sort by

38 publications mentioning tae-MIR156

Open access articles that are associated with the species Triticum aestivum and mention the gene name MIR156. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 181
In A. thaliana, two miRNAs, miR156 and miR172, regulated the juvenile to adult developmental phase change [38]; SPL9 and SPL10 promoted the expression of miR172b by binding to its promoter and acted independently of this and its target genes [38]; and the expression of miR156 was higher in the juvenile phase than in the adult phase, whereas the expression of miR172 was lower in the juvenile phase than in the adult phase [38]. [score:11]
Nine HvSPLs (HvSPL1, 3, 6, 11, 13, 15, 16, 17 and 23), including six that are targeted by miR156 (HvSPL3, 11, 13, 16, 17 and 23) were highly expressed and displayed tissue-specific patterns of expression. [score:7]
Interestingly, expression of miR156 targeted HvSPL18 and miR156 non -targeted HvSPL7 and HvSPL20 were unique to INF2 tissue. [score:7]
Liu J Cheng X Liu P Sun J miR156 -targeted SBP-Box transcription factors interact with DWARF53 to regulate TEOSINTE BRANCHED1 and BARREN STALK1 expression in bread wheatPlant Physiol. [score:6]
The miR156 -targeted SPL9 promoted sesquiterpene biosynthesis by binding to the promoter region of TPS21 [26] and it negatively regulated anthocyanin levels by modulating the expression of the MYB-bHLH-WD40 complex [27]. [score:6]
Importantly, tissue-specific differential expression of miR156 -targeted HvSPL genes also suggests that they have possible key role in barley growth and development. [score:6]
Since SPL/miR156 module control panicle branching by directly regulating the miR172/AP2 module in rice 30, 47, bract and ear glume development in maize 48, 49 and floral meristem identity in A. majus 2, 28, expression of HvSPL genes in the mir172 barley mutant was analysed. [score:6]
Splice variant 1 of HvSPL11 (HvSPL11 V1), which contained a miR156 target site, showed lower expression at vegetative and higher at the reproductive phase and was the major transcript (Fig.   3B,C). [score:5]
In Arabidopsis, 10 of the 16 SPL genes are targets of miR156 5, 20 and 11 of the 19 SPL genes in rice have been identified as a targets of miR156 [18]. [score:5]
Expression analyses of HvSPL3, 6, 13, and 23 in our study are aligned with the expression pattern of miR156 and miR172b during vegetative and reproductive phases suggesting the similar role of miR156-HvSPL-miR172b module in growth phase modifications in barley as observed in A. thaliana [38] and maize [61] (Figs  6A,B and S5). [score:5]
However, expression remained constant for variant 2 of HvSPL11 (SPL11 V2), which lacked a miR156 target site and was a minor transcript. [score:5]
The genomic and cDNA sequences of HvSPLs were analysed to predict the putative target sites of miR156 using psRNATarget tool (http://plantgrn. [score:5]
Earlier studies in A. thaliana indicated that floral transition was regulated by gibberellin guided miR156 -targeted SQUAMOSA PROMOTER BINDING-LIKE transcription factors [58]. [score:4]
Conserved Motif Identification, Cis-Regulatory Elements, miR156 Target Site Prediction and Alternative Splicing Event Analysis. [score:4]
Conserved Motif Identification, Cis-Regulatory Elements, miR156 Target Site Prediction and Alternative Splicing Event AnalysisA search for conserved motifs within HvSPL proteins was performed by using the MEME 4.11.0 tool (http://meme-suite. [score:4]
Yu Z-X Progressive regulation of sesquiterpene biosynthesis in Arabidopsis and Patchouli (Pogostemon cablin) by the miR156 -targeted SPL transcription factorsMol. [score:4]
Vegetative to Reproductive Phase in Barley: Expression of miR156, miR172 and Specific SPL GenesThe timing of juvenile to adult phase transition in A. thaliana is known to be regulated by miR156 and miR172, along with several members of the SPL family [38]. [score:4]
Most of the splice variants of miR156 -targeted HvSPLs exhibited miR156 complementary sites, implying the existence of alternate splicing -mediated regulation of biological processes in barley (Fig.   3, Table  S7). [score:4]
The expression pattern of miR156 family members and miR172b in barley vegetative to reproductive phase was also antagonistically related (Fig.   5A–C). [score:3]
Vegetative to Reproductive Phase in Barley: Expression of miR156, miR172 and Specific SPL Genes. [score:3]
The miR156 complementary sites are present in the coding region or in the 3′ un-translated region (3′-UTR). [score:3]
HvSPL genes that contain miR156 target sites are indicated by (*) asterisks. [score:3]
The miR156 target sites with the nucleotide positions of HvSPL transcripts are shown in green. [score:3]
Xu M Developmental functions of miR156-regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes in Arabidopsis thalianaPLoS Genet. [score:3]
In A. thaliana, 10 of 17 SPL genes are targeted by miR156, suggesting that miR156 complementary sites in SPL genes are conserved across plant species. [score:3]
Therefore, miR156 family in barley genome and its target site in HvSPLs was studied. [score:3]
Interestingly, differences in the miR156 target site among splice variants were also observed. [score:3]
Similarly, miR156 non -targeted (that is, lacking a miR156 binding site) HvSPLs also generated splice variants (1 to 20 numbers) of varying length. [score:3]
As expected, expression of miR156 family members was higher in 11-d-old seedlings stage (vegetative phase) and lower in 70–75 days old plants (reproductive phase). [score:3]
Data are expressed as RPM (reads per million) for the miR172 and miR156 members normalized to all miRNAs identified in the sample. [score:3]
Green colour denotes the mature sequence of miR156a/b/c and d. (C) miR156 target site in HvSPL3, 11, 13, 16, 17, 18 & 23 genes. [score:3]
We identified 4 members of miR156 family in barley and target prediction showed that 7 of the 17 SPL genes contained a complementary site for this miRNA (Fig.   2A–C; Table  S5). [score:3]
In case of HvSPL3 (20 splice variants), HvSPL11 (4 splice variants) and HvSPL17 (14 splice variants), only 15, 1 and 9 number of splice variants contained miR156 target site. [score:3]
Expression Analysis of Barley miR156 and miR172 Family Members. [score:3]
In addition, the expression patterns of SPL genes and of miR156 and miR172 from vegetative to reproductive phases revealed their possible functional relationships. [score:3]
Antagonistic expression pattern of miR156 and miR172b was observed during vegetative and reproductive phases of barley. [score:3]
Figure 5Barley miR172 sequences and expression analysis of miR156 and miR172 family members. [score:3]
The results of the current study revealed that the miR156/HvSPL/miR172 module functions as key molecular integrators that affected developmental phase transitions and spike development in barley. [score:3]
Putative miR156 binding sites were found for HvSPL3, HvSPL11, HvSPL16, HvSPL17, HvSPL18 and HvSPL23 in their coding regions and for HvSPL13 in the 3′UTR (Fig. 2C; Table  S5), suggesting that regulation by miR156 is restricted to this subset of HvSPL genes. [score:2]
Gou J The miR156-SPL4 module predominantly regulates aerial axillary bud formation and controls shoot architectureNew Phytol. [score:2]
Xie K Wu C Xiong L Genomic organization, differential expression, and interaction of SQUAMOSA promoter -binding-like transcription factors and microRNA156 in ricePlant Physiol. [score:2]
In bread wheat, it was found that the miR156-SPL module regulated bread wheat plant architecture by interacting with a strigolactone signalling repressor gene, DWARF53 [34]. [score:2]
MiR156 Family in H. vulgare and Their Target Site in HvSPL Genes. [score:2]
In A. thaliana, these phases are regulated by miR156 and miR172 [38] via SPL genes. [score:2]
The present study represents the first comprehensive analysis of the miR156/SPL/miR172 regulatory hub in barley. [score:2]
The timing of juvenile to adult phase transition in A. thaliana is known to be regulated by miR156 and miR172, along with several members of the SPL family [38]. [score:2]
Genetic modification of the miR156-SPL4 module controls aerial axillary bud formation, branching, biomass yield, and re-growth after cutting in switchgrass [36]. [score:1]
