sort by

11 publications mentioning hsa-mir-514b

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-514b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-199a-1, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-205, hsa-mir-214, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-141, hsa-mir-144, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-146a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-29c, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-133b, hsa-mir-429, hsa-mir-487a, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-526b, hsa-mir-514a-1, hsa-mir-514a-2, hsa-mir-514a-3, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-656, hsa-mir-542, hsa-mir-378d-2, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-2114, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-378c, hsa-mir-4303, hsa-mir-4309, hsa-mir-4307, hsa-mir-4278, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Only one report by Wotschofsky et al. detected has-miR-514b and identified that the expression of has-miR-514b was downregulated in primary metastatic renal cell carcinoma [37]. [score:6]
The aberrantly expression miRNAs such as has-miR-214*, has-miR-105, has-miR-548n, and has-miR-514 which are upregulate in gastric cancerous tissues. [score:6]
The expression level of miR-214* is increased 3.79-fold (Figure 4(a)), miR-105 is increased 16.32-fold (Figure 4(b)), has-miR-548 is 4.21-fold (Figure 4(c)), and miR-514 is increased 11.76-fold (Figure 4(d)) in comparing with normal tissues. [score:3]
We selected hsa-miR-105, hsa-miR-214*, hsa-miR-514b, and has-miR-548n to test in 24 paired gastric normal and tumor tissues. [score:1]
[1 to 20 of 4 sentences]
2
[+] score: 5
Among the differentially expressed miRNAs, 11 (miR-199a-5p, miR-218, miR-409a, miR-433, miR-511, miR-514, miR-551, miR-562, miR-556-3p, miR-1178 and miR-1205) were common to both doses (Figure 2D) and exhibited similar expression patterns (Tables 1A and C). [score:5]
[1 to 20 of 1 sentences]
3
[+] score: 5
9 cluster members (miR521, 520e, 373*, 373, 367) were not detected in both baboon liver and lymphocytes; however, miR514 cluster member on chr X was expressed in the liver and not detected in lymphocytes. [score:3]
Interestingly, miR-514 is known to have different copy numbers among primate species; three copies in human, four in chimpanzee and one in other primates [46], an indication that miRNA duplications may exhibit an evolutionary temporal pattern. [score:1]
Further, we noted that miR-514, a cluster member on the X chromosome was differentially detected in baboon liver and lymphocytes. [score:1]
[1 to 20 of 3 sentences]
4
[+] score: 4
Finally, our analysis identified a cluster of testis-enriched miRNAs located on chromosome X, including miR-506, miR-507, miR-508 and miR-514, that was previously reported as preferentially expressed in testis [32]. [score:3]
Our analysis also revealed a cluster conserved in horse on chromosome X, consisting of miR-514 and miR-8908n. [score:1]
[1 to 20 of 2 sentences]
5
[+] score: 3
Here, we describe the identification of a set of deregulated miRNAs in TGCT and the role of miR-514-3p and NF- κB in TGCT. [score:2]
This cluster is conserved in primates, and consists of seven distinct miRNAs, that is, miR-506, miR-507, miR-508, miR-509, miR-510, miR-513 and miR-514. [score:1]
[1 to 20 of 2 sentences]
6
[+] score: 1
In our experiments we did not observe induction of miR-514b (data not shown), which is located approximately 10 kbps upstream of miR-508. [score:1]
[1 to 20 of 1 sentences]
7
[+] score: 1
Zhang et al. showed that the duplications of another subfamily (miR-514) in this cluster occurred independently in humans and chimpanzees [6]. [score:1]
[1 to 20 of 1 sentences]
8
[+] score: 1
