sort by

9 publications mentioning hvu-MIR399

Open access articles that are associated with the species Hordeum vulgare and mention the gene name MIR399. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 445
We identified 10 members of the miR399 family and one miR827 gene in barley, all of which were significantly up-regulated under deficient P. In addition, we found many isomirs of the miR399 family and miR827, most of which were also significantly up-regulated under deficient P. Several isomirs of miR399 members were found to be able to cleave their predicted targets in vivo. [score:9]
To further confirm the targets of miR399 and miR827, some of the targets detected in the degradome library for miR399 and miR827 were selected for qRT-PCR to determine their expression levels. [score:7]
miR399 targets the PHO2 gene encoding E2 enzyme that negatively regulates phosphate uptake and root-to-shoot allocation, while miR827 targets SPX-domain-containing genes that negatively regulate other P-responsive genes. [score:7]
In total, 160 targets of miR399 and 22 targets of miR827 were detected in the library (Additional file 9: Table S8), some of which corresponded to target identities that were predicted bioinformatically, while others had not been predicted. [score:7]
Furthermore, a mismatch at target site 4 occurs within the miRNA seed sequence important for recognising the target sequence, presumably making it difficult for this target site to be cleaved by miR399. [score:7]
For example, the gene encoding DNA primase (AV835204) has two predicted sites specifically targeted by hvu-miR399g, while HvPHO2 has five predicted target sites, targeted by different miR399 members (Additional file 8: Table S7). [score:7]
Target genes of miR399 and miR827 were first predicted using psRNATarget [86], a plant sRNA target analysis server [87], and were then validated using a barley (cv. [score:7]
We identified a potential regulatory network among miR399, its target HvPHO2 and target mimics HvIPS1 and HvIPS2 in barley under P -deficient and P-sufficient conditions. [score:6]
Furthermore, we also identified a potential regulatory network among miR399, its target HvPHO2 and target mimics HvIPS1 and HvIPS2 in barley under P -deficient and P-sufficient conditions. [score:6]
All of these miR399 genes are up-regulated under deficient P, but generally expressed at low levels in these plants. [score:6]
Interestingly, the expression of IPS1 is suppressed by PHO2 per se, revealing autoregulation of miR399 and PHO2. [score:6]
However, it is not clear why the highly expressed miR399 target mimic, HvISP1, in the same cells could not protect HvPHO2 from miR399 -mediated cleavage. [score:5]
Correlation of miR399, its PHO2 target and IPS target mimics in P -deficient barley. [score:5]
Intriguingly, although HvPHO2 targeted by miR399 contains five predicted miR399-interacting sites in the 5′ untranslated region [44], only two of these (interacting sites 2 and 5) were found to be cleaved, and occurred at positions 10–11 relative to the 5′ end of the miRNA (Figure  4). [score:5]
Click here for file Predicted targets of miR399 and miR827 in barley, using psRNATarget (Dai and Zhao, 2011). [score:5]
The advantage of using a degradome library is that the cleavage sites of miR399 or miR827 targets can be identified without requiring a priori miRNA target prediction. [score:5]
Previous studies showed that P deficiency -induced IPS genes are target mimics of miR399 and can protect the targets of miR399, such as PHO2, from miR399 -mediated cleavage [25]. [score:5]
We found that hvu-miR399-3p (including hvu-miR399-1-3p, hvu-miR399-2-3p, hvu-miR399-3-3p and hvu-miR399-4-3p) has a single nt deletion relative to target site 2, and two mismatches to target site 5 (Figure  4). [score:5]
Figure 5 qRT-PCR analysis of the expression of predicted targets of miR399 and miR827 in P -deficient (−P) and P-sufficient (+P) barley shoots. [score:5]
Targets of miR399 and miR827 were first predicted using psRNAtarget. [score:5]
Taking these results together, we inferred that target site 2 would most likely be cleaved by hvu-miR399-3p (hvu-miR399-1-3p, hvu-miR399-2-3p, hvu-miR399-3-3p and hvu-miR399-4-3p inclusive), followed by hvu-miR399b-3p and hvu-miR399e-3p (miR399e-1-3p and hvu-miR399e-2-3p inclusive), while target site 5 would most likely be cleaved by hvu-miR399b-3p and hvu-miR399e-3p (miR399e-1-3p and hvu-miR399e-2-3p inclusive). [score:5]
By contrast, all the other miR399 members have a single nt deletion and one mismatch to target site 2, and 1–3 mismatches to target site 5 (Figure  4). [score:5]
It is likely that low N affects the expression of transcription factors or co-factors that control the transcription of MIR399 and MIR827 genes, thereby reducing the expression of the mature miRNAs [77]. [score:5]
A total of 46 targets for the miR399 members and 12 targets for miR827 were predicted (Additional file 8: Table S7). [score:5]
In barley we found that with increasing levels of miR399, the transcript levels of HvPHO2 decreased under P deficiency, suggesting that miR399 suppresses the expression of HvPHO2. [score:5]