Two putative members of miR156 family, Hv-miR156a (accession number MI0016449) and Hv-miR156b (accession number MI0030546) were identified for barley in the miRbase database (http://www. [score:1]
The mature miR156 sequences of all four members were identical, but divergence was observed in the precursor sequences which showed 71 to 87% homology. [score:1]
All HvSPLs with miR156 binding sites were predicted to produce splice variants (4 to 20 numbers). [score:1]
* Asterisks denote the presence of the miR156 complementary sequence in the splice variants of barley SPL11 gene. [score:1]
The miR156-complementary site was present in coding regions of HvSPL3, 11, 16, 17, 18, 23, and in the 3′UTR of HvSPL13. [score:1]
The respective transcripts of miR156 and miR172 has been shown in RPM (reads per million). [score:1]
[1 to 20 of 53 sentences]
2
[+] score: 135
Other miRNAs from this paper: tae-MIR159a, tae-MIR159b, tae-MIR319, tae-MIR398, tae-MIR397
This suggested that miR156 overexpression delays or prevents booting and flowering by inhibiting the expression of its target mRNA (CK196549) in wheat, which depends on the degree of reduction in the level of the mRNA in wheat. [score:9]
miR156 silencing resulted in a great increase in the abundance of its target mRNA, and led to a leaf-curl phenotype in wheat seedlings (Figure 3), suggesting that miR156 plays important roles in leaf development by regulating its target gene expression in wheat seedlings. [score:9]
For examples, miR156 targets squamosa promoter -binding protein-like 10 (SPL10) and SPL11, and the regulation of these targets prevents premature gene expression during early embryogenesis in Arabidopsis (Nodine and Bartel, 2010). [score:8]
As described above, we applied the systems to functionally characterize the target gene of miR156 via its transient down-regulation or up-regulation in wheat. [score:7]
These observation reflected the delay of the vegetative phase transitions and heading as well as flowering caused by miR156 overexpression resulting in great reduction of the levels of the target mRNA CK196549 (Wu and Poethig, 2006). [score:5]
The 185-bp fragment of PDS and the 350-bp fragment of pri-miR156 indicated by boxes, and the sequences of pre-amiRNA and STTM are inserted into BSMV γ vector for virus induced the target fragment expressing or silencing. [score:5]
In this study, overexpression of endogenous miR156 in wheat seedlings led to a significant reduction in the levels of the miR156 target mRNA (Figure 5), resulting in distinct phenotypes of either not booting or booting and heading very late (Figure 6). [score:5]
To test whether a BSMV-derived vector can be used to over-express endogenous miRNA to silence target genes in wheat, we constructed BSMV-derived vector BSMV:miR156-F and BSMV:miR156-R, which carries pre-miR156 sequences (upper pane in Figure 5A) in the sense and antisense orientation, respectively. [score:5]
Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3. [score:5]
The BSMV vectors utilized to silence endogenous particular miRNAs were constructed to carry STTM of the certain miRNA, which is composed of two short sequences mimicking small RNA target sites separated by a linker of an 48-nucleotide RNA spacer (totally 153 bp in length) (Figure 1B), and designed as BSMV:STTM, including BSMV:STTM156/156 and BSMV:STTM166/166 which harbors two copies of short tandem target mimic of miR156 and miR166, respectively (Figures 3A, 4A). [score:5]
FIGURE 5miR156 overexpression induced by a BSMV -based vector leads to obvious reduction of mRNA level of miR156 target gene SPL2 in wheat. [score:5]
It is known that the mRNA sequence (GenBank ID: CK196549) is a homolog of miR156 target gene SPL2 in B. distachyon by sequence alignment, therefore, we expect that the CK196549 is one of the miR156 target genes in wheat. [score:5]
Therefore, we chose miR156 and miR166 as target miRNA to knock down in wheat in order easy to check whether a BSMV-derived vector can induce endogenous miRNA silencing in wheat or not. [score:4]
By utilizing the BSMV systems, we successfully knocked down the levels of endogenous miR156 and miR166 and over-expressed endogenous miR156 and amiR-PDS in wheat. [score:4]
miR156 targets the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) transcription factor genes which are involved in the promotion of vegetative phase transitions as well as flowering (Wu and Poethig, 2006). [score:3]
miR156 and miR166 are conserved among plant species and highly expressed throughout the growing period of wheat (Han et al., 2014). [score:3]
Contrasting to the reduction of miR156 abundance, a remarkable increasing of mRNA abundance of the miR156 target gene was detected at 14 dpi. [score:3]
To determine the abundance of the interested mature miRNAs and their target mRNAs in wheat infected with BSMV:STTM156/156, BSMV:STTM166/166, BSMV:amiR-PDS, and BSMV:miR156, respectively, quantitative real-time RT-PCR (qTR-PCR) was performed with U6 (small U6 spliceosomal RNA) and GADPH as internal reference genes for cDNA normalization. [score:3]
Overexpress miR156 in Wheat Using a BSMV-Derived Vector. [score:3]
The BSMV vector carrying a fragment of precursor sequences of wheat miR156 (pre-miR156, 350 bp in length) (Figure 1B), designed as BSMV:miR156, was constructed for miR156 overexpressing in wheat plants. [score:3]
In Arabidopsis, 11 of 17 SPL transcription factor genes have miR156 binding-site, and miR156 targets the SPL genes, including SPL3, SPL4, and SPL5, which are involved in the promotion of vegetative phase transitions as well as flowering (Wu and Poethig, 2006). [score:3]
” The results indicated that the miR156 levels were significantly knocked down in BSMV:STTM156/156 infected plants from 4 to 22 dpi (Figure 3C). [score:2]
The present study confirms that miR156 regulates the vegetative phase transitions and booting as well as flowering through SPL genes in wheat. [score:2]
The resulting PCR products were purified and directly inserted into the BSMV γ construct by T-A cloning in either the sense (BSMV: miR156-F) or antisense (BSMV: miR156-R) orientation. [score:2]
However, qRT-PCR analysis revealed that the abundances of miR156 were greatly increased in the leaves of wheat infected with BSMV:miR156-F or BSMV:miR156-R, compared to that in control plants (Figure 5C), on the contrary, the levels of miR156 target CK196549 were largely reduced in the leaves of plants infected with BSMV:miR156-F or BSMV:miR156-R (Figure 5D). [score:2]
Genomic organization, differential expression, and interaction of SQUAMOSA promoter -binding-like transcription factors and microRNA156 in rice. [score:2]
miR156 has also been reported to function in rice development (Xie et al., 2006). [score:2]
Primer pair P22/P23 was used for miR156 target sequence (GenBank ID: CK196549) [5], which is the homolog of SPL2 in O. sativa and Brachypodium distachyon, and P24/P25 was used for Homeobox-leucine zipper protein HOX33-like (Accession no. [score:2]
It has been demonstrated that the functional blockage of miR156/157 triggered an early vegetative phase change and early flowering in A. thaliana (Yan et al., 2012). [score:1]
Furthermore, qRT-PCR analysis of miR 156 abundance was conducted to investigate if the different phenotype caused by distinct mature miR156 abundances leading to different mRNA levels of the miR156 target in these BSMV-miR156-infected wheat. [score:1]
The control plants exhibited normally booting, heading and flowering (Figures 6A– C), however, the wheat plants infected with either BSMV:miR156-F or BSMV:miR156-R displayed two different phenotypes: type I (plants) showed the increased tiller number (5 more than the control plants) but not booting and heading (Figures 6A,C), and type II (plants) exhibited the similar tiller number as control plants did but with very late booting and heading date (7–10 days later than the control plants) (Figure 6B), the control plants heading at 25 dpi whereas the BSMV:miR156-infected wheat heading at about 32 dpi. [score:1]
FIGURE 3 Barley stripe mosaic virus-derived vector BSMV:STTM156/156 can induce endogenous miR156 silencing in wheat. [score:1]
We inoculated the 2nd fully expanded leaves of wheat at three-leaf stage with BSMV:00, BSMV:amiR-PDS, BSMV:STTM156/156, and BSMV:miR156, respectively. [score:1]
FIGURE 6 Two phenotypes of wheat infected with BSMV:miR156 constructs. [score:1]
