sort by

25 publications mentioning gma-MIR396i

Open access articles that are associated with the species Glycine max and mention the gene name MIR396i. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

[+] score: 221
We found that Pre-miR396a, Pre-miR396i, Pre-miR396b/d/g/k, Pre-miR396e, and Pre-miR396h were up-regulated in leaves, but down-regulated in roots; however, the variations in the expression of Pre-miR396c/f and Pre-miR396j in leaves and roots of low water potential stressed soybean seedlings were not detected because they expressed at levels too low to detect (Figures 1A,B). [score:11]
Ectopic expression of miR396 suppresses GRF target gene expression and alters leaf growth in Arabidopsis. [score:9]
Multi-to-Multi Network Interaction of MiR396– GRF Module in SoybeanMiRNAs negatively regulate target mRNA gene expression via perfect or near-perfect complementation of the target mRNA. [score:7]
2007.199 17585298 5′-RACE RNA ligase -mediated rapid amplification of 5′-cDNA ends Gma-miR396a-k Glycine max mature gma-miR396s GmGRF Glycine max growth -regulating factors GRFs Growth -regulating factors OEOver -expression transgenic Arabidopsis RT-qPCR the reverse transcription quantitative real-time PCR Pre-miR396a-k Glycine max gma-miR396 precursors Vector Empty plant expression vector WTWild-type Arabidopsis. [score:7]
Bazin et al. (2013) reported that roots of transgenic Medicago truncatula plants over -expressing the mtr-miR396b precursor showed decreased MtGRFs expression and reduced growth, but mtr-miR396 inactivation led to increased MtGRFs expression and greater root biomass. [score:7]
The results of gene expression analysis showed that bar gene and Pre-miR396a-k in WT have no expression, but bar gene in vector-OE and Pre-miR396a-k in miR396(a-k)-OE transgenic Arabidopsis all displayed high over -expression (Figure 4A). [score:7]
Baucher et al. (2013) and Cao et al. (2016) showed that miR396 targets GRFs to control floral organ development, and Liang et al. (2014) reported that miR396 regulates GRF to control carpel number and pistil development. [score:6]
In previous studies, miR396 over -expression markedly decreased the expression of cell cycle-related genes (Liu et al., 2012). [score:5]
MiR396- GRF Module Effect on Plant DevelopmentBy over -expressing 11 gma-miR396 family precursors (Pre-miR396a–k) in Arabidopsis, we verified that Pre-miR396a/b/c/e/h/i/k affect plant development, because the phenotypes of miR396a/b/c/e/h/i/k-OE were dwarf plants, short roots, small leaves, and smaller and fewer siliques. [score:5]
Regulations on growth and development in tomato cotyledon, flower and fruit via destruction of miR396 with short tandem target mimic. [score:5]
By over -expressing 11 gma-miR396 family precursors (Pre-miR396a–k) in Arabidopsis, we verified that Pre-miR396a/b/c/e/h/i/k affect plant development, because the phenotypes of miR396a/b/c/e/h/i/k-OE were dwarf plants, short roots, small leaves, and smaller and fewer siliques. [score:4]
miR396 -targeted AtGRF transcription factors are required for coordination of cell division and differentiation during leaf development in Arabidopsis. [score:4]
A role for the miR396/ GRF network in specification of organ type during flower development, as supported by ectopic expression of Populus trichocarpa miR396c in transgenic tobacco. [score:4]
We verified the function of the gma-miR396 gene family by over -expressing Pre-miR396a–k in Arabidopsis (miR396a/b/c/d/e/f/g/h/i/k-OE), seven gma-miR396 precursors (Pre-miR396a/b/c/e/h/i/k) affected the development of miR396a/b/c/e/h/i/k-OE transgenic Arabidopsis plants, which exhibited small leaves, short roots, and decreased seed yield. [score:4]
First, we analyzed variations in the expression of gma-miR396 precursors in leaves and roots of low water potential stressed soybean seedlings, Universal primers were used for expression analysis of Pre-miR396b/d/g/k because of their sequence homology. [score:4]
According to the target gene prediction of miR396 in soybean and Arabidopsis, gma-miR396a/b/c/e/h/i/k-5p same with ath-miR396a/b-5p which interacted with AtGRF1/2/3/4/7/8/9 (Supplementary Figure S5B). [score:3]
Repression of growth regulating factors by the microRNA396 inhibits cell proliferation by UV-B radiation in Arabidopsis leaves. [score:3]
Previous reports identified a few GmGRFs as the target genes of gma-miR396 based on their degradation products (Fang et al., 2013; Hu et al., 2013). [score:3]
Furthermore, we further verified the function of Glycine max miR396 -family genes by over -expressing Pre-miR396a–k in Arabidopsis, and found miR396a/b/c/e/h/i/k-OE Arabidopsis seedlings all exhibited shorter roots and smaller leaves. [score:3]
We verified the cleavage site of gma-miR396 on target GmGRF transcripts using a modified 5′-RACE method. [score:3]
