sort by

12 publications mentioning hsa-mir-3960

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-3960. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 25
The Tukey post hoc test revealed that in comparison to the mock-infected cells, miR-4508, miR-3960, miR-3614-5p, miR-181a-3p are upregulated in DENV-challenged cells; miR-4508, miR-3960, and miR-4301 are upregulated in the sorted DENV-plus cell population; and miR-4508, miR-3960, miR-3614-5p and miR-181a-3p are upregulated in the DENV-neg population. [score:10]
For example, an increased expression of miR-4508 and miR-4301 has been observed in several cancer types [44– 47] and it was previously reported that miR-3960 can be used as a marker for type 2 diabetes [48]. [score:3]
To validate the sequencing results, we next analyzed the expression level of the miRNAs with the highest changes (miR-4508 and miR-3960) by real-time PCR. [score:3]
The results show a 6.9- and 6.1-fold change in miR-4508 and miR-3960 expression levels in DENV-plus cells over mock-infected cells (Fig 2A). [score:3]
0005981.g002 Fig 2 (A) miR-3960 and miR-4508 expression was determined by real-time PCR using specific primers for the mature form of the miRNAs. [score:2]
In DENV-neg cells, a 1.8 fold change was seen for miR-4508 and no change in miR-3960 was observed when related to mock-infected cells (Fig 2A). [score:1]
At 24 h post-seeding, cells were transfected with 1.5μl of lipofectamine RNAi/Max (Invitrogen) and a final concentration of 10mM of miRNAs mimics (Ambion, cat 4464066; miR-3960 (ID: MC22178), miR-4508 (ID: MC21571), miR-4301 (ID: MC17762), miR-181a (ID: MC10381) and miR-3614-5p (ID: MC20080)). [score:1]
Unexpectedly, neither the percentage of infection nor the viral titers were affected by miR-3960, miR-4508, miR-4301 and miR-181a in Huh7 cells following infection at MOIs 1, 5, and 10 (Fig 3). [score:1]
Effect of miR-181a, miR-4301, miR-3960 and miR-4508 on DENV infection of Huh7 cells. [score:1]
[1 to 20 of 9 sentences]
2
[+] score: 20
[31] A study reveals that the lncRNA TGFB2 overlapping transcript 1 (TGFB2-OT1, also known as FLJ11812) can be upregulated by vascular endothelial cell (VEC) inflammation triggers and function as the sponge for miR-3960, miR-4488 and miR-4459, thereby increasing the expression levels of their targets, such as ATG13, ceramide synthase 1 (CERS1) and La ribonucleoprotein domain family, member 1 (LARP1). [score:8]
[31]A study reveals that the lncRNA TGFB2 overlapping transcript 1 (TGFB2-OT1, also known as FLJ11812) can be upregulated by vascular endothelial cell (VEC) inflammation triggers and function as the sponge for miR-3960, miR-4488 and miR-4459, thereby increasing the expression levels of their targets, such as ATG13, ceramide synthase 1 (CERS1) and La ribonucleoprotein domain family, member 1 (LARP1). [score:8]
89, 90 Moreover, when TGFB2-OT1 prevents miR-3960 -mediated repression of CERS1, production of C18-ceramide is increased to induce mitophagy (a class of selective autophagy targeting dysfunctional mitochondria) by directly interacting with LC3-II-containing autophagolysosomes upon Drp1 -dependent mitochondrial fission. [score:4]
[1 to 20 of 3 sentences]
3
[+] score: 13
Another set of up-regulated miRNAs in both chronic and acute brucelosis are miR-2861 and miR-3960. [score:4]
Afterwards Hu et al. identified miR-3960 that played a regulatory role in osteoblast differentiation through a regulatory feedback loop with miR-2861. [score:3]
They reported that miR-3960 and miR-2861, transcribed together from the same miRNA polycistron, both function in osteoblast differentiation through a novel Runx2/miR-3960/miR-2861regulatory feedback loop [70]. [score:2]
Our findings showed that miR-2861 and miR-3960 have increased expression in both chronic and active group compared with the control group. [score:2]
Because all of the patients involved in this study were classified as osteoarticular brucellosis cases, our findings support the previous knowledge about the altered function of miR-2861 and miR-3960. [score:1]
Xia et al. showed that Runx2/miR-3960/miR-2861 positive feedback loop plays an important role in osteogenic transdifferentiation of vascular smooth muscle cells [71]. [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 9