It was observed that the wheat infected with BSMV:miR156-F, BSMV:miR156-R or BSMV:00 did not show any distinguishable symptoms at 18 dpi or earlier (Figure 5B). [score:1]
The needle-like leaves were seen at 18 dpi, much later than the reduction of the miR156 level. [score:1]
miR156 and miR166 Can Be Silenced in Wheat by Using BSMV Vectors. [score:1]
Ningchun 16 was infected with in vitro transcribed RNAs representing the α, β, and γ of BSMV:00; α, β, and γ-PDS RNAs of BSMV:PDS; α, β, and γ-STTM156/156 of BSMV:STTM156/156 and α, β, and γ-pre-miR156 of BSMV:miR156 onto the 2nd leaves of seedlings. [score:1]
Ten plants were infected with each of the BSMV:amiR-PDS, the BSMV:miR156, the BSMV:STTM156/156, the BSMV:STTM166/166, the BSMV:PDS, and the BSMV:00, respectively, as described previously (Scofield et al., 2005; Ma et al., 2012), the inoculation with BSMV:PDS and BSMV:00 being as a positive control, and a control, respectively. [score:1]
The wheat pre-miR156 sequence available on miRBase [3] was predicted based on the sequence of primary transcript of miR156 (pri-miR156) (Genbank accession CL902915) in wheat (Dryanova et al., 2008). [score:1]
These suggested that BSMV:STTM156/156 can induce miR156 silencing in wheat plants. [score:1]
The leaves of the plants infected with BSMV:amiR-PDS exhibited photobleaching phenotype, those infected with BSMV:STTM156/156 displayed shrinking in the middle section of the leaves, while those infected with BSMV:miR156 did not showed any obviously symptom, presenting mosaic and chlorotic stripes similar as that of the plants infected with BSMV:00. [score:1]
Further observation found that the wheat plants infected with BSMV:miR156-F and BSMV:miR156-R showed very different phenotypes from control plants at 20 dpi and later. [score:1]
About 15% reduction in mature miR156 abundance was detected as early as 4 dpi, and a remarkable reduction of miR156 level was detected at 14 ∼ 18 dpi. [score:1]
The results confirmed that the mature miR156 levels in type I plants were significantly higher than in type II plants (Figure 6D). [score:1]
Ten wheat seedlings gone through vernalization were inoculated onto the 3rd fully expanded leaves with BSMV:miR156-F, BSMV:miR156-R, and BSMV:00, respectively, at 4-leaf stage. [score:1]
Semiquantitative RT-PCR analysis was conducted to detected the abundance of the BSMV γ RNA, pre-amiR-PDS, STTM156/156, and pre-miR156 in the leaves exhibited in Figure 2A. [score:1]
[1 to 20 of 47 sentences]
3
[+] score: 98
miR156 molecules decrease the expression of miR172 through the cleavage of SPL transcripts, and miR172 directly down-regulates APETALA2-like genes TOE1 and TOE2 to promote the transition from vegetative to reproductive phase [68]. [score:7]
Therefore, the down-regulation of wheat AP1/ FUL-type MADS-box genes could be due to the increased miR156 expression. [score:6]
In addition, miR156 overexpression results in down-regulation of SPLs and in morphological changes including dwarfism, increased tiller number and late flowering in maize, switchgrass and rice [29, 66, 67], which have phenotypes that closely resemble the phenotype of the grass-clump dwarf lines [18]. [score:6]
Expression analysis of the miR156 -targeted wheat SPLs. [score:5]
0176497.g009 Fig 9Expression analysis of the miR156 -targeted wheat SPLs. [score:5]
Thus, the excess tiller numbers and dwarfism could be caused by the increased miR156 expression and repressed TaSPL expression in the grass-clump dwarf lines. [score:5]
S3 FigRecent reports have shown [51, 63] that the underlined SPL genes contain the miR156-target site, and their transcripts are directly cleaved by miR156 in Arabidopsis and rice. [score:4]
On the other hand, the transcript levels of SPLs, direct targets of miR156 [29, 50, 66], were significantly decreased in crown tissues of the grass-clump dwarf lines. [score:4]
The present study showed that at least four TaSPLs could be direct targets of miR156 in the crown tissues of wheat. [score:4]
On the other hand, Arabidopsis SPLs directly activate flowering promoting the MADS-box genes FUL and SOC1, and miR156 molecules negatively regulate the MADS-box genes through the cleavage of SPL transcripts [69]. [score:3]
One of six 5’-ends of the TaSPL mRNA was found in the target region of tae-miR156 molecules. [score:3]
Expression analysis of miR156 and SPL genesIn common wheat, several miR156 molecules have been previously identified, and their sequences are well conserved with those of other plant species [62]. [score:3]
Therefore, the increase in miR156 expression might induce lower miR172 levels, whereas no significant change in the miR172 levels in response to the growth temperature was observed in the crown tissues of the grass-clump dwarf lines. [score:3]
Based on reports in which interaction between miR156 and SPLs of Arabidopsis and rice were confirmed [50, 63], four TaSPLs were selected; the target sites of the five tae-miR156 molecules were present in the coding regions of the four TaSPLs (Fig 9A). [score:3]
The reverse complement of five tae-miR156 targeting sites to the four TaSPL sequences is represented in bold letters. [score:3]
Overexpression of miR156 results in the extremely bushy dwarf phenotype of maize Corngrass1 (Cg1) mutants [29], and the Cg1 phenotype strongly resembles the grass-clump dwarf phenotype of wheat hybrids [18]. [score:3]
Expression analysis of miR156 and SPL genes. [score:3]
Especially, unusual expression patterns of the miR156/ SPLs module could well explain the grass-clump dwarf phenotype. [score:3]
LT treatment dramatically inhibited miR156 accumulation in the crown tissues, and the miR156 molecules were more abundantly accumulated in the grass-clump dwarf lines than in WT lines under normal temperature. [score:3]
SPL genes are associated with regulation of tillering and branching through interaction with miR156 in maize, rice and Arabidopsis [29, 50, 63]. [score:2]
Namely, the Net1- Net2 interaction regulates the temperature -dependent phenotypic plasticity through the miR156/ SPLs module in the wheat crown tissues. [score:2]
The molecular mechanisms controlling the miR156/ SPLs module regulation via the Net1- Net2 interaction are unknown. [score:2]
Some miRNAs including miR156, miR159 miR169 and miR319 are associated with coordination of the relationship between development and stress responses [61]. [score:2]
In the grass-clump dwarf, modification of the miR156/ SPLs module occurs at the shoot apical meristem of the crown tissues under normal temperature. [score:1]
In addition to these plant species, cleavage of an SPL mRNA via miR156 was previously confirmed in common wheat [64, 65]. [score:1]
Here, we report mRNA and miRNA transcriptome analyses in type II necrosis lines under distinct growth temperatures, and discuss association of miR156 with the grass-clump dwarf phenotype in the ABD triploids. [score:1]
Thus, the Net1- Net2 interaction appears to control the miR156/ SPLs module in response to the growth temperature in the wheat ABD hybrids and synthetic hexaploids. [score:1]
Comparison of transcript accumulation of the three miR156 molecules in the WT and type II necrosis/grass-clump dwarf lines. [score:1]
For the grass-clump dwarf phenotype, unusual expression of only the miR156/ SPLs module could at least partly explain the three characteristics of dwarfism, excess tillers and late flowering under normal temperature. [score:1]
Our observations here show that the miR156/ SPLs module is at least partly associated with the grass-clump dwarf phenotype in the type II necrosis lines of synthetic hexaploid wheat. [score:1]
Moreover, the miR156/ SPLs module also controls flowering time in Arabidopsis. [score:1]
Recent reports showed that wheat miR156 cleaves a TaSPL mRNA [64, 65]. [score:1]
miR396, miR5054, miR156 and miR5072 showed lower responsiveness to the growth temperature in Ldn/KU-2059 than in Ldn/KU-2025 (Table 6). [score:1]
In common wheat, several miR156 molecules have been previously identified, and their sequences are well conserved with those of other plant species [62]. [score:1]
Accumulation of miR156 molecules was altered in response to the growth temperature in the crown tissues of wheat synthetic hexaploids (Fig 8). [score:1]
The Net1- Net2 interaction induces the growth abnormalities: necrotic cell death triggered by an autoimmune response under LT and the grass-clump dwarf phenotype induced through the miR156/ SPLs module under normal temperature. [score:1]