No hsa-miR-10b-3p ACAGAUUCGAUUCUAGGGGAAU 204514 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG 204753 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG 204373 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC 204407 hsa-miR-99b-3p CAAGCUCGUGUCUGUGGGUCCG 204064 hsa-miR-99b CACCCGUAGAACCGACCUUGCG 204367 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC 204446 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA 204339 hsa-miR-126-5p CAUUAUUACUUUUGGUACGCG 204584 hsa-miR-126 UCGUACCGUGAGUAAUAAUGCG 204227 hsa-miR-202-5p UUCCUAUGCAUAUACUUCUUUG 204730 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA 204101 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU 204507 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA 204539 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA 204480 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG 204077 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG 204458 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG 204503 hsa-miR-514 AUUGACACUUCUGUGAGUAGA 204645 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA 204063 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG 204306 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU 204593 First strand of cDNA was synthesized using a Universal cDNA Synthesis Kit II (Exiqon, Cat. [score:1]
[1 to 20 of 1 sentences]
9
[+] score: 1
Other miRNAs from this paper: hsa-mir-17, hsa-mir-28, hsa-mir-223, hsa-mir-127, hsa-mir-188, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-30e, hsa-mir-362, hsa-mir-363, hsa-mir-367, hsa-mir-379, hsa-mir-196b, hsa-mir-450a-1, hsa-mir-431, ssc-mir-28, hsa-mir-493, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-500a, hsa-mir-501, hsa-mir-502, hsa-mir-450a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-506, hsa-mir-508, hsa-mir-509-1, hsa-mir-532, hsa-mir-615, hsa-mir-660, bta-mir-127, bta-mir-30e, bta-mir-17, bta-mir-450a-2, bta-mir-532, bta-mir-363, bta-mir-660, hsa-mir-891a, hsa-mir-892a, hsa-mir-509-2, hsa-mir-450b, hsa-mir-892b, hsa-mir-708, hsa-mir-509-3, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1248, ssc-mir-17, bta-mir-155, bta-mir-188, bta-mir-194-2, bta-mir-196b, bta-mir-223, bta-mir-28, bta-mir-362, bta-mir-367, bta-mir-379, bta-mir-431, bta-mir-493, bta-mir-500, bta-mir-502a-1, bta-mir-502a-2, bta-mir-502b, bta-mir-615, bta-mir-708, bta-mir-1248-1, bta-mir-1248-2, ssc-mir-450a, bta-mir-2320, bta-mir-1388, bta-mir-194-1, bta-mir-450a-1, eca-mir-30e, eca-mir-367, eca-mir-684, eca-mir-196b, eca-mir-615, eca-mir-708, eca-mir-194-1, eca-mir-493a, eca-mir-17, eca-mir-1248, eca-mir-28, eca-mir-127, eca-mir-379, eca-mir-431, eca-mir-493b, eca-mir-155, eca-mir-194-2, eca-mir-188, eca-mir-223, eca-mir-362, eca-mir-363, eca-mir-450a, eca-mir-450b, eca-mir-450c, eca-mir-500-1, eca-mir-500-2, eca-mir-501, eca-mir-502, eca-mir-508, eca-mir-509a, eca-mir-532, eca-mir-660, ssc-mir-30e, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-127, ssc-mir-532, ssc-mir-708, ssc-mir-1285, ssc-mir-500, ssc-mir-363-1, ssc-mir-450c, hsa-mir-500b, ssc-mir-194b, ssc-mir-155, ssc-mir-362, bta-mir-3601, ssc-mir-615, ssc-mir-2320, bta-mir-450b, ssc-mir-194a, ssc-mir-196b-2, ssc-mir-363-2, ssc-mir-493, hsa-mir-892c, eca-mir-1388, eca-mir-514b, eca-mir-506a, eca-mir-509b, bta-mir-194b, ssc-mir-1388, ssc-mir-223, ssc-mir-660, bta-mir-194b-2, bta-mir-1949
The mir-513a and mir-514b clusters are incomplete in the pig genome (See Additional file 1: Figure S18), leading to several problems in the pairwise alignments. [score:1]
[1 to 20 of 1 sentences]
10
[+] score: 1
One of the three bat miRNAs in this cluster (pal-can-103) returned a non-identical BLAST hit to dog miR-514, while the other two returned only low-quality hits. [score:1]
[1 to 20 of 1 sentences]
11
[+] score: 1
In particular six out of eight chrXq27.3 miRNAs (miR-506, miR-507, miR-508-3p, miR-509-3p, miR-509-5p and miR-514) showed Pearson’s correlation greater than 0.95 (Figure 4A). [score:1]
[1 to 20 of 1 sentences]