sort by

2 publications mentioning gso-MIR1509a

Open access articles that are associated with the species Glycine soja and mention the gene name MIR1509a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 16
In addition, more tags of target transcripts sliced by PN-miR1509, PN-miR393 and PN-miR403 which were up-regulated under Al stress were detected in the Al-free library (Additional file 3, Table 4). [score:6]
Most of these wild soybean specific miRNAs were relatively highly expressed in the two root libraries; among them, gso-miR2218 was the most abundant in the two libraries (7,282 and 19,061 reads in the Al-free and Al -treated libraries, respectively), followed by gso-miRNA1509a. [score:3]
In contrast, only one target each was identified for gso-miR1509, gso-miR2109 and PN-miR399 (Additional file 3). [score:3]
The p3/p5 strands of five unconserved miRNAs (gso-mir1509a-p3, gso-mir1510a-p5, gso-mir2109-p3, PN-miR4387e-p5 and PN-mir4415-p3) were differentially expressed between the two libraries. [score:3]
151.23PN-miR169cAAGCCAAGGATGACTTGCCGA174717.9644.481.31PN-miR390bAAGCTCAGGAGGGATAGCACC133613.7434.071.31PN-miR862a, bGCTGGATGTCTTTGAAGGAAT113355119.41335.951.49PC-39-5pTAGATTTTAAAGTTGCGGATCA103210.5730.281.52gso-mir1509a-p3ACCGTGTTTCCTTGGTTAACG9349.5132.181.76PC-25-3pCTACATAAGGCACGAGATCATC7297.4027.441.89gso-mir1510a-p5AGGGATAGGTAAAACAATGAC6256.3423.661.90PN-miR4387e-p5TCACGCCTAATCACTGACGCA114911.6246.372.00PN-miR1514aTTCATTTTTAAAATAGGCATTGGG115111.6248.262.05PN-mir4415-p3TTGATTCTCATCACAACATGG4124343.32229.962.41PC-33-3pGGAGAACAAAGAAGCAGCTAAATTC4294. [score:1]
[1 to 20 of 5 sentences]
2
[+] score: 1
Furthermore, four miRNAs (miR1507, miR1509, miR1510, and miR1514) in C08 and five miRNAs (miR1508, miR1510, miR1514, miR393, and miR5674) in W05 were predicted to trigger more than one PHAS locus. [score:1]
[1 to 20 of 1 sentences]