 target (F/5′ GTTCGATGTGCAAATGACCAA 3′; R/5′ CCGTCACGATGCTCTTGCT 3′), miR398 target (F/5′ TCTCATTATTCTCATGTGTTCTCAGTTC 3′; R/5′ CGGCGACGGCAACAAG 3′), miR408 target (F/5′ CCAAGAGACGCCAGTGAAGAG 3′; R/5′ TACTGCCCGTTCACCGTGAT 3′) and miR528 target (F/5′ CCCAGCACTCATTCCATAGCA 3′; R/5′ CCCAGCACTCATTCCATAGCA 3′). [score:12]
In maize, four Cu-miRNAs - miR397, miR398, miR408 and miR528 - were up-regulated and their targets were down-regulated in response to H. seropedicae inoculation. [score:9]
A hypothetical mo del involving copper-miRNA is proposed, emphasizing the fact that the up-regulation of miR397, miR398, miR408 and miR528, which is followed by inhibition of their targets, can facilitate association with diazotrophic bacteria. [score:8]
The one exception was the putative target of miR528; in plants inoculated with A. brasilense an increase in mRNA accumulation was observed, suggesting that in this situation, this mRNA is either not a target of miR528, or there is an additional layer of transcriptional control of its expression. [score:7]
In plants inoculated with endophytic diazotrophic bacteria, an inverse miRNA/target regulation was observed: miR397, miR408 and miR528 were induced, and their targets were repressed. [score:6]
The results confirmed an increase in expression of miR397, miR398, miR408 and miR528 in plants inoculated with H. seropedicae (Figure 5). [score:3]
Relative expression of miR397, miR398, miR408 and miR528 in response to inoculation with A. brasilense and H. seropedicae. [score:3]
The described targets of miR397, miR408 and miR528 in maize are laccases and cupredoxins [64], important copper protein families with redox activities [65] whose domains are conserved in other enzymes [66]. [score:3]
The expression profiles of four Cu-miRNAs (miR397, miR398, miR408 and miR528) were assayed by stem–loop qRT-PCR [105, 106]. [score:2]
Moreover, miR397 and miR528 are also classified as Cu-miRNA because they regulate proteins involved in copper homeostasis. [score:2]
The miR528, for instance, is an example of monocot-specific miRNA [77]. [score:1]
[1 to 20 of 11 sentences]
3
[+] score: 39
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR529, zma-MIR827, zma-MIR1432, zma-MIR444a, zma-MIR444b
MiR528 and miR408 both were up-regulated by 2.6 folds, but the basal expression frequency of miR528 was 214,196 whereas the basal expression frequency of miR408 was only 2,571. [score:8]
These 17 targets were targets of 11 miRNA families (miR156, miR164, miR166, miR167, miR168, miR169, miR319, miR393, miR408, miR528 and zma-miRn6). [score:5]
A-K represented the expression profiles of some predicted target genes of miR156, miR164, miR166, miR167, miR168, miR169, miR319, miR393, miR408, miR528 and zma-miRn6 in dry and imbibed seeds, respectively. [score:5]
Rice miR528 had been shown to be down-regulated during the early submergence phase and induced after 24 h of submergence in maize roots [70]. [score:4]
MiR528 was up-regulated upon imbibition and also was the most abundant miRNAs in the imbibed seed. [score:4]
The 4 up-regulated families were miR398, miR408, miR528 and miR529. [score:4]
Copper proteins, cupredoxin, multicopper oxidase and laccase genes have been predicted as targets of miR528, only Cu [2+] -binding domain-containing protein (CBP) was experimentally validated in sugarcane [72]. [score:3]
MiR408 and miR528, whose potential target genes are predominantly involved in energy metabolism and scavenging of the oxidative species produced during stress. [score:3]
There was a stable strong repression of miR528 in maize both roots and shoots under the low N condition [71]. [score:1]
The most abundant families were miR156/miR157, miR166, miR168 and miR528, and the least abundant families were miR162 and miR399 (Figure 3). [score:1]
To validate conserved miRNAs identified and novel ones predicted, quantitative RT-PCR (qRT-PCR) was performed on 10 randomly selected miRNAs, miR156, miR159, miR166, miR167, miR319, miR408, miR528, zma-miRn6, zma-miRn15 and zma-miRn37 in dry and imbibed seed. [score:1]
[1 to 20 of 11 sentences]
4
[+] score: 33
While the expression of Zma-miR528 was significantly down-regulated from 7- to 15-DAP endosperms, a rapid up-regulation of Zma-miR167 was observed at 10- and 15-DAP. [score:9]
Therefore, a high abundance of miR397 and miR528 would directly repress the expression of AO and indirectly repress that of DHA, maintain a high rate of cell division, and thereby promote plant growth. [score:5]
In addition, Zma-miR528 and Zma-miR167 showed dramatically varied expression patterns during endosperm development. [score:4]