Overall, our results illustrate the tissue-specific regulation of the gma-miR396 family in coordinating development and low water availability response. [score:3]
GmGRF gene family contained 26 members (including 55 transcript sequences), among which, 24 GmGRFs (including 55 transcript sequences) were predicted as the target genes of 7 gma-miR396 (gma-miR396a/b/c/e/h/i/k) (Supplementary Table S3), and their interaction site was located at the conserved “CGTTCAAGAAAGCCTGTGGAA” sequence (Supplementary Figure S2A) which coded conserved “RSRKPVE” amino acid sequence in the WRC region (Supplementary Figure S2B). [score:3]
To date, 11 Glycine max gma-miR396 precursors (Pre-miR396a–k) have been identified, and 24 Glycine max GRFs (GmGRF1–GmGRF24) were predicted as the targets of seven gma-miR396a/b/c/e/h/i/k. [score:3]
Validation of Multi-to-Multi Network Interaction of MiR396– GRF Module in SoybeanTarget validation of miRNA is a prerequisite step towards understanding the function of miRNA. [score:3]
We also explored the regulatory mechanism of the miR396– GRF regulatory module in soybean in low water availability response. [score:3]
The miR396– GRF module plays regulatory roles in plant growth and development, and in the responses to various environmental stresses (Omidbakhshfard et al., 2015). [score:3]
In O. sativa, there are eight osa-miR396 loci (osa-miR396a–h) and 13 OsGRF family genes, but only some of the predicted OsGRFs have been verified as targets of osa-miR396c (Gao et al., 2010; Li et al., 2016). [score:3]
Wang et al. (2011) and Das Gupta and Nath (2015) suggested that miR396 -targeted AtGRF transcription factors are required to establish leaf polarity. [score:3]
There is some experimental evidence that the miR396- GRF module plays significant regulatory roles in plant growth and development (Omidbakhshfard et al., 2015). [score:3]
Expression of each gma-miR396 precursor in soybean cultured under normal conditions served as control. [score:3]
However, previous studies have focused only on the leaves of miR396-over -expressing transgenic plants, and none has focused on how other tissues of these transgenic plants respond to low water availability. [score:3]
Divergence in patterns of leaf growth polarity is associated with the expression divergence of miR396. [score:3]
To analyze the expression of the miR396– GRF module during the low water availability response, soybean seedlings were treated with PEG to impose low water potential stress (Supplementary Figure S1). [score:3]
Remaining two genes GmGRF25 and GmGRF26 were not predicted to be target genes of gma-miR396. [score:3]
According to prediction, 24 putative GmGRFs (GmGRF1-GmGRF24) are the targets of 7 gma-miR396 (gma-miR396a/b/c/e/h/i/k), the predicted results were listed in Supplementary Table S3. [score:3]
In this study, we used two improved methods, the 5′-RACE technique and the Arabidopsis protoplast transient expression, to verify the interaction between the gma-miR396 and GmGRF families. [score:3]
Verification of Interaction between Gma-miR396s and GmGRF-Family GenesWe verified the cleavage site of gma-miR396 on target GmGRF transcripts using a modified 5′-RACE method. [score:3]
FIGURE 1Low water potential stress induced tissue-specific expression of miR396– GRF module. [score:3]
In Arabidopsis, there are two ath-miR396 loci (ath-miR396a/b), and nine AtGRF family genes (AtGRF1/2/3/4/5/6/7/8/9), six of which (AtGRF1/2/3/7/8/9) were proven to be targets of ath-miR396a/b in 5′-RACE analysis (Jones-Rhoades and Bartel, 2004; Jones-Rhoades et al., 2006). [score:3]
To functionally analyze Pre-miR396a–k, we generated transgenic Arabidopsis plants constitutively over -expressing each of the 11 gma -miR396 family precursors under the control of the CaMV 35S promoter. [score:3]
Together, these data contribute to our understanding of the tissue-specific regulation of the gma-miR396 family in coordinating development and low water availability responses. [score:3]
But the special family members Pre-miR396d/f/g/j do not play typical function of miR396 family to effect on development in Arabidopsis. [score:2]
MiR396 normally target a conserved domain of GRF, the WRC (Trp, Arg, Cys) domain, which contains a functional nuclear localization signal and a putative zinc finger motif (Van der Knaap et al., 2000). [score:2]
Therefore, their regulation by gma-miR396 was further analyzed in leaves and roots of low water potential stressed soybean seedlings. [score:2]
Tissue-Specific Regulation of Pre-miR396 in Low Water Availability Responses. [score:2]
As we already detected tissue-specific regulation of the miR396– GRF module in low water potential stressed soybean and we found that Pre-miR396a/b/c/e/h/i/k play practical roles in regulating tissue development, which inspired us to evaluate the low water availability of different tissues of miR396a/b/c/e/h/i/k-OE transgenic Arabidopsis plants. [score:2]