A similar difference in the miR156 levels was confirmed between Ldn/KU-2059 and Ldn/KU-2025 under normal temperature, and the accumulation of the miR156 molecules was dramatically repressed by LT treatment in the crown tissues of both WT and type II necrosis lines (Fig 8B). [score:1]
[1 to 20 of 37 sentences]
4
[+] score: 89
The results revealed that expression of miR156 was up-regulated in both TAM107 and CS genotypes after heat treatment, miR159 was down-regulated only in CS genotype after 2 h heat treatment, miR166 was up-regulated only in CS genotype after 2 h heat treatment, miR393 and Ta-miR2002 were up-regulated only in CS genotype after 0.5 h heat treatment (Figure 5). [score:15]
It was found that after powdery mildew infection miR156 was down-regulated both in JD8 and JD8-Pm30, miR164 was down-regulated only in JD8-pm30 but not in JD8, miR393 was down-regulated only in JD8-pm30 but not in JD8 (Figure 4). [score:10]
In accordance with solexa sequencing, miR156 was down-regulated in northern blot after powdery mildew infection both in JD8 and JD8-Pm30, while their putative targets gene Ta3711 and Ta7012 were up-regulated, respectively. [score:9]
For example, miR172 was significantly decreased with 1.5 fold changes, and 8 miRNAs, including miR156, miR159, miR160, miR166, miR168, miR169, miR827, and miR2005, were up-regulated with the highest expression change of 2.9 fold for miR168. [score:6]
In this study, we further performed semi-quantitative RT-PCR analysis to determine the expression patterns of 2 putative target genes of miR156 (Figure 7), which is responsive to powdery mildew infection (Figure 4). [score:5]
Co -expression of 35S::Ta3711 with 35S::miR156 resulted in loss of the full length Ta3711 transcript form, and co -expression of 35S::mTa3711 (encoding a Ta3711 transcript that carries an altered miR156 binding site; see Materials and methods) with 35S::miR156 resulted in detectable transcripts of the Ta3711 size (Additional file 8). [score:5]
It was also noted that expression of some miRNAs, such as miR156 and miR393 were significantly changed at 0.5 h after heat treatment, suggesting that the expression of some miRNA are responsive to the vary short heat treatment. [score:5]
In Arabidopsis, miR156 and miR164 were induced by infection with plant virus TYMV p69, and also induced in transgenic Arabidopsis plants expressing the viral silencing suppressor P1/HC-Pro [52]. [score:5]
Then, we tested if the miRNA directs the cleavage of putative mRNAs using an Agrobacterium -mediated delivery system to co-express miR156 and Ta3711 mRNA in N. benthamiana leaf tissue. [score:4]
Figure 7 of putative target genes of miR156 in response to powdery mildew infection. [score:3]
Negative correlations were observed between miR156 and its putative target genes Ta3711 and Ta7012. [score:3]
Four constructs (35S::miR156, 35S::Ta3711, 35S::mTa3711) were inoculated and expressed. [score:3]
Group 3 contained 10 miRNAs, in which miR156, miR159, miR164 and miR396 were significantly decreased with same expression pattern in JD8 and JD8- Pm30. [score:3]
We also found 8 cases (miR156, miR159, miR172, miR167, miR169, miR396, miR399 and miR818) where all the members of a miRNA family were expressed at similar pattern in response to powdery mildew infection or heat stress. [score:3]
The results indicated that miR156 directed the cleavage of Ta3711. [score:2]
fusiforme [32], and miR156, miR164 and miR160 were induced in tobacco after plant virus's infection [51]. [score:1]
Click here for file Figure S1 MiR156 directs the cleavage of Ta3711 transcripts. [score:1]
Precursor sequences of miR156 including the hairpin structures, the Ta3711 and mTa3711 were cloned to downstream of 35 S promoter, respectively. [score:1]
Figure S1 MiR156 directs the cleavage of Ta3711 transcripts. [score:1]
In this study, we also found that miR156 was significantly repressed by powdery mildew infection, whereas, miR156 was induced in response to heat stress. [score:1]
For example, miR156 and miR160 were significantly repressed in the galled loblolly pine stem infected with the fungus C. quercuum f. sp. [score:1]
35S::miR156, 35S::Ta3711, 35S::mTa3711 were introduced into A. tumefaciens and the bacteria injected into N. benthamiana leaves with a syringe according to the method of Llave [59]. [score:1]
The nucleotide sequence in miR156 binding domain of the mTa3711 was changed from CATGCTCTCTCTCTTCTGTCA to CACGCACTGTCACTACTCTCT. [score:1]
[1 to 20 of 23 sentences]
5
[+] score: 77
Tae-miR156 targets the SBP (SQUAMOSA-promoter binding protein) domain (Traes_2BS_186EA570A), miR164 targets the CUP-SHAPED COTYLEDON (CUC)/ NO APICAL MERISTEM (NAM) gene family (Traes_2BL_6AEE8AC28.1), miR159 targets a myeloblastosis (MYB) transcription factor (Traes_1AL_041EBB4A6.2), tae-miR171a targets the SCL (Scarecrow-like) gene (Traes_6DL_26DDCA106.1), tae-aly-miR825-5p targets the CaBP gene (Ca [2+] binding transmembrane protein) (Traes_1DL_F77022E34.2), tae-aly-miRNA398a-5p and tae-blo-miRNA398a-5p may target the EXPB gene (expansin precursor protein) (Traes_1AL_DB4D32ABB. [score:13]
To examine the functional relationship between the targets and their corresponding miRNAs, 9 known miRNAs (tae-miRNA156, tae-miRNA171, tae-miRNA159, tae-miRNA172, tae-blo-miRNA398, tae-miRNA164, tae-miRNA825, miRNA1120, and miRNA1130) and 2 novel miRNAs (novel-miR-964 and novel-miR-2186) and expression of their targets were examined by qRT-PCR to analyze their principle regulation during male fertility transition (Figure 6). [score:8]
In addition, the terms “regulation of flower development” [such as the targets of tae-miR167a (Traes_2DL_8434C0251), tae-miR1130b-3p (Traes_2DL_DA1A74C0D) and tae-miR156 (Traes_2BS_186EA570A)] and “recognition of pollen” [such as the targets of tae-miR1122b-3p (Traes_1DS_7868656E4.1) and tae-miR5049-3p (Traes_2AL_2A541092D. [score:7]
miR172, miR156, and miR171 interact with their respective target genes (AP2, SPL, and SCL), participating in the GA/abscisic acid (ABA) signaling pathway and GA/auxin signaling pathway to regulate flowering time; miR825, miR167, and miR1120/miR1130 interact with their respective target genes (CaBP, ARF, and LRR), participating in the CRY/PHY signaling pathway, auxin signaling pathway and JA signaling pathway, to modulate pollen development. [score:7]
Indeed, recent studies have shown that vegetative phase changes in Arabidopsis could be regulated by miR156 which promotes the expression of the juvenile phase and represses the expression of the adult phase (Yang et al., 2011). [score:6]
miR156, which targets SPL (SQUAMOSA PROMOTER BINDING PROTEIN-LIKE) transcription factors, promotes flowering and plays important regulatory roles throughout the growth and development stages (Cardon et al., 1997; Schmid et al., 2003). [score:5]
Among these targets, the targets of miR156, miR164, and tae-miR171a were predicted, and the others were confirmed using degradation sequencing. [score:5]
miR156 -targeted and nontargeted SBP-box transcription factors act in concert to secure male fertility in Arabidopsis. [score:5]
However, many differentially expressed miRNAs such as tae-miR167a, tae-miR156 and tae-miR164, showed differentially expressed miRNAs peaked at stage 3 (Figure 2), suggesting that the transition of male fertility may occur at this time. [score:5]
miR156 has been known to play a crucial role in the development of sporogenic tissues with its targets in rice (Yamaguchi et al., 2009) and Arabidopsis (Xing et al., 2010). [score:4]
These predicted targets of known miRNAs, such as miR156, miR159, miR164, miR1120, and miR167, are described as growth -regulating factors, MYB family transcription factors, F-box domain-containing proteins, MADS-box family proteins, and SBP-box gene family members (Table S5). [score:4]
In this mo del, miR825, miR172, miR156, and miR171 are mainly regulated by light, whereas miR1130/miR1120, miR398, miR159, miR164, and two novel-miRNAs (novel-miR964 and novel-miR2186) may be regulated by light. [score:3]
The targets of miR156 (Traes_2BL_186EA570A), annotated as the SBP family (for SQUAMOSA-PROMOTER BINDING PROTEIN) which is a sequence specific DNA -binding domain found in plant proteins, was nearly silenced in SS. [score:3]