In Arabidopsis, over -expression of IPS1 has been shown to increase accumulation of mRNA of the miR399 target PHO2[25]. [score:5]
The target gene HvPHO2 of miR399 contains five predicted miR399 target sites. [score:5]
This in turn suggests that the stress-regulated miRNAs such as miR399 and miR827 may share a common mechanism in both expression and function. [score:4]
In Arabidopsis, miR399 targets PHO2, which negatively regulates Pi uptake and root-to-shoot allocation [9]. [score:4]
All of the five miR399-like sequences from P-sufficient barley were detected and up-regulated in the P -deficient barley dataset. [score:4]
Targets of isomirs of miR399 and miR827 were also directly examined using the barley degradome library. [score:4]
Under other nutrient stresses such as sulfate starvation and high levels of Fe, Cu, Zn, Al, Cd and Hg in soils, the latter of which inhibit plant growth and cause toxicity to plants [76], miR399 and miR827 were not found to be regulated. [score:4]
* means p < 0.003 versus the expression of the same gene under sufficient P. To further explore the correlation among hvu-miR399, HvIPS1, HvIPS2 and HvPHO2, we aligned all the reads from the P -deficient and P-sufficient barley datasets with HvIPS1, HvIPS2 and HvPHO2 transcript sequences in both sense and antisense directions. [score:4]
Many antisense sRNAs of miR399 and a few for miR827 were also detected, but they did not seem to be regulated by P. Intriguingly, the lowest expressed member, hvu-miR399k, had four-fold more antisense sRNAs than sense sRNAs, and furthermore under P sufficiency, the antisense sRNAs are more frequent than the sense sRNAs. [score:4]
* means p < 0.003 versus the expression of the same gene under sufficient P. To further explore the correlation among hvu-miR399, HvIPS1, HvIPS2 and HvPHO2, we aligned all the reads from the P -deficient and P-sufficient barley datasets with HvIPS1, HvIPS2 and HvPHO2 transcript sequences in both sense and antisense directions. [score:4]
In Arabidopsis and maize, miR399 and miR827 are down-regulated under low N conditions [73, 74]. [score:4]
In contrast to the reads derived from HvIPS1 or HvIPS2 transcripts, which were located outside the miR399-interacting sequence, the reads derived from HvPHO2 were mostly located at miR399 target sites (Additional file 3: Figure S5). [score:3]
Target genes of miR399 and miR827. [score:3]
Figure 2 qRT-PCR analysis of the expression of mature miR399 and miR827 in P -deficient (−P) and P-sufficient (+P) barley shoots. [score:3]
To profile the expression values of a given mature miRNA, we first mapped all reads to the barley genome for obtaining the corresponding genomic coordinates for each read, then by means of the coordinates of the mature miR399 and miR827 sequences, we extracted all reads that lay within a window of: start position of the canonical mature miRNA – 3 nt and end position of the canonical mature miRNA + 5 nt. [score:3]
IPS1 functions as a target mimic by using its motif to sequester miR399 from PHO2, thereby protecting PHO2 from miR399 -mediated cleavage. [score:3]
Because HvPHO2 contains five predicted target sites, these sRNAs may be triggered by miR399 [45, 70, 71]. [score:3]
Indeed, qRT-PCR analysis showed that when the levels of miR399 or miR827 increased under P deficiency, the levels of most of the selected target transcripts decreased (Figure  5). [score:3]
Base-pairing of the other three target sites in HvPHO2 with the miR399 genes was also analysed. [score:3]
In support of this hypothesis, we found that different miR399 genes in barley are differentially expressed under the same conditions. [score:3]
One miR399 mimic target has previously been identified in barley [44]. [score:3]
Unexpectedly, although target site 1 in HvPHO2 was perfectly matched to the abundant hvu-miR399-3p (hvu-miR399-1-3p, hvu-miR399-2-3p, hvu-miR399-3-3p and hvu-miR399-4-3p inclusive) (Additional file 3: Figure S5), its cleavage product by these or other miR399 genes was not found in the degradome library, suggesting that additional factor(s) may control the selection of miRNA cleavage sites. [score:3]
Previous studies showed that cleavage events triggered by miR399 occurred at target sites 2–5 in PHO2[21, 45]. [score:3]
The expression level of hvu-miR399 was 1.5-fold higher under P -deficient conditions than under P-sufficient conditions (Figure  2A), which was consistent with the read abundance of this miRNA in the P -deficient and P-sufficient barley sequencing datasets. [score:3]
Among MIR399 genes, miR399k-3p was the lowest expressed (RPM = 1.4). [score:3]
Removal of these sequences stabilises the level of UBC24/ PHO2 transcripts under P deficiency [16], indicating that these sequences are likely to be targeted by miR399. [score:3]
Click here for file Expression profile of hvu-miR399-3p and hvu-miR399-5p, determined by analysis of read counts in the barley P-sufficient and P -deficient sequence datasets. [score:3]
On the other hand, the expression of miR399 and miR827 may also be determined by other factors. [score:3]
In this study, by analysing expression profiles of miR399 and miR827, we identified 9 novel members of the miR399 family, and many isomirs and antisense sRNAs for both miR399 and miR827. [score:3]