Overexpression of Arabidopsis MiR396 enhances drought tolerance in transgenic tobacco plants. [score:2]
Excluding genes that were not affected and too low to detect, our results suggested that the miR396– GRF module displays tissue-specific regulation in leaves and roots of soybean seedlings in low water availability response. [score:2]
Arabidopsis miR396 mediates the development of leaves and flowers in transgenic tobacco. [score:2]
Furthermore, our results and those of several previous reports indicate that the miR396– GRF module is required to co-ordinate cell division and differentiation during leaf development (Wang et al., 2011). [score:2]
The miR396– GRF module was suggested to be necessary to regulate the transition of root stem cells into transit-amplifying cells (Rodriguez et al., 2015). [score:2]
Previous reports have indicated that miR396 -mediated GRF regulation affects the low water availability of plants. [score:2]
We also verified the interaction between gma-miR396 and GmGRFs by transient expression assays with Arabidopsis mesophyll protoplasts. [score:2]
MicroRNA miR396 regulates the switch between stem cells and transit-amplifying cells in Arabidopsis roots. [score:2]
Tissue-Specific Responses of Low Water Availability in MiR396-OE Transgenic Arabidopsis plantsAs we already detected tissue-specific regulation of the miR396– GRF module in low water potential stressed soybean and we found that Pre-miR396a/b/c/e/h/i/k play practical roles in regulating tissue development, which inspired us to evaluate the low water availability of different tissues of miR396a/b/c/e/h/i/k-OE transgenic Arabidopsis plants. [score:2]
MiR396 is a conserved gene family that is found in many plant species, and some GRF -family genes are generally recognized as its target genes. [score:2]
Yang and Yu (2009) and Chen et al. (2015) found the WT plants leaves were clearly wilted compared to ath-miR396a/sp-miR396-5p over -expression tansgeninc tobacco gown on soil drying. [score:2]
Tissue-Specific Regulation of MiR396– GRF Module in Soybean Low Water Availability ResponseLow water availability status is of most obvious importance in drought stress (Verslues et al., 2006). [score:1]
When the plasmid DNA of the universal interaction vector (HBT-sGFP(S65T)-NOS- GRF) was transfected into Arabidopsis mesophyll protoplasts separately isolated from each of the WT/OE-vector and the seven miR396-OE lines (miR396a/b/c/e/h/i/k-OE), the protoplasts derived from the WT/vector showed normal green fluorescence, while those derived from miR396a/b/c/e/h/i/k-OE showed significantly reduced green fluorescence. [score:1]
Glycine max miR396 family gene sequences were obtained from miRBase Release 21 [1]. [score:1]
However, the multi-to-multi interactions of the miR396– GRF module in soybean were still unclear, and it was technically difficult to verify the predicted interactions between the seven gma-miR396 and 24 GmGRFs. [score:1]
These properties suggest that miR396 -based genetic modifications have the potential to improve the drought tolerance of plants. [score:1]
Since the interaction sites of gma-miR396 and GmGRFs are conserved (Supplementary Figure S2), the 21-bp cleavage site sequence CGTTCAAGAAAGCCTGTGGAA was inserted into the HBT-sGFP(S65T)-NOS vector (Chiu et al., 1996) to construct a universal GmGRF interaction vector (HBT-sGFP(S65T)-NOS- GRF). [score:1]
miR396 affects mycorrhization and root meristem activity in the legume Medicago truncatula. [score:1]
Soybean has the largest number of miR396/ GRF family genes identified to date: 11 miR396 loci (gma-miR396a∼k) and 26 GmGRF family genes (GmGRF1–GmGRF26). [score:1]
MiR396- GRF Module Effect on Plant Development. [score:1]
Previous studies predicted interactions between miR396 and GRF -family genes, and these interactions were partially verified at the experimental level in Arabidopsis and Oryza sativa. [score:1]
Control of cell proliferation in Arabidopsis thaliana by microRNA miR396. [score:1]
Several studies have shown that the miR396– GRF module is involved in the responses to various biotic and abiotic stresses, including drought, salt, alkali, UV-B radiation, osmotic stresses, and pathogen infection (Gao et al., 2010; Kim et al., 2012; Casadevall et al., 2013; Chen et al., 2015). [score:1]
Tissue-Specific Regulation of MiR396– GRF Module in Soybean Low Water Availability Response. [score:1]
For each transgenic Arabidopsis line (miR396a–k-OE), at least 20 independent transgenic plants were obtained, and the homozygous lines with the highest levels of Pre-miR396 transcripts were used for morphological observations. [score:1]