Vegetative phase change is mediated by a leaf-derived signal that represses the transcription of miR156. [score:1]
Recently, it has been reported that miR156 (Schwab et al., 2005), miR159 (Achard et al., 2004), and miR172 (Aukerman and Sakai, 2003; Chen, 2004 are involved in control of flowering time. [score:1]
[1 to 20 of 15 sentences]
6
[+] score: 51
The targets of miR156 and miR164 were significantly up-regulated in spikelet tissue, which correlates inversely with the expression levels of corresponding miRNAs in the same tissue. [score:8]
While 7 of the 9 known miRNAs tested (miR156, miR160, miR164, miR166a, miR167a, miR171a, miR396d) were down-regulated in root tissues, expression of miR1135 and miR5139 was comparable in root and shoot tissues. [score:6]
In Arabidopsis, 16 members of plant specific SPL TF family involved in diverse developmental processes have been identified and of these 10 are targeted by MIR156/157 family [82]. [score:4]
All the known miRNAs that were studied showed down-regulation, with miR156, miR164 and miR5139 exhibiting more than 2-fold change, in response to high temperature stress (Figure 5A). [score:4]
Two of the miRNAs, miR156 and miR166a, expressed at significantly high levels in mature leaf (Figure 4A) which is in agreement with earlier reports implicating the role of miR156 in phase change and leaf development [59], [60] and miR166 in establishing leaf polarity [61]. [score:4]
Identification of more members of SPL, ARF and NAC family of transcription factors in wheat would help in delineating more targets of miR156, miR160 and miR164, respectively and further provide insights on their role in plant development. [score:4]
We analyzed the expression pattern of 9 known miRNAs (miR156, miR160, miR164, miR166a, miR167a, miR171a, miR396d, miR1135 and miR5139) and 9 true novel miRNAs (tae_6, tae_7, tae_10, tae_15, tae_19, tae_22, tae_27, tae_44 and tae_45) (Figure 4 and Figure S2). [score:3]
It is worthwhile to experimentally determine the target specificity of miR156 in wheat. [score:3]
We further validated the target genes: SPL-like, ARF10 and NAC1 of wheat miR156, miR160 and miR164, respectively by RLM-RACE method. [score:3]
miR156, miR160 and miR164 were found to target wheat homologs of A. thaliana SPL gene, ARF10 and NAC1 [16], [58], [78]– [80]. [score:3]
Our analysis revealed that at least three wheat SPL genes exhibiting homology with rice SPL2, 11 and 16 are potentially targeted by miR156 which is in agreement with studies wherein 11 out of 15 SPL members were found to contain sequence complementary to MIR156 [83]. [score:3]
We found that miR156, miR160, miR166a, miR396d, miR1135, miR5139, tae_10, tae_15 and tae_44 exhibited approximately two-fold induction in expression levels when mannitol -induced water-deficiency stress was imposed (Figure 5A, B). [score:3]
Surprisingly, out of 18 miRNAs tested in this study, 11 miRNAs (miR156, miR160, miR166a, miR167a, miR171a, tae_6, tae_7, tae_15, tae_19, tae_27 and tae_45) exhibited contrasting expression profile in seedlings exposed to mannitol as compared with the seedlings stressed with PEG (Figure 5A, B). [score:2]
Amongst known miRNAs, MIR156 was the most abundant family consisting of 534830 tags followed by MIR166 with 14643 counts, whereas MIR1120 was the least abundant with only 1 read count as shown in Table S1 in File S1. [score:1]
[1 to 20 of 14 sentences]
7
[+] score: 48
In their study, they found that the expression of miR164, miR395, and miR156 was downregulated while miR159, miR167, and miR171 expression was upregulated in leaf tissues of wheat. [score:11]
Expression of some conserved miRNA families such as miR156 and miR6213 has been detected as upregulated while miR168, miR444, and miR5048 have shown suppressed expression patterns in response to salinity stress in barley (Lv et al. 2012; Deng et al. 2015). [score:10]
Downregulation of miR156, miR159, miR164, miR398, and miR408 was observed under Cd stress while their targets were mostly upregulated. [score:9]
The miR156-SPL module is associated with heat stress response and memory to delay flowering by the repressing of the expression of SPL TFs in Arabidopsis (Stief et al., 2014) and also the regulation of lateral root development which determines the efficiency of water and nutrient uptake in Brassica (Yu et al. 2015). [score:5]
SPL was detected in the modulation of transition from juvenile phase to adult phase in the shoot development process in Arabidopsis, where miR156 regulates the expression of miR172 through several members of this TF (Wu et al. 2009a, b). [score:5]
Many conserved miRNAs across monocots and dicots, such as miR156, miR159, or miR164, have been shown to target stress -associated transcription factors such as MYB and NAC family members (Gupta et al. 2014; Qiu et al. 2016). [score:3]
Abundance of AGO5 -associated isomiRs of miR156, miR158, and miR845 in the pollen and sperm, combined with the findings described above, suggests a novel and intricate miRNA -mediated regulation mechanism for reproductive cells relative to somatic cells (Borges et al. 2011). [score:2]
Also, the miR156-SPL association was shown to be effective in grain development of rice and barley (Miura et al. 2010; Curaba et al. 2012). [score:2]
dicocoides Mn superoxide dismutaseKantar et al. 2011a miR156 T. turgidum ssp. [score:1]
[1 to 20 of 9 sentences]
8
[+] score: 45
A unique set of miRNAs expressed or differentially expressed in embryogenic callus were identified in rice (Luo et al., 2006; Chen et al., 2014); miRNAs and their target genes were analyzed in cotton (Gossypium hirsutum L. ) revealing their regulation role during somatic embryogenesis (Yang et al., 2013), miRNA expression during somatic embryogenesis in citrus (Citrus sinensis L. ) shows that miR156, miR168, and miR171 as well as miR159, miR164, miR390, and miR397 are related to somatic embryo induction or formation (Wu et al., 2011). [score:10]
Furthermore, miR156 played a vital role in controlling leaf development, apical dominance, and floral transition and development by targeting several members of SPL (Cardon et al., 1997; Xie et al., 2006). [score:5]
Previous studies indicated that the miR156 directly repressed the expression of SBP-box transcription factors that played an important role in juvenile-to-adult transition in Arabidopsis, maize, rice, and wheat (Liu et al., 2008; Qin et al., 2008; Wang, 2014). [score:4]
In this study, miR156 expressed significantly higher in IME3 and IME6 than in MEs and IME15, 3 DC and 6 DC were the important time for embryogenic callus formation in IME, indicating that miRNA156 was possibly related to embryogenic callus formation in bread wheat. [score:3]
The majority of abundantly expressed miRNAs were known miRNAs from the miRBase of wheat or they were deeply conserved families such as miR156, miR159, and miR171. [score:3]
Targets function analysis indicated that some miRNA families, such as miR156, miR164, miR1432, miR398, miR397 and some novel miRNAs, play important roles in callus formation. [score:3]
Research in citrus somatic embryogenesis showed that expressions of the miR156 and miR164 were significantly higher in embryogenic callus than in non-embryogenic callus (Wu et al., 2011), suggesting that these two miRNAs were involved in embryogenic callus formation. [score:3]
Research in Arabidopsis showed that high expression of miR156 in young plants prevented precocious flowering (Wang et al., 2009). [score:3]
Study in larch showed that expression of the miR156 reached it minor and major peak level at early cotyledonary embryo and late cotyledonary embryo stage, respectively, and was in low level at middle cotyledonary embryo and before the late single embryo stages (Zhang et al., 2012). [score:3]
miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. [score:2]
Regulation of flowering time by the miR156 -mediated age pathway. [score:2]
Genomic organization, differential expression, and interaction of SQUAMOSA promoter -binding-like transcription factors and microRNA156 in rice. [score:2]
IME6, including three members of miR156 family, miR164, miR1432, tae-miR9657b-5p and several novel miRNAs. [score:1]
Furthermore, miR156 was found to be intimately associated with embryogenic callus formation in rice (Luo et al., 2006), citrus (Wu et al., 2011), and larch (Zhang et al., 2012). [score:1]
[1 to 20 of 14 sentences]
9