It has been predicted that one target of miR528 and miR397 is the L-ascorbate oxidases (AO) gene, which would increase the accumulation of dehydroascorbate (DHA) and in turn restrict cell-division ability (Potters et al., 2000; Pignocchi et al., 2006). [score:3]
Similarly, Zma-miR408 also exhibited similar expression trends to Zma-miR528 and Zma-miR397, which might contribute to the phenotypic difference between these two reciprocal crosses (Figure 4B). [score:3]
Among them, Zma-miR168, Zma-miR166, Zma-miR156, Zma-miR528, Zma-miR827, and Zma-miR167 were the top six most abundantly expressed miRNAs in both reciprocal crosses, corresponding to more than 98% of the total number of known miRNAs (Table S2, Figure 2A). [score:3]
Moreover, seven out of 36 miRNAs, including osa-miR167, osa-miR397, osa-miR398, osa-miR408, osa-miR528, osa-miR1866-3p, and osa-miRc11 were also preferentially expressed in rice seeds according to miRNA chip data in subspecies of japonica (Xue et al., 2009). [score:3]
For example, the expression levels of Zma-miR528 and Zma-miR397 were clearly higher in the Mo17 × B73 cross than in B73 × Mo17 in 5-DAP kernels and 7-DAP endosperms (Figure 4B). [score:3]
[1 to 20 of 8 sentences]
5
[+] score: 30
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR528a, zma-MIR529, zma-MIR827, zma-MIR390b
The candidate target gene of of miR528 encodes antifreeze protein (AFP), and the expressions of miR528 and AFP gene both increased in latter stages during maize seed development (Fig 3C). [score:6]
The accumulation of miR528 in the late development of maize kernel suggests that it might participate in the control of stress responses during the process of nutrient storage by regulating the expression of AFP gene. [score:5]
Another miRNA family which showed highest accumulation in the late stage of maize kernel development was miR528, with highest expression at 18–23 DAP, which was consistent with the results of its filial line Zhengdan 958 [72]. [score:4]
dicoccoides, miR528 was down-regulated in leaves during drought stress [102], pointing to the role of miR528 in stress response. [score:4]
Further analysis revealed that miR528 has no sequence complementarity to the promoter region of AFP genes, which indicates that the expression of AFP gene might be influenced by other factors in addition to miR528. [score:3]
Finally, the miRNA families with higher expression levels in the latter stage of nutrient storage such as miR167 and miR528 might participate in metabolism and stress response (Fig 4). [score:3]
miR159, miR164, miR166, miR171, miR390, miR399, and miR529 families might play roles in the embryogenesis of maize grain by participating in transcriptional regulation and morphogenesis, while miR167 and miR528 families might play roles in the process of nutrient storage by participating in the metabolism process and stress response. [score:2]
Conserved miRNAs that accumulated more in the late developmental stage of maize seed include miR156, miR167, miR398, and miR528 families. [score:2]
Recent studies showed that miR528 is significantly repressed during low nitrate conditions in maize roots and shoots [48], while in Triticum. [score:1]
[1 to 20 of 9 sentences]
6
[+] score: 24
Rice miR528 had been shown to be down-regulated during the early submergence phase and induced after 24 h of submergence in maize roots [53]. [score:4]
Six miRNAs (miR167, miR169, miR395, miR399, miR408, and miR528) were found in roots in response to the chronic low nitrate condition, all of which were down-regulated (Table S2). [score:4]
Nine miRNA faimlies (miR164, miR169, miR172, miR397, miR398, miR399, miR408, miR528, and miR827) were identified to be differentially expressed in leaves in response to chronic low N condition. [score:3]
Given our results, it can be suggested that miR399 might play a role in reducing Pi transport to keep a balance between N and P. MiR528 was found to be repressed in response to drought stress in leaves in T. dicoccoides and there are no verified target genes [52]. [score:3]
With regards to tissue specificity(or tissue dependent), some miRNAs were only regulated in roots or leaves, such as miR160, miR167, miR168, miR319 and miR395 in roots, and miR164, miR172, miR397, miR398 and miR827 in leaves, while some others were regulated in both tissues, such as miR169, miR399, miR408 and miR528 (Fig. 4). [score:3]
The second category includes miR395, miR397, miR398, miR399, miR408, miR528, and miR827, whose potential target genes are predominantly involved in energy metabolism and scavenging of the oxidative species produced during stress. [score:3]