However, other seven of the miR396-OE transgenic Arabidopsis lines (miR396a/b/c/e/h/i/k-OE) showed significant phenotypic changes. [score:1]
That is, seven gma-miR396 (gma-miR396a/b/c/h/e/i/k) and 20 GmGRFs (GmGRF1/2/6-11/13-24) in soybean represent a multi-to-multi network interaction. [score:1]
Vector Construction and Generation of Transgenic ArabidopsisEach of the 11 gma-miR396 precursors (Pre-miR396a–k, listed in Supplementary Table S2) was ligated between the CaMV 35S promoter and the Nos-terminator in the modified pBasta vector, with the Bar gene inserted into the T-DNA as a selection marker gene. [score:1]
The inconsistent results probably reflected the high sensitivity of miR396 to subtle differences in soil drying stress conditions, for instance, we cultured the seedlings in one same container, more number of seedlings, more soil drying time, and so on. [score:1]
Molecular mechanism of microRNA396 mediating pistil development in Arabidopsis. [score:1]
FIGURE 2Twenty GmGRFs verified to be cleaved by gma-miR396 using 5′RACE. [score:1]
Each of the 11 gma-miR396 precursors (Pre-miR396a–k, listed in Supplementary Table S2) was ligated between the CaMV 35S promoter and the Nos-terminator in the modified pBasta vector, with the Bar gene inserted into the T-DNA as a selection marker gene. [score:1]
The 5′ termini of mRNA fragments were identified by the cloned 5′-RACE products, which matched to the correct GmGRFs and had 5′-ends centered on the miR396-complemented site (Supplementary Figure S4). [score:1]
[1 to 20 of 79 sentences]
[+] score: 41
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR164a, gma-MIR167c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR1509b, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR4403, gma-MIR171c, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR1535b, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5037b, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR169m, gma-MIR171k, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR167j, gma-MIR171l, gma-MIR393b, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR319n, gma-MIR171p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR6300, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l
It was worthy notice that three members of miR396 family performed different expression, in which miR396a-3p and miR396i-3p were significantly up-regulated, while miR396b-5p was down-regulated (Table 1). [score:9]
Under Cd stress, miR397, miR408 and miR398 were reported to be up-regulated and miRNA396 and miRNA319 to be down-regulated in response to Cd exposure in the root of rice or Brassica [25], [26]. [score:7]
Ahy-miR398, gma-miR398a and gma-miR398c, of 398 family members, showed over 2-fold up-regulated only in HX3, whereas two 396 family members, miR396a-3p and miR396i-3p showed over 2-fold up-regulated only in ZH24. [score:7]
Consistent with the fact that miR396 acts as a negative regulator of GRF gene expression, overexpression of miR396 negatively impacted cell proliferation in leaves and meristem size [78], [82]. [score:6]
Among the 26 miRNAs, 14 miRNAs (gma-miR3522, gso-miR3522a, gso-miR3522b, gma-miR397a, PN-miR397a_L-1, ahy-miR408-3p, gma-miR408, gma-miR408b-5p, gma-miR4996, gma-miR396a-3p, gma-miR396i-3p, ahy-miR398, gma-miR398a and gma-miR398c) belonging to six families were up-regulated by Cd exposure (P<0.01) in both HX3 and ZH24. [score:4]
In addition, we also found that two other miR396 family members, gma-miR396a-3p and gma-miR396i-3p, showed up-regulated in the both cultivars, which was contrary with that of gma-miR396b-5p and its homologous members. [score:4]
The expression patterns of gma-miR396b-5p in two soybean genotypes were very similar with that of miR396 in rice [25] and Brassica [26]. [score:3]
Ding et al. [25] verified that miR166, miR171, miR390, miR156 and miR168 responded to Cd stress in rice, and Zhou et al. [26] reported that miR396, miR397, miR398 and miR408 were related to Cd exposure in Brassica. [score:1]
[1 to 20 of 8 sentences]
[+] score: 30
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR167c, gma-MIR390a, gma-MIR390b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1510a, gma-MIR1511, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR172f, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR408d, gma-MIR482c, gma-MIR1507c, gma-MIR1508c, gma-MIR4998, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5368, gma-MIR5371, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR482d, gma-MIR4413b, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR319n, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l