[+] score: 41
For example, miR156 and miR164 from Group II both showed high expression levels at 14 DPA, miR166, miR393 and Ta-miRn8 from Group I showed gradual decreases in expression from 7 to 28 DPA, whereas expression of miR9666 from Group IV increased gradually from 7 to 28 DPA (Figs 6A and S5). [score:7]
Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3. [score:5]
Consistent with previous studies in wheat grains [18, 19], similar expression patterns were observed for several development-ralated miRNAs such as miR156, miR167 and miR827. [score:4]
The targets of miR156 include multiple SPL transcription factors, some of which have been proved to be positive regulators of cell proliferation, resulting in increased grain size and yield in rice [10, 14]. [score:4]
It is noted that some development-related miRNAs including miR156, miR167 and miR827 were also indentified by previous studies [18, 19], demonstrating their important regulatory roles in wheat grain development. [score:4]
For 13 highly conserved miRNA families differentially expressed in wheat grain development (Fig 3), five (miR165/166, miR171, miR393, miR396 and miR444), three (miR156, miR164 and miR168), two (miR319 and miR827), one (miR408) and two miRNAs (miR159 and miR167) belonged to Group I, II, III, IV and V, respectively. [score:4]
For instance, miR156 targets several different SQUAMOSA PROMOTER-BINDING PROTEIN LIKE (SPL) genes to affect many aspects of plant development, such as phase transition from the juvenile to the adult stage [8], trichome distribution during flowering [9], and plant architecture [10]. [score:4]
In rice, OsSPL16/GW8, one of miR156 target genes, controls grain size and shape by promoting cell division and grain filling [14]. [score:3]
Most verified targets/miRNA modules were highly conserved among monocots and dicots, such as SPLs/miR156, NACs/miR164, HOXs/miR166, ARFs/miR167, SCL1/miR171, TCPs/miR319, GRFs/miR396, SPX/miR827 (Fig 4A). [score:3]
Temporal control of trichome distribution by microRNA156 -targeted SPL genes in Arabidopsis thaliana. [score:2]
In addition, miR156 -mediated cleavage of Ta. [score:1]
[1 to 20 of 11 sentences]
10
[+] score: 31
In transgenic barley overexpressing the drought tolerant gene TaDREB3, miR156 was over two-fold up-regulated when comparing with the non-transgenic control. [score:6]
Blocking the miR156 signalling pathway with 35S::MIM156 (via target mimicry) increased the sensitivity of the plant to stress treatment, whereas the overexpression of miR156 increased stress tolerance [36]. [score:5]
In another study, miRNA microarray analysis showed that miR156, miR167, miR164, miR319, miR396 and miR166 were up-regulated in leaf or root of bread wheat under drought stress [43]. [score:4]
The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. [score:3]
miR156 targets SQUAMOSA promoter binding protein-like (SPL) TFs, which control flowering time, phase change and leaf initiation rate [31, 32, 42]. [score:3]
Among these 7 known tae-miRNAs, 3 miRNAs, tae-miR167c-5p, tae-miR156 and tae-miR9661-3p were up-regulated only in GM wheat seeds compared to a non-GM acceptor, while there were no significant differences between the different non-GM wheat varieties tested in this study (L21/J19 and J22/J19). [score:3]
miR156 targets SQUAMOSA promoter binding protein-like (SPL) TFs related to flowering time, phase change and leaf initiation rate [31, 32]. [score:3]
The miR156-SPL9-DFR pathway coordinates the relationship between development and abiotic stress tolerance in plants. [score:2]
Several known miRNAs (miR319, miR164, miR167, and miR156) are involved in drought response. [score:1]
tae-miR156 Squamosa Promoter -binding-Like protein (SPL) Teosinte glume architecture 1, TC453361 CK196549 AL810223 TC409846 Glycosyl/glycerophosphate transferase, DR739383 TC384445 TC420438 TC412204 Predicted permease, TC441570 TC373290 TC398965 TC460639 Cob(I)alamin adenolsyltransferas, TC372857 TC390294 CA741955 TC370322 Cytochrome P450, TC413555 CA612886 Telomere binding protein, Initiator binding protein. [score:1]
[1 to 20 of 10 sentences]
11
[+] score: 31
For example, miR156 targets an SPB gene while miR172 targets an AP2-like ethylene-responsive transcription factor (AP2), both of which mediate the transition of the vegetative stage to reproductive stage [48– 50]. [score:5]
For example, miR156, miR169, miR171a, miR444c, miR827, and miR5048a were identified by sequencing as down-regulated. [score:4]
In wheat, miR156 responds to heat, drought, dehydration, and Cd stresses, and fungus stresses in wheat [28, 30, 32, 64], while Tae-miR172 expresses in the tapetum and microsporocytes at the anther development stage [34]. [score:4]
Thus, overexpressed miRNA156 will increase the biomass in cereals such as the energy crop switchgrass. [score:3]
Furthermore, miR156 acts in concert to secure male fertility by targeting the SPB transcript factors in Arabidopsis [73]. [score:3]
Moreover, as shown in Table  2, a significant number of transcripts detected by degradome sequencing have been reported previously such as miR156- SBP, miR172- AP2, miR160- ARF (Auxin Response Factor), miR169-NFYA (Nuclear transcription Factor Y subunit A), miR319- TCP, and MiR9863- NBS, indicating conserved miRNA-target interaction in plants. [score:3]
In Arabidopsis, the interaction of miR156 and miR172 controls developmental timing by the regulation of SPB and AP2 in Arabidopsis [48]. [score:3]
MiR169, miR172, miR156, miR319, miR159, and miR396 showed the cold-stress response in at least three species, and miR160, miR165, miR167, and miR171 overlapped with Populus, Arabidopsis, and Medicago (Additional file 1: Table S6). [score:1]
Among cold responsive miRNAs, miR156 and miR172 are most important developing related miRNAs. [score:1]
In Arabidopsis, 16 miRNAs, including miR156, miR159, miR164, miR165, miR168, miR169, miR172, miR319, miR389, miR393, miR396, miR397, miR398, miR400, miR402, and miR408, were identified by RNA gel blot analysis [12], microarray analysis [13], and a computation -based approach to be related to cold response [14]. [score:1]
Fig. 4Target plots (T-plots) of miR156 (a), miR159 (b), miR169 (c), and miR5028 (d) characterized by degradome sequencing. [score:1]
The response of miR156 and miR172 to cold, heat, and drought are conserved in Arabidopsis, rice, and Brachypodium [13, 74]. [score:1]
In Populus, 19 cold stress-responsive miRNAs were identified by miRNA microarray [15], among which miR156, miR164, miR168, miR169, miR393, and miR396 were overlapped with those in Arabidopsis. [score:1]
[1 to 20 of 13 sentences]
12
[+] score: 24
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR164f, osa-MIR390, osa-MIR439a, osa-MIR439b, osa-MIR439c, osa-MIR439d, osa-MIR439e, osa-MIR439f, osa-MIR439g, osa-MIR439h, osa-MIR439i, osa-MIR396e, osa-MIR444a, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR171a, tae-MIR399, tae-MIR408, tae-MIR444a, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, tae-MIR319, tae-MIR167b, tae-MIR169, tae-MIR444b, tae-MIR171b, tae-MIR396, tae-MIR167c, tae-MIR397
In Arabidopsis, miR156 was strongly expressed during seedling development and showed weak expression in mature tissues [28]. [score:6]
The expression patterns of miR156, miR159, miR164, and miR171, which are conserved miRNAs, were examined by (Figure 5). [score:3]
Rice miR156 showed similar expression profile to those found in Arabidopsis and wheat [51]. [score:3]
Twelve conserved miRNA families (miR156/157, miR159/319, miR160, miR164, miR165/166, miR167, miR169, miR170/171, miR172 and miR444) have been predicted to target 24 transcription factors, including squamosa promoter binding proteins, MYB, NAC1, homeodomain-leucine zipper protein, auxin response factor, CCAAT -binding protein, scarecrow-like protein, APETELA2 protein and MADS box protein (Additional data file 2). [score:3]
miRNA members of the miR156 family also showed variable expression. [score:3]
Expression of miR156 was higher in roots and flag leaves, but lower in other tissues tested, especially in spikes. [score:3]
MiR169 was represented by five members, miR156, miR165/166, miR167, miR170/171 and miR172 were represented by three members each, and miR159, miR319 and miR168 were represented by two members each in the library. [score:1]