All of these reads were located at the target sites of miR399 (Additional file 3: Figure S5). [score:3]
It is to note that the targets listed in Additional file 9: Table S8 also include those of putative miR399 and miR827 genes that were not identified in our barley sRNA datasets but were annotated in miRBase. [score:3]
Predicted targets of miR399 and miR827 were validated using a barley degradome library constructed by RLM-5′-RACE (RNA ligase -mediated rapid amplification of 5′ cDNA ends) technology. [score:3]
However, we found that miR399 isomirs with an A addition also cleave their predicted targets in vivo. [score:3]
qRT-PCR analysis showed that four pre-miR399 genes were expressed at much higher levels in P -deficient barley than in P-sufficient barley (Figure  3), which is consistent with previous studies [12]. [score:3]
NP398309 (MLOC_67378.2), AV835204, AL508349 (AK358746), BY839718 and TC275184 (MLOC_73301.3) are accession numbers or gene names from the MIPS Barley database (in bracket) of the predicted targets of miR399 or miR827, encoding NBS-LRR-like protein, DNA primase, proline rich protein, an unknown protein and cytochrome P450-like protein, respectively. [score:3]
Please note that the expression level of miR827 is much higher than that of miR399. [score:3]
The detected targets of miR399 and miR827 indicate that both miRNAs have diverse and complicated function. [score:3]
We found that MIR827 was more highly expressed than any of the MIR399 genes (Additional file 5: Table S4). [score:3]
Expression profile of miR399 and miR827 genes under different phosphorus conditions. [score:3]
Some of the antisense reads identified for miR399 and miR827 may function as mimics to protect the targets of these miRNAs from cleavage. [score:3]
Similar to miR399, the expression level of miR827 was also 2.5-fold higher in P -deficient barley than in P-sufficient barley (Figure  2B), suggesting that both miR399 and miR827 may function in P homeostasis in barley. [score:3]
In addition, we found that one target (AV835204) was cleaved by isomirs derived from three miR399 genes at two different positions (Additional file 10: Table S9). [score:3]
The expression level of miR827 was 50-fold higher than that of miR399 under P -deficient conditions (Figure  2A and B). [score:3]
Targets of miR399 and miR827 and their isomirs in barley. [score:3]
This suggests that the control of the expression of miR399 genes is independent. [score:3]
Additionally, several small RNAs (sRNAs) derived from the single-stranded loops of the hairpin structures of two MIR399 genes were also shown to be functional by the detection of cleavage products of their predicted targets. [score:3]
Click here for file Genes with miR399- and/or miR827-targetted cleavage products detected by RLM-5′-RACE technology from a barley degradome library. [score:3]
This could explain why some of the predicted targets of miR399 and miR827 were not identified in the barley degradome library (Additional file 9: Table S8). [score:3]
Why the other three miR399-interacting sites could not be cleaved by miR399 in barley is unknown, but likely linked to the expression level of the miR399 member(s) that specifically cleave the site, and this may be tissue- or condition -dependent. [score:3]
Why target site 1, which is perfectly matched to the abundant hvu-miR399, hvu-miR399c and hvu-miR399e, is not cleaved by these or any other miR399 members in this and previous studies [21, 45], is not understood. [score:3]
Figure 3 qRT-PCR analysis of the expression of pre-miR399 and pre-miR827 genes in P -deficient (−P) and P-sufficient (+P) barley shoots. [score:3]
Currently, little information is available on the relationship of miR827 or miR399 expression with P conditions in cereal crops. [score:3]
Taken together, these results indicate that the expression of miR399 members and miR827 are clearly affected by P conditions in barley. [score:3]
One possibility is that the target site could be cleaved by different members of the miR399 family at different times, and another possibility is that some cleavage products may result from natural degradation. [score:3]
Furthermore, all miR399 members cleaved the HvPHO2 target at an equal efficiency as judged by the fragment frequency. [score:3]
However, the miR399 activity in targeting PHO2 is quenched by IPS1 (Induced by Phosphate Starvation 1), a long non-coding RNA containing a sequence motif complementary to miR399 [25]. [score:3]
Click here for file Genes with cleavage products targeted by isomirs of miR399 or miR827, detected by RLM-5′-RACE technology from a barley degradome library. [score:3]
It has been shown that the 5′-untranslated region (UTR) of UBC24/ PHO2 contains multiple sequences complementary to miR399 [22]. [score:3]
None of the miR399 genes had less than 3 mismatches to target sites 3 and 4, thereby making these two sites the most diverse (Additional file 3: Figure S5). [score:3]
Pallas) roots, where HvIPS1 and HvIPS2 were expressed at high levels [44], increased miR399 did not reduce the transcript level of HvPHO2, a PHO2 ortholog in barley [44]. [score:3]