Nine miRNA families (miR164, miR169, miR172, miR397, miR398, miR399, miR408, miR528, and miR827) were identified in leaves, and nine miRNA families (miR160, miR167, miR168, miR169, miR319, miR395, miR399, miR408, and miR528) identified in roots. [score:1]
Other multi-copper oxidases that showed a similar pattern to miR397 include miR408/GRMZM2G066260 (Cupredoxin) (Fig. 3) and miR528/GRMZM2G367668 (multi-copper oxidase)(Fig. 3), suggesting that multi-copper oxidase activity involved in electron transport and in oxidase activity might be an important aspect of the physiological response to N limitation. [score:1]
Among these miRNAs, miR169 (169p; 169f,g,h; 169i,j,k), miR399 (399d,j), miR408, and miR528 (528a,b) were found to be N-responsive in both leaves and roots (Fig. 1). [score:1]
In our case, the stable strong repression of miR528 was found in both roots and shoots under the low N condition. [score:1]
[1 to 20 of 10 sentences]
7
[+] score: 20
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR390, osa-MIR444a, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1432, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR408b, zma-MIR528a, zma-MIR827, zma-MIR1432, zma-MIR390b, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, zma-MIR444a, osa-MIR6251
For those miRNAs that showed similar expression patterns between maize and rice, i. e., miR156, miR166, miR168, miR172, miR2275 and miR528, GO enrichment analysis of their predicted targets was applied (Additional file 13). [score:5]
On the contrary, miR528 family, regulators of cupredoxin domains involving oxidative stress responses [43], was expressed higher in maize than rice during de-etiolation process (Additional file 8). [score:4]
Beta- CA5 (GRMZM2G145101) was predicted to be a target of miR528 in maize. [score:3]
miR528 was reported to regulate seed development in rice and response to drought/waterlogging stress in maize and rice [43, 58]. [score:3]
Beta- CA5 (GRMZM2G145101) was also predicted to be a binding target of miR528 in maize (Table  1). [score:3]
Thus the regulation of miR528 to beta- CA is more likely a response to environmental stress, in this case, a sudden exposure to light during de-etiolation process. [score:2]
[1 to 20 of 6 sentences]
8
[+] score: 19
Targets such as cupredoxin (miR408 and miR528 targets) are involved in oxidative stress response [60]. [score:5]
These 13 targets are targeted by 8 miRNA families (miR159, miR164, miR167, miR172, miR319, miR393, miR528, miRn7) (Table S9), which are active participants in the signal transduction at the early stage of hypoxia conditions. [score:5]
miR408 and miR528 target cupredoxin, which are involved in oxidative stress response signal by mediating electron-transfer or oxidation homeostasis and protecting cellular structures. [score:3]
Both miR408 and miR528 target cupredoxin. [score:3]
miR159, miR164, miR167,miR393, miR408 and miR528, which are involved in root cap formation, lateral root development, root/shoot elongation and plant cell detoxification by scavenging the reactive oxygen species and thus protecting damage to cellular structure were induced under short waterlogging conditions in waterlogging tolerant line Hz32 and repressed in waterlogging sensitive line Mo17. [score:2]
In B73, the mid-tolerant line, miR159, miR408 and miR528 (similar to Hz32) are induced while miR164, miR167 and miR393 (similar to Mo17) are reduced, suggested the repression of ABA and cupredoxin signals and the induction of auxin signals at the initial stages of waterlogging. [score:1]
[1 to 20 of 6 sentences]
9
[+] score: 16
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR529, zma-MIR827, zma-MIR1432, zma-MIR444a, zma-MIR444b
We noted that miR482 lacks an expression signature in any of the five tissues, while miR162 miR394, miR395, miR398, miR399, miR408, miR528 and miR1432 had low expression counts (less than 200 RPM). [score:5]
Similar to miR397 and miR408, miR528 also targets copper proteins cupredoxin, multicopper oxidase and laccase genes and thus might play a critical role in regulating physiological processes (photosynthetic and respiratory electron transport) and stress responses. [score:4]
We also predicted potential targets of miRNA families not previously identified in maize (miR482, miR528, miR529, miR827 and miR1432). [score:3]
Target genes of miRNA families, miR164, miR397, miR408, and miR528 showed enrichment in laccase and oxidoreductase activities and were found to be involved in secondary metabolic processes such as phenylpropanoid, amino acids, aromatic compounds and lignin catabolic processes (Table S7). [score:3]