Furthermore, our analysis revealed that the library included all known members of several miRNA families: miR156, miR159, miR167, miR169, miR168, miR171 and miR172. [score:1]
These include miRNA156/157, miR159, miR160, miR164, miR165/166, miR167, miR168, miR169, miR170/171, miR172, miR319, miR390, miR393, miR396, miR397, miR399 and miR408, which are conserved in diverse plant species (Table 2). [score:1]
[1 to 20 of 9 sentences]
13
[+] score: 22
A detailed analysis indicated that miRNAs downregulated in response to heat stress, such as miR156, Tae-miR818 and miR169, primarily targeted transcripts associated with activation of signal transduction pathways and transcription factors such as receptor-like kinases, CCAAT and MIKC-type MADS-box transcription factors. [score:6]
Expression profiles of miR398, miR156 and miR169 family members and isomiRs all showed reduced expression in the early recovery period after heat stress (Fig. S5a–c). [score:5]
Inspite of differences between our studies in terms of genotypes (Glenlea vs HD2985), duration of heat stress exposure (5 days vs 2 hours), stage of sampling (boot stage vs seedling), nature of samples (leaf vs mixed), precursor evidence (~98,000 from the IWGSC draft assembly vs wheat ESTs) and method of differential expression analysis (edgeR vs log2 ratio), five major miRNA families (miR156, miR159, miR160, miR167 and miR398) associated with proteins of known heat signaling pathways were differentially expressed in both studies. [score:5]
Hence, suppression of miR156 under heat stress accelerates flowering which makes evolutionary sense 16. [score:3]
MiR156, referred to as a count-down timer necessary for sustaining the juvenile phase 55, targets a SPL family, which in turn, promotes the transition from the juvenile to the adult phases. [score:2]
For example, miR156 and miR168, enriched in some species, exist predominantly as 20 and 21-mers, whereas miR472, miR482 and miR2118, enriched in others, are 22-mers 31. [score:1]
[1 to 20 of 6 sentences]
14
[+] score: 22
The conserved miRNA-target interaction previously proved to be essential for floral development in plant, like tae-miR156-SPL17, tae-miR159a-GAMYB, tae-miR160-ARF18, tae-miR164-CUC2 and tae-miR167a-ARF12, showed very little changes in expression between SL and NN plants at MMC and MP stages (Additional file  19: Figure S7). [score:6]
The relative expression of selected targets from degradome data for miR156 (SPL17), miR159 (GAMYB), miR160 (ARF18), miR164 (CUC2), miR167 (ARF12) and miR1127b (DAD1). [score:5]
c and d Screening of significant differentially expressed genes with Volcano chart by comparing SL1 and NN1, SL2 and NN2 There are several conserved miRNAs that have been reported to be essential for reproductive development in plants, including miR156/7, miR159, miR160, miR164, miR165/166, miR167, miR169, miR172, miR319 and miR396 [14]. [score:4]
Error bars indicated s. d. based on three biological replicates (** P < 0.01, Student’s t-test) There are several conserved miRNAs that have been reported to be essential for reproductive development in plants, including miR156/7, miR159, miR160, miR164, miR165/166, miR167, miR169, miR172, miR319 and miR396 [14]. [score:2]
According to previous studies, miR156, miR159, miR160, miR164, miR167, miR319, miR396 and miR5200 were mainly involved in floral development [14, 28]. [score:2]
In this study, miR156, miR159, miR160, miR164, miR167, miR319 and miR396 were identified from our data. [score:1]
Some conserved and classical miRNAs such as, miR156, miR159, miR160, miR164, miR167, miR396, miR5200, etc. [score:1]
tae-miR156 and tae-miR319 did not show two-fold change as RNA-seq data did. [score:1]
[1 to 20 of 8 sentences]
15
[+] score: 15
Similarly, six miRNAs were identified as UV-B-responsive miRNAs in wheat (Wang et al., 2013), in which miR159, miR167a, and miR171 are upregulated and miR156, miR164, miR395 are downregulated. [score:7]
For example, genes SPL and AP2, encoded DNA -binding transcription factors, can be regulated by miR156 and miR172, which showed opposite expression patterns (Ding et al., 2014). [score:4]
Some of these upregulated miRNAs (miR156, miR160, miR165/166, miR167, miR398, and miR168) were also reported in UV-B-stressed Arabidopsis (Zhou et al., 2007). [score:4]
[1 to 20 of 3 sentences]
16
[+] score: 14
Efforts have been devoted to unravel regulatory events that control responses to abiotic stresses; for example, miR156 and miR398 are upregulated in response to drought whereas miR165/166, miR170/171, and miR396 are down-regulated [12]. [score:8]
With the development of high-throughput sequencing and advancement in knowledge regarding miRNA functions in plants, studies have revealed that many miRNAs, such as miR156, miR159, miR160, miR162, miR171, and miR172, are conserved and universally expressed among various angiosperms. [score:4]
miR156 modulates squamosa promoter -binding protein-like substance; moreover, OsSPL14 in rice is regulated by OsmiR156; OsSPL14 contributes to rice plant architecture [17], facilitates panicle branching, and provides higher grain productivity in rice [59]. [score:2]
[1 to 20 of 3 sentences]
17
[+] score: 13
Besides, miR827 and miR2005 are up-regulated in wheat both under powdery mildew infection and heat stress, whereas miR156, miR159, miR168, miR393, miR2001, and miR2013 exhibit opposite expression pattern response to these stresses [14]. [score:6]
For instance, miR156, miR166, miR168 and miR2009 show abundant expression in young wheat seedlings [7]. [score:3]
Similarly, the expression levels of miR156, miR159, miR164, miR167a, miR171, miR395 and miR6000 have been shown to be altered in wheat under UV-B stress [13]. [score:3]
Previously, miR1867, miR474, miR398, miR1450, miR1881, miR894, miR156, and miR1432 have been found to be induced by drought in wild emmer wheat (Triticum dicoccoides) [3]. [score:1]
[1 to 20 of 4 sentences]
18
[+] score: 12
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR156k, zma-MIR160f, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR1127a, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2275a, osa-MIR2275b, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, hvu-MIR156a, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, tae-MIR167b, hvu-MIR168, hvu-MIR169, tae-MIR169, hvu-MIR397a, tae-MIR398, tae-MIR171b, hvu-MIR166b, hvu-MIR166c, osa-MIR2275c, osa-MIR2275d, tae-MIR1122b, tae-MIR9653a, tae-MIR9654a, tae-MIR9656, tae-MIR9657a, tae-MIR9659, tae-MIR9660, tae-MIR1127b, tae-MIR9661, tae-MIR396, tae-MIR9665, tae-MIR2275, tae-MIR9667, tae-MIR167c, tae-MIR1120b, tae-MIR397, tae-MIR1130b, tae-MIR5384, tae-MIR9675, tae-MIR1120c, tae-MIR9679, tae-MIR9657b, hvu-MIR397b, hvu-MIR156b, tae-MIR9653b
miR156 targets squamosa promoter -binding protein-like 10 (SPL10) and SPL11, and the regulation of these targets prevents premature gene expression during early embryogenesis [19]. [score:8]
Of the 15 known miRNA families, 8 (miR396, miR168, miR156, miR172, miR159, miR398, miR1318 and miR167) showed different levels of preferential expression in wheat flag leaves, with the logarithm of the fold changes ranged from 0.5 to 5.2 as well as more than those in the developing seeds (Figure  3a, Table  2). [score:3]
The highest read abundance (approximately 238,000 RPM) was detected in the miR168 family and was 3.8 to 78 times more abundant than the other miRNA families, including miR156, miR166, miR167 and miR172, whose abundance ranged from about 2,900 RPM to 62,000 RPM (Table  2). [score:1]
[1 to 20 of 3 sentences]
19
[+] score: 12
Other miRNAs from this paper: tae-MIR530, tae-MIR5200
Members of the miR156 family target multiple SPL genes during development [60], but we did not observe significant changes in the expression of any SPL genes carrying the miR156 target site at this developmental stage (Table  4). [score:9]
The phyB -null mutant exhibited increased expression of pri- miR156 (Table  4), which has been associated with a prolonged vegetative state in maize [75] and switchgrass [76], consistent with the phenotype of the wheat phyB -null mutant. [score:3]
[1 to 20 of 2 sentences]
20
[+] score: 9
Upon Pi starvation, miR156, miR399, miR778, miR827, and miR2211 of Arabidopsis (Arabidopsis thaliana) display an upregulated expression pattern (Fujii et al., 2005). [score:6]
A set of miRNA members, such as miR156, miR159, miR167, miR168, miR171, miR319, and miR396 of Arabidopsis, exhibit altered expression levels upon salt (Yu et al., 2005; Ding et al., 2009). [score:3]