Although the expression values of the guide strand were similar among the different MIR399 genes, the fold-changes between P -deficient and P-sufficient samples varied significantly. [score:3]
We found several targets for isomirs derived from MIR399-4, MIR399c, MIR399b and MIR399d genes but not for those derived from other miR399 genes or from miR827 (Additional file 10: Table S9). [score:3]
To better estimate the expression levels of miR399 and miR827 under different P conditions, quantitative real-time PCR (qRT-PCR) was performed. [score:3]
However, because almost all miR399 genes have the same sequence in the first 10 nt that are the key for miRNA function, it is difficult to judge which miRNA is responsible for cleavage at each target site, especially at positions 10–11 relative to the 5′ end of the miRNA. [score:3]
Our data provide an important insight into the mechanistic regulation and function of miR399 and miR827 in barley under different P conditions. [score:2]
Our data provide an important insight into the mechanistic regulation and function of miR399, miR827 and their isomirs in barley under different P conditions. [score:2]
Such factors may either be common or unique to each miR399 gene, but associated with plant species, tissue specificity, developmental stage and/or environmental conditions. [score:2]
The most strikingly P-regulated MIR399 gene was miR399d, for which we could not find a single read in the P-sufficient dataset. [score:2]
In P-sufficient barley, with the exception of hvu-MIR399c and hvu-MIR827, all of the miR399 antisense sequences were more abundant than their sense sequences (Additional file 12: Table S11). [score:1]
Surprisingly, every MIR399 or MIR827 was found to have an antisense sequence (Additional file 12: Table S11). [score:1]
In this study, we investigated the expression profiles of miR399 and miR827 in barley (Hordeum vulagre L. ) under P -deficient and P-sufficient conditions. [score:1]
All the 159 mature miR399 members (39 unique sequences) and 16 mature miR827 members (9 unique sequences) originate from 3p arms. [score:1]
This does not necessarily mean that the miRBase MIR399 gene is a false positive, but only that in barley shoots it seems not to be processed accordingly to a miRNA. [score:1]
The ten miR399 genes are hvu-miR399-1, hvu-miR399-2, hvu-miR399-3 and hvu-miR399-4, miR399b, miR399c, miR399d, miR399e-1, miR399e-2 and miR399k (Additional file 2: Table S2). [score:1]
In transgenic plants, increasing miR399 transcripts reduces UBC24 transcripts [21]. [score:1]
When up to 2 nt mismatches were allowed, 10 additional miR399-like sequences were identified in P -deficient barley (red sequences in Additional file 1: Table S1), but no additional miR399-like sequences were found in P-sufficient barley. [score:1]
It is unclear how miR399 and miR827 are responsive to low N in plants. [score:1]
However, when we analysed upstream sequences of miR399 genes in plants, we could not find high sequence similarity for these upstream sequences. [score:1]
Corresponding to this hypothesis, we found that the ends of most of the identified isomirs of miR399 and miR827 fit the type cleavage product from Dicer. [score:1]
However, some isomirs of miR399 or miR827 may be generated from different pathways, because their lengths vary significantly relative to their canonical miRNAs [58]. [score:1]
This might be true because previous studies have identified multiple cis-elements (GNATATNC), which are bound by a MYB transcription factor, PHOSPHATE STARVATION RESPONSE 1 (PHR1), in the upstream sequences of all six miR399 genes in Arabidopsis [8, 78]. [score:1]
Mature miR399 sequences identified in sRNA datasets previously obtained from P -deficient and P-sufficient barley (cv. [score:1]
The chromosomal locations of all miR399 and miR827 genes were determined from the barley assemblies (Additional file 2: Table S2), and were confirmed by with barley-wheat addition lines (data not shown). [score:1]
We retained only those candidates for which: (i) the reads mapped to the stem of the pre-miRNA; (ii) the reads showed little fluctuation around the 5′ start position in the alignment; and (iii) the read representing the 3p arm mapped to a known miRBase miR399 or miR827 sequence, allowing no more than 2 mismatches. [score:1]
This in turn suggests that other factors are involved, which may control the activity of upstream elements of miR399 genes. [score:1]
The results could be used for miR399- or miR827 -based engineering in the future for improvement of crop yields with limited P fertilizer. [score:1]
To determine this, we firstly aligned all miR399 sequences with interacting sites 2 and 5 in HvPHO2. [score:1]
By detecting novel miR399 genes at a genomic level, we could resolve that the perfect match of the read ‘TGCCAAAGGAGAATTGCCC’ to the miRBase sequence of tae-miR399 (see Additional file 1: Table S1) is a false positive, as this read mapped in the barley genome to the same location as miR399b, showing that it is a 3′ truncated isomiR of miR399b and not a novel miR399 gene homologous to tae-miR399. [score:1]
Alignment of miR399 3p sequences (red sequences in Figure  1) revealed high homology. [score:1]