S2 FileqRT-PCR was used to verify the targets prediction at 8 and 16 h. (Fig A) The results of qRT-PCR validation of the targets of miR159e-3p and miR482b-3p at 8 h. (Fig B) The results of the qRT-PCR validation of the targets of miR1507 and miR1508 at 8 h. (Fig C) The results of the qRT-PCR validation of the targets of miR166 at 8 h. (Fig D) The results of the qRT-PCR validation of the targets of miR1510 at 8 h. (Fig E) The results of the qRT-PCR validation of the targets of miR4413 at 16 h. (Fig F) The results of the qRT-PCR validation of the targets of miR396 and miR159e-3p at 16 h. (Fig G) The results of the qRT-PCR validation of the targets of miR1508 and miR4413 (the expression of the two targets were much higher than other targets of miR4413). [score:23]
1) and one target gene of miR396 (Glyma16g00260. [score:3]
At 16 h, the targets of miR159, miR1508, miR396, and miR4413 showed increased transcription under SDs and responded to the day-length treatment. [score:3]
The induction ratio of most of the microRNAs selected was higher for the miRNA sequencing analysis than in the qRT-PCR validation experiment, except for four miRNAs (miR4998, miR4413b, miR396 and miR1511) at 16 h (S1 File). [score:1]
[1 to 20 of 4 sentences]
[+] score: 30
Ectopic expression of miR396 suppresses GRF target gene expression and alters leaf growth in Arabidopsis. [score:9]
Collectively, this suggests that miR394, miR396, miR1509, and miR2218 were up-regulated in the apical hook by FRc; In the hypocotyl, miR168, miR166, and miR1507 were down regulated and miR167 was up-regulated by FRc (Figure 5A; Table S6). [score:8]
miR394, miR396, miR530, miR1509, and miR2218 were up-regulated by FRc in the hook concave region (Figure 5A), while miR166, miR394, miR396, miR1508, miR1509, and miR2218 were up-regulated by FRc in the hook convex region (Figure 5A). [score:7]
For some of the microRNAs, e. g., miR166, miR167, and miR396, their mRNA targets have been well characterized to regulate plant growth and development (Williams et al., 2005; Wu et al., 2006; Jung and Park, 2007; Liu et al., 2009; Rodriguez et al., 2010). [score:3]
The miR396 level was at higher levels in response to FRc in both sides of the hook in our study, again requiring confirmation, but possibly part of a mechanism to alter growth regulation. [score:2]
Control of cell proliferation in Arabidopsis thaliana by microRNA miR396. [score:1]
[1 to 20 of 6 sentences]
[+] score: 15
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1514a, gma-MIR1514b, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR2109, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR4345, gma-MIR396d, gma-MIR4369, gma-MIR482b, gma-MIR167g, gma-MIR4397, gma-MIR156f, gma-MIR4409, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR1508c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5373, gma-MIR403a, gma-MIR403b, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR482d, gma-MIR1512b, gma-MIR1513c, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR1512c, gma-MIR5767, gma-MIR5770a, gma-MIR393b, gma-MIR5781, gma-MIR5770b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR399i, gma-MIR167k, gma-MIR5770c, gma-MIR1446, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
miR168 regulates Argonaute-1, an essential protein for miRNA activity; miR396 regulates several GRF transcription factors that are mostly known to regulate leaf development [17] but also central for normal root growth and development [18] and miR1508 and miR1511 appears to be mostly found in legumes thus far, suggesting lineage-specific roles. [score:6]
Recently, several studies reported differential expression of miRNAs such as miR164, miR169, miR171, miR396, miR398, miR399, miR408 and miR2118 in drought-stressed plants but their regulation (up or down) differed between different plant species [5]. [score:4]
Among the highly conserved 23 miRNA families [23], two (miR156 and miR166) were classified as high, three (miR168, miR396 and miR172) as moderate and seven (miR169, miR171, miR164, miR390, miR159, miR160 and miR167) as low and two (miR395 and miR399) as extremely low abundantly expressed miRNA families in primary root tips of soybean. [score:3]
Six miRNA families (miR168, miR396, miR1511, miR1508, miR172 and miR3522) were grouped as moderately abundant in primary root tips (Additional file 2). [score:1]
The miR168 family is the most enriched in this group followed by miR396 and miR1511 families. [score:1]
[1 to 20 of 5 sentences]
[+] score: 13
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR1514a, gma-MIR1514b, gma-MIR1536, gma-MIR1530, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR398c, gma-MIR2118a, gma-MIR2118b, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR167j, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR169t, gma-MIR166l, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR398d, gma-MIR167k, gma-MIR167l, gma-MIR169w