hsa-miR-197-5p (MIMAT0022691) CGGGUAGAGAGGGCAGUGGGAGG 2102555 hsa-miR-33b-3p (MIMAT0004811) CAGUGCCUCGGCAGUGCAGCCC 204462 hsa-miR-3960 (MIMAT0019337) GGCGGCGGCGGAGGCGGGGG 2100264 hsa-miR-4443 (MIMAT0018961) UUGGAGGCGUGGGUUUU 2104824 hsa-miR-4455 (MIMAT0018977) AGGGUGUGUGUGUUUUU 2105370 hsa-miR-4515 (MIMAT0019052) AGGACUGGACUCCCGGCAGCCC 2118009 hsa-miR-762 (MIMAT0010313) GGGGCUGGGGCCGGGGCCGAGC 2114944 hsa-miR-940 (MIMAT0004983) AAGGCAGGGCCCCCGCUCCCC 204094 hsa-miR-4530 (MIMAT0019069) CCCAGCAGGACGGGAGCG 2105012 hsa-miR-486-5p (MIMAT0002177) UCCUGUACUGAGCUGCCCCGAG 204001 hsa-miR-630 (MIMAT0003299) AGUAUUCUGUACCAGGGAAGGU 204392 cel-miR-39 (MIMAT0000010) UCACCGGGUGUAAAUCAGCUUG 203952 Using an miRWalk 1.0 online tool, target genes of differentially expressed miRNAs were further co-predicted with miRWalk, Targetscan, miRanda, PICTAR2, and DIANAmT software programs. [score:7]
Figure 2Comparison of the serum levels of miR-33b-3p (A), miR-940 (B), miR-486-5p (C), miR-4443 (D), miR-3960 (E), miR-4530 (F), and miR-4739 (G) in subclinical hypothyroidism (SCH) + spontaneous abortion (SA), SCH, SA, and healthy control (HC) groups. [score:1]
Only 7 of 11 miRNAs, including miR-33b-3p, miR-940, miR-4443, miR-4530, miR-4739, miR-486-5p, and miR-3960, were stably detected in all 4 groups (Figure 1). [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 6
Although no miRNAs were linked to nicotinic acetylcholine receptor-, ligand-gated ion channel- or P-glycoprotein-encoding genes in T. canis, some miRNAs (n = 35), including Tc-miR-2881, Tc-miR-5126, Tc-miR-2861 and Tc-miR-3960, did target ABC transporter, cytochrome P450 and multi-drug resistance -associated protein genes (Additional file 1: Table S9), suggesting an involvement in the regulation of transcription of drug target genes and/or possibly in drug resistance. [score:6]
[1 to 20 of 1 sentences]
6
[+] score: 5
The sequences of targeting motifs used to build the miRNA -inhibitor vectors are listed below: (1) aaagtgccgccatcttttgagt for miR-371b-5p, (2) gcacagcccccgtccctccct for miR-149, (3) cgccgccccgcacctgct for miR-3665, (4) cagagcccgccccaacccac for miR-3940-5p, (5) cccccgcctccgccgccgcc for miR-3960, (6) gcctgccccctccaacagcca for miR-4687-3p, (7) gcggtcccgcggcgccccgcct for miR-663, and (8) gctcggccccggccccagcccc for miR-762. [score:5]
[1 to 20 of 1 sentences]
7
[+] score: 3
Another example is that lncRNA TGFB2 overlapping transcript 1 (TGFB2-OT1), transcribed from the antisense strand of the transforming growth factor beta 2 (TGFB2) gene,can bind to miR-3960/-4488/-4459 and promote their target genes mediated autophagy and inflammation of vascular endothelial cells [23]. [score:3]
[1 to 20 of 1 sentences]
8
[+] score: 2
Eleven miRNAs were identified as commonly detectable in all types of specimens: miR-320a, miR-589-5p, miR-636, miR-1273a, miR-3960, miR-4419a, miR-4497, miR-4709-5p, miR-4792, miR-7641-1, and miR-7641-2. Figure 2(A) Venn diagram reporting the number of miRNAs detected in different specimens from healthy individuals and their overlap. [score:1]
Eleven miRNAs were identified as commonly detectable in all types of specimens: miR-320a, miR-589-5p, miR-636, miR-1273a, miR-3960, miR-4419a, miR-4497, miR-4709-5p, miR-4792, miR-7641-1, and miR-7641-2. Figure 2(A) Venn diagram reporting the number of miRNAs detected in different specimens from healthy individuals and their overlap. [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 2
Other miRNAs from this paper: hsa-mir-2861
Hu R. Liu W. Li H. Yang L. Chen C. Xia Z. Y. Guo L. J. Xie H. Zhou H. D. Wu X. P. A RUNX2/MIR-3960/MIR-2861 regulatory feedback loop during mouse osteoblast differentiation J. Biol. [score:2]
[1 to 20 of 1 sentences]
10
[+] score: 2
Several miRNAs, such as miR-3960 were not regulated by CS, but were highly abundant in both and cMPs (Supplementary Table 3). [score:2]
[1 to 20 of 1 sentences]
11
[+] score: 1
Other miRNAs from this paper: hsa-mir-1322
For example, miR-3960 binding sites are mainly in CDSs, and many are positioned adjacent to each other (through one, two, three, or more nucleotides) [6]. [score:1]
[1 to 20 of 1 sentences]
12
[+] score: 1
The successful bioinformatics approach to identifying miR-1236 allows us to anticipate that miR-3960, miR-3166, miR-4763, miR-665 and miR-663, are potential candidates for anti-HBV miRNA (Tables 1 and 2). [score:1]
[1 to 20 of 1 sentences]