Sequences highlighted in red are hvu-miR399-3p sequences, while those highlighted in green are hvu-miR399-5p sequences. [score:1]
The miR399 relationship with UBC24/ PHO2 in response to P starvation has been proposed to be conserved in angiosperms [20, 23, 24]. [score:1]
The other MIR399 genes varied within a very small range from 50.7 (miR399d-3p) to 93.3 (miR399e-1-3p). [score:1]
We identified ten miR399 genes in barley. [score:1]
miR399-2 and miR399-3 not only have the same miR399-3p sequence but also have the same miR399-5p sequence, which was covered by five reads in our experimental data from P -deficient barley. [score:1]
Click here for file Sequences of hvu-miR399-3p, hvu-miR399-5p and hvu-MIR399 genes and their locations in the barley genome. [score:1]
However, none of these reads were located in the miR399-interacting portion of the transcript sequence (Additional file 3: Figure S5). [score:1]
The miR399 genes are distributed in the long arms of chromosomes 1H, 2H, 3H and 7H, of which 7HL contains five miR399 genes, while the others each contain two miR399 genes (Additional file 2: Table S2). [score:1]
The remaining miR399 genes have both 3p and 5p arm sequences detected from the sRNA datasets. [score:1]
Analysis of isomirs of miR399 and miR827 showed that both adenylated and uridylated reads were present for all guide strand mature sequences under P deficiency (Additional file 7: Table S6). [score:1]
By contrast and as described above, significant differences were observed for sense read abundance for all of the hvu-MIR399 genes and for the hvu-MIR827 gene between P -deficient and P-sufficient barley (Additional file 12: Table S11). [score:1]
In line with these points, we found that nine miR399-like sequences and all of the miR827-like sequences (except for the homolog of osa-miR827a) do not perfectly map to the barley genome (Additional file 1: Table S1). [score:1]
It is very likely that the hvu-miR399-3p sequence in miRBase is derived from hvu-miR399-2, as some reads mapped uniquely to this sequence and not to the other three miR399 genes. [score:1]
Figure 1 Sequence alignments of barley pre-miR399 genes. [score:1]
Genomic location of barley miR399 and miR827 genes. [score:1]
In addition, these reads were all located outside the miR399-interacting portions of the sequences (Additional file 3: Figure S5). [score:1]
With the exception of miR399d, all miR399 members cleaved both interacting sites 2 and 5 (miR399d cleaved interacting site 2 only). [score:1]
The overall sequence identity among the ten miR399 genes is about 35%. [score:1]
The obtained mature miRNA sequences (the guide strand which is 3p for both miR399 and miR827) were then mapped again with no mismatches to the genome, in order to obtain all genes giving rise to the same mature miRNA. [score:1]
To date, 159 miR399 genes (155 unique sequences) and 16 miR827 genes (16 unique sequences) have been identified from various species and deposited in miRBase (Release 19: August 2012). [score:1]
By contrast, in Arabidopsis four of the five miR399-interacting sites [2- 5] in the PHO2 gene were reported to be cleaved [21, 45]. [score:1]
The deposited 5p arm sequences in miRBase are only 19 (18 unique sequences) for miR399 genes and 2 (2 unique sequences) for miR827 genes. [score:1]
In total, we found ten miR399 genes and one miR827 gene. [score:1]
Because IPS1 lacks a miRNA -mediated cleavage site, the interaction between IPS1 and miR399 is stable. [score:1]
Although many miR399 and miR827 members/genes have been identified in various plant species, currently only one miR399 sequence, but no miR827 sequence, from barley is deposited in miRBase. [score:1]
Intriguingly, we found NTAs at the 3′ ends of some isomirs of miR399 and miR827, and that these additions do not favour specific nt. [score:1]
Next, we examined the abundance of the miR399 members in the sRNA datasets. [score:1]
This is consistent with some, but not all, studies of the relationship between miR399 and PHO2[9]. [score:1]
In support, miR399 as well as many other nutrient-responsive miRNAs were detected in the phloem of nutrient stressed plants [79- 82]. [score:1]
The presence of HvPHO2 -associated sRNAs in P -deficient barley could substitute for miR399 in mediating the cleavage of HvPHO2. [score:1]
For hvu-miR399d, suffixes Morex, Barke and Bowman indicate the genomic sequences of the barley cultivars from which pre-miR399 sequences were derived. [score:1]
As expected, we generally observed high ratios between the read counts of the guide strand and the passenger strand for most MIR827 and MIR399 genes (see ‘Arm ratio 3p/5p’ in Additional file 5: Table S4). [score:1]
Only three nt vary among the ten miR399-3p sequences. [score:1]
We first aligned all the sRNA sequencing reads to miRBase without mismatch, identifying seven miR399-like sRNA sequences with a total of 644 reads in P -deficient barley and five miR399-like sequences with a total of 62 reads in P-sufficient barley (Additional file 1: Table S1). [score:1]
Click here for file Sequence alignment of pre-miR399 sequences obtained from miRBase. [score:1]