It should be noted that many targets of a single conserved miRNA are in pairs with very similar sequences, and the gma-miR156, gma-miR160, gma-miR164, gma-miR166, gma-miR172 and gma-miR396 had at least 10 targets, with the gma-miR396 having more than 20 targets (Table 3). [score:7]
A series of targets for known miRNAs, including gma-miR156, gma-miR159, gma-miR160, gma-miR164, gma-miR167, gma-miR169, gma-miR396, gma-miR398 and gma-miR1514, belong to this class (Tables 3, 4). [score:3]
The gma-miR396 had 21 target genes, and most of these could be grouped into Class I and Class II (Table 3). [score:3]
[1 to 20 of 3 sentences]
[+] score: 12
Other miRNAs from this paper: gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR159d, gma-MIR396e, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR393b, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR396j, gma-MIR171q, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR482e, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR169u, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
For example, transient up regulation of miR172 (Figure 5) which regulates a putative Apetala2-like transcription factor, down-regulation of miR166 and miR396 (Figure 5) targeting an HD-ZIPIII-like transcription factor and a cysteine protease respectively are potentially novel regulatory elements during nodulation. [score:9]
The identified targets of miR168 [TGI:BG882680; 1 clone] and miR396 [TGI:TC206710; 2 clones] in soybean seem to be non-conserved. [score:3]
[1 to 20 of 2 sentences]
[+] score: 12
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR482a, gma-MIR1507a, gma-MIR1510a, gma-MIR1513a, gma-MIR1520d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR482b, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1513b, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR482d, gma-MIR1513c, gma-MIR4415b, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR169t, gma-MIR166l, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR319o, gma-MIR319p, gma-MIR319q, gma-MIR169w
Of these, only 21 families had predicted targets and they are listed in the Additional file 2. The conserved miRNA families showed multiples targets, however families MIR156, MIR172, MIR396, MIR397, MIR1510 and MIR1513 were highly conserved about their targets. [score:7]
The same occur with MIR396, MIR397, MIR1510 and MIR1513 families that targeted various genes families as GRF (growth regulating factor) transcription factor, multicopper oxidases, LRR (leucine-rich-repetitions)-containing proteins and F-BOX domain proteins respectively. [score:4]
One new gene was detected in MIR169, MIR172, MIR396 and MIR482 with mature sequences originated from both the 3'and 5'arms (Table 4). [score:1]
[1 to 20 of 3 sentences]
[+] score: 11
The gene expression levels of 396a and GRF9 were inversely correlated, probably because GRF genes are miR396 targets in plants [51– 53]. [score:5]
As reported previously, miR396 expression is affected by various environmental stresses [28, 47– 51]. [score:3]
This was consistent with the results of previous studies that concluded miR396 gene expression was insensitive to ABA[54]. [score:3]
[1 to 20 of 3 sentences]
[+] score: 9
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR391, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR394c, gma-MIR398c, gma-MIR408d, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR403a, gma-MIR403b, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR167j, gma-MIR393b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR399c, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR166l, gma-MIR394f, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Because the exact sequence of miR396d,e has not been found in the Arabidopsis or Populus genomes and its expression could not be detected in Arabidopsis, it was considered a monocot-specific version of the miR396 family [3]. [score:2]
We also found five families (miR159, miR160, miR164, miR166 and miR168) conserved in gymnosperms and two (miR396 and miR408) in Selaginella. [score:1]
miR396 homologs were found to be deeply conserved [27]. [score:1]
Thus, the identification of miR437, miR444 and the miR396d/e variant of the miR396 family in several monocots provided solid support for consideration of these miRNAs as being monocot specific. [score:1]
miR403 homologs were found in 16 dicots, whereas miR437 and miR444 homologs, as well as the miR396d/e variant of the miR396 family, were found only in monocots, thus providing large-scale authenticity for the dicot- and monocot-specific miRNAs. [score:1]
Six families (miR159, miR160, miR167, miR170/171, miR396 and miR399) were found in 30–39 diverse plant species (Table 1). [score:1]
We found six families (miR159, miR160, miR167, miR170/171, miR396 and miR399) in 30–39 species; seven (miR164, miR168, miR172, miR393, miR395, miR398 and miR408) in 20–29 species; and five (miR162, miR390, miR397, miR403 and miR437) in 10–19 species (Table 1). [score:1]