[1 to 20 of 2 sentences]
21
[+] score: 9
Some of the conserved miRNAs differentially expressed in response to powdery mildew infection in wheat such as miR156, miR159, miR164, miR171, and miR396 were downregulated whereas miR393, miR444, and miR827 were upregulated, respectively [16]. [score:9]
[1 to 20 of 1 sentences]
22
[+] score: 8
Similarly, increased expression of miR156 in T. dicoccoides targets the SBP TFs and promoted flowering while miR398 targets copper superoxide dismutases, cytochrome C oxidase, and regulates ROS production under drought stress. [score:8]
[1 to 20 of 1 sentences]
23
[+] score: 8
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR171a, osa-MIR393a, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169f, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319b, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169f, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, osa-MIR529a, tae-MIR159a, tae-MIR159b, tae-MIR171a, tae-MIR1120a, osa-MIR1430, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR166n, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR397a, zma-MIR397b, hvu-MIR156a, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, hvu-MIR168, hvu-MIR171, hvu-MIR397a, tae-MIR171b, hvu-MIR1120, hvu-MIR166b, osa-MIR3981, hvu-MIR166c, tae-MIR1120b, tae-MIR397, tae-MIR1120c, hvu-MIR397b, hvu-MIR156b
Both 20 and 21 nt long miR156 were expressed at the highest level in 68-day-old plants. [score:3]
The 20 nt long mature miR156 was previously identified in barley using deep sequencing [48]. [score:1]
Hybridization also revealed the presence of two mature miR156, 20 and 21 nt long (Figure 6H). [score:1]
A 21 nt long mature miR156 with an additional adenosine residue at the 3 [′] end is annotated in the databases of many eukaryotic species [50, 51]. [score:1]
Based on nucleotide sequence and structural similarities, we classify barley MIR156 as an orthologue of rice MIR156g (Figure 6B). [score:1]
Both the 20 and 21 nt miR156 species were equally represented in 6-week- and 68-day-old plants; however, in 1- and 2-week-old plants, primarily the 20 nt long miR156 was detectable. [score:1]
[1 to 20 of 6 sentences]
24
[+] score: 7
Other miRNAs from this paper: tae-MIR160
Significantly, several genes involved in the biogenesis of siRNA and miRNA, including Dicer homolog, AGO1, piwi, and dsRNA -binding proteins, were also regulated by heat stress, Several microRNA (miRNA) target genes, such as SPL2 (miR156) [55] and ARF16 (miR160) [56], were down-regulated, suggesting a role of miRNAs in heat response pathway in plants. [score:7]
[1 to 20 of 1 sentences]
25
[+] score: 7
We employed a gene-specific 5′-rapid amplification of cDNA ends (RACE) assay to isolate cleavage remnants for 15 target genes, including 2 SPL genes for miR156, 1 ARF gene for miR160, 2 NAC genes for miR164, 2 HOMEOBOX-LEUCINE ZIPPER genes for miR166, 5 genes encoding nuclear transcription factor Y subunit A proteins for miR169, 1 scarecrow-like protein gene for miR171 and 1 AP2 gene for miR172, and 1 gene encoding a C3HC4 type zinc finger protein that was regulated by miR444 in wheat. [score:3]
Therefore, wheat miR156 might also be involved in late embryo maturation during wheat grain development. [score:2]
In Arabidopsis embryos, miR156 delays the production of maturation transcripts by directing the repression of SPL10/11[66]. [score:2]
[1 to 20 of 3 sentences]
26
[+] score: 6
We also predicted several new potential targets for miR156 and miR172, such as MYB-related protein (TC#: TC370322) and the starch negative regulator RSR1 (GB#: CA486144). [score:4]
For example, miR156 in rice regulates SPL (Squamosa Promoter -binding protein-Like), which promotes panicle branching and higher grain productivity [37]. [score:2]
[1 to 20 of 2 sentences]
27
[+] score: 6
were shown as both drought-and salt-responsive miRNAs in almost all of the five species except Aegilops tauschii, and miR156 was induced to express under both of the stresses in these species, indicating that the conserved drought-and salt-responsive mechanism might exist among Triticeae species. [score:3]
miRNAs such as miR156, miR171 and miR396 etc. [score:1]
miR156, miR169, miR396, etc. [score:1]
miR156, miR169, miR160, miR159, miR168, miR171, miR172, miR393 and miR396 were the most well-known salinity stress responsive miRNAs in plants summarized from previous studies in maize [18], rice [17], wheat [20, 39], barley [7] and sugarcane [40]. [score:1]
[1 to 20 of 4 sentences]
28
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR164a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR437, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, tae-MIR159b, tae-MIR167a, tae-MIR399, tae-MIR408, tae-MIR444a, osa-MIR1432, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1848, osa-MIR1858a, osa-MIR1858b, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1871, osa-MIR1862d, osa-MIR1862e, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, hvu-MIR156a, hvu-MIR159b, hvu-MIR166a, tae-MIR167b, hvu-MIR168, tae-MIR395a, tae-MIR395b, hvu-MIR397a, tae-MIR398, tae-MIR444b, hvu-MIR166b, hvu-MIR444a, osa-MIR1862f, osa-MIR1862g, hvu-MIR399, hvu-MIR444b, hvu-MIR166c, tae-MIR396, tae-MIR167c, tae-MIR397, hvu-MIR397b, hvu-MIR156b
Recent studies showed that miR172 acts downstream of miR156 and is regulated by miR156 [56]. [score:2]
Interestingly, miR156 is the second most abundant miRNA in the barley dataset, accounting for about 3.7% of the total reads (Additional file 1). [score:1]
These results, combined with the fact that Brachypodium is closer to barley than to rice [57, 58], lead us to speculate that miR156 may have different or additional roles in barley and Brachypodium relative to rice. [score:1]
[1 to 20 of 3 sentences]
29
[+] score: 4
Zhu (2011) proposed a conserved regulatory network with key roles for miR156 and miR172 in triggering changes in the developmental phase and in flower development in Arabidopsis and monocotyledons [30]. [score:4]
[1 to 20 of 1 sentences]
30
[+] score: 4
Negative regulation of anthocyanin biosynthesis in Arabidopsis by a miR156 -targeted SPL transcription factor. [score:4]
[1 to 20 of 1 sentences]
31
[+] score: 3
Gene expression proved that they are implicated in Xingzi 9104 responding to stripe rust pathogene CYR 32, such as miR156, miR160, miR164, miR167, miR393, miR398, miR829, etc [33], while Xin et al substantiated that some of them are involved in powdery mildew stress [34]. [score:3]
[1 to 20 of 1 sentences]
32
[+] score: 2
Very recently, SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 15 (AtSPL) was demonstrated to be regulated by miR156 and to promote flowering under non-inductive conditions (Hyun et al., 2016). [score:2]
[1 to 20 of 1 sentences]
33
[+] score: 2
Overexpression of microRNA156 in Brassica napus enhanced carotenoid content in seeds (Wei et al., 2010). [score:2]
[1 to 20 of 1 sentences]
34
[+] score: 2
Because miR156 and miR172 participate in the age -dependent regulation of flowering in diverse plants 12 13, it will be interesting to explore whether alterations in FT2 growth-related AS in B. distachyon is controlled by these two miRNAs during flowering processes. [score:2]
[1 to 20 of 1 sentences]
35
[+] score: 1
Also, 4 sequences contained two adjacent hairpins that both passed the pre-miRNA criteria; in each of these cases the 2 hits were to members of the same miRNA family (1 pair each for miR156, miR1121, miR2118 and miR5050), and so may represent tandem repeats of these miRNAs. [score:1]
[1 to 20 of 1 sentences]
36
[+] score: 1
Vegetative phase change is mediated by a leaf-derived signal that represses the transcription of miR156. [score:1]
[1 to 20 of 1 sentences]
37
[+] score: 1
Sixteen miRNA families were shown to be putatively present on chromosome 5A: two of them (miR164 and miR167) were found only in the short arm, three families (miR156, miR399 and miR2118) were found only in the long arm, while the remaining eleven families were found in both arms (Table 3). [score:1]
[1 to 20 of 1 sentences]
38
[+] score: 1
In Arabidopsis, the LFY, FUL and AP1 genes are activated by SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 3 (SPL3) (Figure 1) which is regulated by FT and microRNA156 [100]. [score:1]
[1 to 20 of 1 sentences]