Click here for file Antisense sequences to pre-miR399 members and pre-miR827, identified from barley small RNA datasets. [score:1]
By contrast, miR399 gene sequences in miRBase are less conserved, because they originate from different plant species (Additional file 4: Table S3). [score:1]
Presence of miR399 and miR827 genes in the barley genome. [score:1]
Figure 4 Alignment of miR399 members to two predicted cleavage sites [2],[5] on HvPHO2. [score:1]
Profile of miR399 and miR827 isomirs and alternative biogenesis pathways. [score:1]
By examining the degradome library, we confirmed that interacting sites 2 and 5 in HvPHO2 were cleaved by miR399. [score:1]
Importantly, we identified several functional isomirs of the miR399 family. [score:1]
However, it was not known which of the ten miR399 members cleaved these sites. [score:1]
However, there were no significant differences in antisense read abundance for any of the hvu-MIR399 genes or the hvu-MIR827 gene, between P -deficient and P-sufficient barley (Additional file: 12: Table S11). [score:1]
miR399 is the first miRNA demonstrated to have an ability to increase plant uptake of P in plants [8, 16- 20]. [score:1]
Of the identified miR399 genes, only one (hvu-miR3993p) is currently annotated in miRBase, but the corresponding 5p arm is not annotated in miRBase. [score:1]
Furthermore, the annotated miR399 gene in miRBase does not show a canonical biogenesis, allowing us to rule out that the mature guide strand was obtained from this gene. [score:1]
The other nine miR399 genes are novel (Additional file 2: Table S2). [score:1]
Antisense sequences of miR399 and miR827 in P -deficient and P-sufficient barley. [score:1]
All the miR399 gene sequences, except for miR399-4, could be found in each of the three barley genome assemblies. [score:1]
miR399 and miR827 are not only responsive to low P, but also responsive to low nitrogen (N) in plants [72- 74]. [score:1]
Determination of miR399 cleaving HvPHO2. [score:1]
Prediction of novel MIR399 and MIR827 genes was performed with a modified miRanalyzer algorithm [31]. [score:1]
Click here for file Isomirs of miR399 and miR827 in barley. [score:1]
In order to improve the detection of miR399 and miR827 genes, we used a prediction based on the miRanalyzer algorithm [31], together with the newly available barley genome assemblies [32]. [score:1]
The cause of discrepancy between previous studies was proposed to be due to relative abundance differences of different miR399 members in the samples [45]. [score:1]
The specific origin of isomirs of miR399 or miR827 remains unclear. [score:1]
miR399 and miR827 are both involved in conserved phosphorus (P) deficiency signalling pathways. [score:1]
The first four miR399 genes give rise to the same mature miRNAs and hence they are given the same name, but with a unique suffix of an identifier number. [score:1]
Given this scenario, we took advantage of our previously obtained sRNA datasets from shoots of P -deficient and P-sufficient barley [30] to identify additional miR399 and miR827 genes in the barley genome. [score:1]
miR399c-3p, miR399-3p and miR399k-3p did not show adenylation and uridylation at their 3′ ends (Additional file 7: Table S6). [score:1]
One of the miR399-like sequences was aligned with miR399d in antisense (Additional file 1: Table S1). [score:1]
Consistently, miR399 members in the rice genome were also found to form clusters [34]. [score:1]
In addition to the identified miR399 and miR827 genes, we also identified many isomirs of miR399 and miR827 in barley. [score:1]
In rice nine miR399 loci exist [22, 49], while in dicot Arabidopsis and soybean, six and five miR399 loci are present, respectively [22, 50]. [score:1]
By contrast, the miR399 5p sequences (green sequences in Figure  1) only share three conserved nt. [score:1]
[1 to 20 of 180 sentences]
2
[+] score: 60
Other miRNAs from this paper: hvu-MIR159b, hvu-MIR159a
Gene Ensembl Plants Function Notes PHT1;1 MLOC_28370.1 Pi transporter four paralogs in barley PHT1;4 MLOC_6187 Pi transporter PHT1;6 MLOC_80912.2 Pi transporter PHR1 MLOC_5585TF, ortholog of OsPHR1 PHR2 MLOC_60198.1TF, ortholog of OsPHR2 PHO1 MLOC_12153.1Pi transporter, homologous to rice PHO1;2 PHO2 MLOC_53410.2 ubiquitin-conjugating enzyme E2, catalytic (UBCc) domain targeted by miR399 IPS1 not identified in Ensembl Plants binds miR399 position chr 4, 510585405-510586016 NLA MLOC_52462.2 E3 ubiquitin-protein ligase, SPX_BAH1-like, RING domains no miR827 binding site in barley SPX-MFS MLOC_57566.4 Pi sensing and transport SPX, MFS domains targeted by miR827 SIZ1 MLOC_38182.4 PHR1 sumoylation Pre-miR399c not identified in Ensembl PlantsmiR399c targets PHO2 position chr 2, 558571927-558572025Barley genes PHR1, PHR2, PHO1, NLA, SPX-MFS, SIZ1, and MIR399c were identified based on their similarity to known orthologs and then allocated to a particular MLOC number. [score:7]
We concluded that, apart from the post-transcriptional action of miR399 on PHO2 expression, downregulation may be caused on the transcriptional level. [score:6]
This observation allowed us to draw the conclusion that the changes in PHO2 and SPX-MFS gene expression in barley shoots (their mRNAs are targeted by miR399 and miR827, respectively) result from transcriptional rather than post-transcriptional regulation. [score:6]