miR396 in rice is represented by two variants with five loci (OsmiR396a,b,c and OsmiR396d,e) [3]. [score:1]
[1 to 20 of 8 sentences]
[+] score: 8
Compared to A3244, all ten of the differentially expressed gma-miRNAs in MON89788 were down-regulated, including the members of miR1507, miR1510, miR166, miR319, miR390, miR396 and miR482 families. [score:5]
As a result, ten gma-miRNAs were down-regulated in MON89788 compared with A3244 soybeans, including mature members of the miR1507, miR1510, miR166, miR319, miR390, miR396 and miR482 families. [score:3]
[1 to 20 of 2 sentences]
[+] score: 8
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR319a, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR393a, gma-MIR1518, gma-MIR1520d, gma-MIR1521a, gma-MIR396c, gma-MIR2119, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR4380a, gma-MIR396d, gma-MIR4378a, gma-MIR4380b, gma-MIR156f, gma-MIR4407, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR396f, gma-MIR396g, gma-MIR397a, gma-MIR397b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR396h, gma-MIR1512b, gma-MIR4413b, gma-MIR5674a, gma-MIR5770a, gma-MIR4416c, gma-MIR5770b, gma-MIR399a, gma-MIR156p, gma-MIR156q, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR166l, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR5674b, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR9747, gma-MIR399i, gma-MIR9763, gma-MIR5770c, gma-MIR399j, gma-MIR399k, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Baucher M Moussawi J Vandeputte OM Monteyne D Mol A Pérez-Morga D A role for the miR396/GRF network in specification of organ type during flower development, as supported by ectopic expression of Populus trichocarpa miR396c in transgenic tobaccoPlant Biol. [score:4]
Liang G He H Li Y Wang F Yu DQ Molecular mechanism of miR396 mediating pistil development in Arabidopsis thalianaPlant Physiol. [score:2]
Yang FX Liang G Liu DM Yu DQ Arabidopsis miR396 mediates the development of leaves and flowers in transgenic tobaccoJ Plant Biol. [score:2]
[1 to 20 of 3 sentences]
[+] score: 6
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR393a, osa-MIR394, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR393a, gma-MIR482a, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ahy-MIR156a, ahy-MIR156b, ahy-MIR156c, ahy-MIR159, ahy-MIR167, ahy-MIR394, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR394c, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR482d, gma-MIR167j, gma-MIR393b, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR394e, gma-MIR169t, gma-MIR166l, gma-MIR394f, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR167k, gma-MIR167l, gma-MIR169w
Compared with miR156 and miR172, the expression levels of miR157 and miR162 are moderate while the expression of miR396 is low. [score:4]
In this study, we adopted this technique to validate and measure the expression of 4 novel miRNAs (miRn1, miRn2 and miRn2*, miRn3, and miRn4) as well as 5 conserved miRNAs (miR156, miR157, miR162, miR172, and miR396). [score:1]
In this study, 5 conserved miRNAs (miR156, miR157, miR162, miR172, and miR396) and 4 peanut-specific miRNAs (miRn1, miRn2 and miRn2*, miRn3, and miRn4) were validated using qRT-PCR (Table 3). [score:1]
[1 to 20 of 3 sentences]
[+] score: 5
Intriguingly, some miRNA target transcripts in the dcl1a [Δ] [7]/dcl1a [Δ] [7]/dcl1b [Δ] [3]/dcl1b [Δ] [3] mutant background, notably the miR396 target gene Glyma05g20930 (Glyma. [score:5]
[1 to 20 of 1 sentences]
[+] score: 4
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR393a, gma-MIR482a, gma-MIR1508a, gma-MIR1509a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, gma-MIR1517, gma-MIR167d, gma-MIR396c, gma-MIR1508b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, gma-MIR4357, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR394c, gma-MIR482c, gma-MIR1508c, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR1512c, gma-MIR5559, gma-MIR393b, gma-MIR4416c, gma-MIR4416b, gma-MIR399a, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR394e, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR394f, gma-MIR399f, gma-MIR399g, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR1515b, gma-MIR399i, gma-MIR167k, gma-MIR167l, gma-MIR4405b, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
Differential expression of miRNAs such as gma-miR167, gma-miR172, gma-miR399, gma-miR396 and gma-miR169c in soybean nodules, and mtr-miR2568, mtr-miR107 in M. truncatula were also identified [34– 36]. [score:3]
Genome-wide screens have identified miRNAs, such as miR393, miR394, miR396 and miR156 specifically responsive to salt stress in Arabidopsis, Zea mays, Populus tremula, rice and soybean [21, 24– 29]. [score:1]
[1 to 20 of 2 sentences]
[+] score: 4