These families are: miR156, miR160, miR164, miR166, miR167, miR172, miR396, and miR528. [score:1]
[1 to 20 of 5 sentences]
10
[+] score: 16
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR528a, zma-MIR827, zma-MIR390b, zma-MIR444a, zma-MIR444b
To identify the expression patterns of key miRNAs and their targets that are related to maize kernel development, we selected four miRNAs highly expressed in the embryo and endosperm, respectively, including miR167, miR528, miR171, miR2118 and their four targets for further validation by qRT-PCR. [score:10]
Meanwhile, zma-miR167c-3p and zma-miR528-5p were expressed more highly in the embryo than the endosperm (Figure 6a,c). [score:3]
MiR528 was highly expressed in the embryo at three stages (Figure 3c). [score:2]
Among them, miR166 was the most abundant family (17,602) followed by miR171 (11,988), miR827 (7686), miR167, miR396, miR528, miR156, miR408, miR160, miR390, miR159, miR444, miR319, miR398, miR168, miR394, miR164, miR393 and miR169 (Figure 3a). [score:1]
[1 to 20 of 4 sentences]
11
[+] score: 11
The greatest number of potential targets of Zea mays miRNAs was for the P111 gene targetted by eighteen different miRNAs (miR156j-3p, miR160a-3p, miR164c-3p, miR164h-3p, miR164h-5p, miR166k-5p, miR166l-5p, miR168b-3p, miR171b-5p, miR171f-5p, miR319a-5p, miR319c-5p, miR399h-5p, miR408b-5p, miR444a, miR444b, miR528a-3p, and miR528b-3p), in combination, at a total of 13 loci of P111 gene. [score:5]
miRNAs targeting both P50 and P111 genes at the same loci were miR164c-3p and miR164h-3p (locus 1009), miR171b-5p and miR171f-5p (locus 1300), miR319a-5p and miR319c-5p (locus 1454), miR444a and miR444b (locus 2466), and miR528a-3p and miR528b-3p (locus 1009). [score:3]
For P50 gene of MCMV, 11 targeting miRNAs were predicted (miR160a-3p, miR164c-3p, miR164h-3p, miR166l-5p, miR171b-5p, miR171f-5p, miR319a-5p, miR319c-5p, miR408b-5p, miR528a-3p, and miR528b-3p). [score:3]
[1 to 20 of 3 sentences]
12
[+] score: 8
The second group consisted of 4 N-limitation downregulated miRNAs including miR171, miR528, miRC19 and miRC37. [score:4]
The predicted targets of miR528 and miRC19 were involved signal transduction pathways. [score:3]
miR528 and miRC19 might shed another light on understanding the molecular basis underlying N sensing/signaling. [score:1]
[1 to 20 of 3 sentences]
13
[+] score: 7
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR394a, ath-MIR394b, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ath-MIR827, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR482, zma-MIR528a, zma-MIR529, zma-MIR827, zma-MIR1432, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
Two members, zma-miR528a and zma-miR528b in zma-miR528 family, however, their expression levels were similar and were detected 147,619 and 158,200 times, respectively. [score:3]
MiRNA528 targets copper proteins, cupredoxin, multicopper oxidase and laccase genes and thus might play a critical role in regulating physiological processes and stress responses. [score:3]
In our datasets, miRNA166 showed the highest abundance followed by miRNA156 and miRNA528, respectively, during the very early stage of seed germination. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 5
Recent studies suggested that miR528 showed significant repression under low nitrate condition in maize roots and shoots [34], while in T. dicoccoides, miR528 was down-regulated in leaves during drought stress [35]. [score:4]
Zma-miR168 and zma-miR528 were the top sequenced in seeds and leaves, respectively (Additional file 1). [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 3
Similarly, while miR169, miR528, and miR529 are more abundant in lbl1, transcript levels for their targets remain unchanged in the mutant. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 1
For example, Li_TCONS_00096947 and Li_TCONS_00064018 could be bound by zma-miR169n-3p and zma-miR169q-3p, and Boerner_Z27kG1_01046 could be bound by zma-miR408b-3p:zma-miR408a, zma-miR528a-3p:zma-miR528b-3p and zma-miR164b-3p (Fig.   6). [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
Other miRNAs from this paper: zma-MIR528a, sbi-MIR528, bdi-MIR528
Modified polymerase chain reactions were performed as described in the protocols section of the WMD3 website to engineer the amiRNA sequences into the endogenous O. sativa microRNA precursor osa-MIR528 in the PNW55 vector [78]. [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR528a, zma-MIR827
Five of them—miR169, miR171, miR393, miR395, and miR528—are responsive to drought and/or salt stress [47]– [53]. [score:1]
[1 to 20 of 1 sentences]