Accordingly, Pi re-supply did not change the level of PHO2 expression significantly, although the expression of pri-miR399 and, consequently, mature miR399 was strongly decreased (Supplementary Figure S2K and Figure 10A). [score:5]
This suggests that the role of miR399 in PHO2 gene -expression regulation is not crucial at the latter developmental stages. [score:5]
Since we detected neither mature miR399 nor significant changes in the expression of mature miR827 in barley shoots, we concluded that the changes observed resulted from transcriptional regulation. [score:4]
miR399 guides the RISC complex to target PHO2 mRNA. [score:3]
FIGURE 6 (A) miR399 and (B) miR827 expression levels in barley shoots. [score:3]
At later growth stages, the expression of PHO2 approached the level in the P-sufficient controls plants, although the abundance of pri-miR399c and mature miR399 was still on a high level in Pi starvation condition (Supplementary Figure S2K and Figure 10A). [score:3]
FIGURE 10 (A) miR399 and (B) miR827 expression levels in barley roots. [score:3]
Furthermore, a riboregulator IPS1 can bind and quench miR399 activity because it is not cleaved by the miRNA due to the base pair mismatches, which prevents PHO2 mRNA against complete degradation (Franco-Zorrilla et al., 2007). [score:2]
The 5′ UTR of barley PHO2 mRNA contains six potential miR399 recognition sites (Figure 1C). [score:1]
In miRBase, there is only one pre-miR399 precursor available (MI0017933) from which mature miR399 could be diced out. [score:1]
The Pi homeostasis regulatory system also comprises the actions of microRNA399 and microRNA827 (Bari et al., 2006; Hackenberg et al., 2013). [score:1]
MiR399 and miR827 are the only microRNAs that bind to the 5′ UTR of mRNAs in Arabidopsis (Ding et al., 2012). [score:1]
We were not able to detect mature miR399 in barley shoots grown in heat stress and control conditions (Figure 6A). [score:1]
We found that this sequence is, in fact, the reverse complement fragment of the PHO2 5′ UTR containing miR399 binding site no 2 (Figure 3B). [score:1]
Ten MIR399 genes and one MIR827 gene have been identified in the barley genome (Hackenberg et al., 2013). [score:1]
The low abundance of miR399 and miR827 in Pi-sufficient conditions and after heat treatment was not surprising. [score:1]
This proposed pre-miR399 stem-loop structure does not contain the typical features of plant pre-miRNA (Figure 3A) (Bologna et al., 2009). [score:1]
Since it is possible that the miR399-3p sequence is unusually processed in barley shoots (Hackenberg et al., 2013), we decided to analyze it in more depth. [score:1]
MI0017933 – miRBase, barley pre-miR399, MIMAT0020542 – miRBase barley microRNA399, fragment of TCONS_00089457 – Rolap, transcriptome identified pri-miR399c; (C) pre-miR399c stem-loop structure based on the TCONS_00089457 sequence (AGTCCAGTTTCAGGGCTCCTCTTTATTGGCAGGGAGCGTGTGAGGCCATGTAGCCTCATTCAGCGCTCTGCCAAAGGAGAGTTGCCCTGTAACTGGAAA). [score:1]
Within exon 2, six miR399 binding sites are depicted; the red vertical line represents binding site no 6; (C) Alignment of six miR399 binding sites in HvPHO2 5′UTR (according to AK249253) and one binding site in HvIPS1 (GQ301528) recognized by miR399. [score:1]
Our Northern analysis of the shoot samples did not show any miR399 signals. [score:1]
[1 to 20 of 24 sentences]
3
[+] score: 27
The target of this miR399 is the mRNA encoding the enzyme “Phosphatase 2” (PHO2), and downregulation of PHO2 was shown in barley by Hackenberg and his colleagues when the miR399 was upregulated (Hackenberg et al. 2013a). [score:9]
Wang and collogues identified induced expression of miR159 and miR399 upon wounding while miR164, miR167, miR393, and miR398 were detected as downregulated by the same process. [score:6]
P starvation-responsive miRNA, miR399, was found to be upregulated in both barley and wheat (Zhao et al. 2013; Hackenberg et al. 2013b) (Table 3). [score:4]
They observed that miR159, miR160, miR164, miR399, miR1117, and miR1120 exhibited differential expression suggesting a role in N homeostasis (Sinha et al. 2015) (Table 3). [score:3]
dicocoides Cu–Zn super oxide dismutaseKantar et al. 2011a miR399 H. vulgare No targetLv et al. 2012 miR408 T. turgidum ssp. [score:3]
miR399 is not the only miRNA detected as Pi deficiency responsive. [score:1]
These observations suggest that miR399 is a candidate for manipulation of the Pi uptake pathway in wheat and barley. [score:1]
[1 to 20 of 7 sentences]
4
[+] score: 24
According to genome sequencing information, SIZ1 is conserved in rice [27]; miR399 expression has been confirmed in rice, and a potential orthologue of UBC24/PHO2 has been identified by assembly using genomic DNA and expressed sequence tags (ESTs) [26]. [score:5]
Comparison of upregulated wheat and rice transcripts revealed that the PHR1-IPS1-miR399-UBC24/PHO2 signalling cascade is conserved in both crop species. [score:4]
Based on the identification of HvmiR399s [28] and the upregulation of HvIPS1[29], the IPS1-miR399-UBC24/PHO2 signalling cascade appears to be conserved in barley [18]. [score:4]
IPS1, a non-protein coding gene that includes highly conserved sequences near miR399 complementary regions in different plant species [22], has been found to be strongly upregulated under −P in rice [10]. [score:4]
These results suggested that the PHR1-IPS1-miR399-UBC24/PHO2 signalling cascade functions as a potent adaptation to −P in wheat. [score:1]
In Arabidopsis, SIZ1 (small ubiquitin-like modifier [SUMO] E3 ligase) [16], miR399, and UBC24/PHO2 (ubiquitin E2 conjugase) are also involved in the cascade (Figure 5) [26]. [score:1]
A highly conserved PHR1-IPS1-miR399-UBC24/PHO2 signalling cascade. [score:1]
Consequently, the PHR1-IPS1-miR399-UBC24/PHO2 signalling cascade is probably also conserved in wheat (Figure 5). [score:1]
These factors may be related to the PHR1-IPS1-miR399-UBC24/PHO2 signalling cascade, as Pi remobilisation, Pi uptake, and Pi-related metabolism are under the control of that cascade (Figure 5). [score:1]
Members of the IPS1 gene family from different plant species, including rice, have a highly-conserved 23-nt-long motif that exhibits complementarity with the miR399 involved in Pi response [22]. [score:1]
Transcribed sequences encoding miR399, miR399 -binding sites, or protein sequences homologous to N- or C-terminal extensions of UBC24/PHO2 have been observed in wheat [26]. [score:1]
[1 to 20 of 11 sentences]
5
[+] score: 17
In our study, miR169c, miR171, and miR399 were up-regulated in leaves whereas miR397, miR444b were down-regulated in roots after exposure to high B concentration. [score:7]
Additionally, the expression of miR399 was induced in shoots upon phosphate deficiency treatment, but it was accumulated in both shoots and roots [57]. [score:3]
In addition, some miRNAs, such as miR172, miR399, miR2021, miR5053 and miR5066 were expressed in both root and leaf (Table 3). [score:3]
Furthermore, according to gene ontology analysis, 3 miRNAs (miR399, miR1122 and miR2014) were determined to be regulated in response to boron stress. [score:2]
Contig5_All Laccase mRNA hvu-miR399 Biological regulationCellular processLocalizationMetabolic processResponse to stimulus – Catalytic activity CL876. [score:2]
[1 to 20 of 5 sentences]
6
[+] score: 11
miRNA regulate gene expression also by targeting enzymes of the ubiquitination pathway (ubiquitin conjugating enzyme E2 and TIR1/ubiquitin ligase): barley miR393, miR399, miR1128, miR1133, miR1135 can be considered putative regulators of gene expression at protein level. [score:8]
In rice Zhou et al. have found a high number of targets for miR156 and miR396 and a low number for miR162, miR167, miR395, miR398 and miR399 [12]. [score:3]
[1 to 20 of 2 sentences]
7
[+] score: 8
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR164a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159b, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR437, osa-MIR396e, osa-MIR444a, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, tae-MIR159b, tae-MIR167a, tae-MIR399, tae-MIR408, tae-MIR444a, osa-MIR1432, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1848, osa-MIR1858a, osa-MIR1858b, osa-MIR1862a, osa-MIR1862b, osa-MIR1862c, osa-MIR1871, osa-MIR1862d, osa-MIR1862e, osa-MIR827, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR166a, tae-MIR167b, hvu-MIR168, tae-MIR395a, tae-MIR395b, hvu-MIR397a, tae-MIR398, tae-MIR444b, hvu-MIR166b, hvu-MIR444a, osa-MIR1862f, osa-MIR1862g, hvu-MIR444b, hvu-MIR166c, tae-MIR396, tae-MIR167c, tae-MIR397, hvu-MIR397b, hvu-MIR156b
Hence, these results confirm actual expression of pre-miR396, pre-miR399 and pre-miR827. [score:3]
miR399 and miR827 are both important for plant uptake of phosphorus under phosphorus deficiency [62], while miR396 is important in controlling cell proliferation [63]. [score:1]
Figure 5 Sequence alignment of each of pre-miRNA396, pre-miRNA399 and pre-miRNA827 from rice, Brachypodium and/or wheat. [score:1]
To test the validity of this approach, we first selected three conserved miRNAs, namely miR396, miR399 and miR827. [score:1]
Sequencing of these PCR products showed high sequence similarity of the barley pre-miRNAs with those from rice, Brachypodium or wheat (Figure 5), confirming that they are indeed barley pre-miR396, pre-miR399 and pre-miR827. [score:1]
To identify pre-miR396, pre-miR399 and pre-miR827 in barley, sequences of pre-miRNA sequences from rice, Brachypodium and/or wheat were aligned to determine conserved regions (Figure 5). [score:1]
[1 to 20 of 6 sentences]
8
[+] score: 4
Other miRNAs from this paper: tae-MIR399, bdi-MIR399a, bdi-MIR399b, bdi-MIR399c, bdi-MIR399d
The AtIPS1 transcript contains a miR399 recognition site and functions as a miRNA target mimic [30]. [score:3]
A 251 bp fragment of HvIPS1, downstream of the miR399 recognition site, was inserted into BSMV-γ-MCS, and seven days old plants grown under hydroponics conditions as described above were inoculated with BSMV-α, -β and either BSMV-γ-IPS1 or a BSMV-γ-GFP [250 ]control construct. [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 2
Moreover, miR399 and miR827 can also positively regulate phosphorus genes (Chien et al., 2017). [score:2]
[1 to 20 of 1 sentences]