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR390, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, osa-MIR827, osa-MIR396f, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR1509b, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR171l, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR1515b, gma-MIR398d, gma-MIR319o, gma-MIR319p, gma-MIR399i, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
It was reported that five conserved miRNAs (miR159, miR162, miR166, miR390, and miR399) presented similar expression levels in root apexes and nodules, but miR169, miR171, miR393, and miR396 enriched in root tips [41]. [score:3]
MicroRNA chip experiments showed that eight miRNAs (miR156/157, miR167, miR168, miR319, miR159, miR894, miR1507, and miR1509) were induced by Pi starvation in soybean leaves, and seven miRNAs (miR159, miR894, miR1507, miR1509, miR396, miR474, and miR482) were induced in soybean roots by low P [31]. [score:1]
[1 to 20 of 2 sentences]
[+] score: 3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR408, ath-MIR156g, ath-MIR156h, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, ath-MIR848, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR1527, gma-MIR1533, gma-MIR396c, pvu-MIR166a, pvu-MIR399a, gma-MIR396d, gma-MIR156f, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR408d, ath-MIR5021, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR171l, ath-MIR156i, ath-MIR156j, gma-MIR399a, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR169w
In Arabidopsis, it was found that miR396 family targets the tubulin mRNAs [71]. [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162a, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
In addition to analysis of miRNA duplications between paralogous contigs, miRNA-containing tandem repeats were also detected in miR395 and miR396. [score:1]
miR396, miR166, miR172, miR169 and miR395 were also present at multiple loci in date palm, and these miRNAs had the highest average copy number in the other plant species. [score:1]
In the miR396 family, miR396e/f was a tandem duplication pair with pre-miRNA sequence similarity of about 85%, and a short (135 bp) distance between tandem repeats. [score:1]
[1 to 20 of 3 sentences]
[+] score: 3
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR393a, gma-MIR171b, gma-MIR1515a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR171j, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR167j, gma-MIR171l, gma-MIR393b, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR156t, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR394g, gma-MIR167k, gma-MIR167l, gma-MIR169w
These miRNAs including miR156, miR158, miR165, miR167, miR168, miR169, miR171, miR393, miR394 and miR396 were responsive to salt stress and may fine-tune plant stress responses at multiple levels through targeting the genes with different functions including large sets of genes that encode various transcription factors [15, 19, 20]. [score:3]
[1 to 20 of 1 sentences]
[+] score: 3
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1511, gma-MIR1512a, gma-MIR1516a, gma-MIR1520d, gma-MIR1520a, gma-MIR1520b, gma-MIR1520c, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2119, gma-MIR167e, gma-MIR167f, gma-MIR1509b, gma-MIR1520e, gma-MIR1520f, gma-MIR1520g, gma-MIR4387c, gma-MIR1520h, gma-MIR1520i, gma-MIR396d, gma-MIR1520j, gma-MIR4365, gma-MIR4387b, gma-MIR482b, gma-MIR1520k, gma-MIR1520l, gma-MIR1520m, gma-MIR1520n, gma-MIR1520o, gma-MIR4387a, gma-MIR4387d, gma-MIR167g, gma-MIR1520r, gma-MIR156f, gma-MIR1520p, gma-MIR169d, gma-MIR1520q, gma-MIR171c, gma-MIR169e, gma-MIR4413a, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR390c, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR862a, gma-MIR1507c, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR1516b, gma-MIR169h, gma-MIR167h, gma-MIR5039, gma-MIR169i, gma-MIR396f, gma-MIR5041, gma-MIR396g, gma-MIR167i, gma-MIR862b, gma-MIR5372, gma-MIR5374, gma-MIR5376, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR482d, gma-MIR1512b, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR5668, gma-MIR5671a, gma-MIR1512c, gma-MIR4387e, gma-MIR393b, gma-MIR1516c, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR319n, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1516d, gma-MIR398d, gma-MIR5671b, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
Some of miRNA families, such as MIR156, MIR160, MIR164, MIR393, MIR396, MIR1510 were conserved in their targets. [score:3]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR168a, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR171b, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1515a, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR1509b, gma-MIR396d, gma-MIR156f, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR390c, gma-MIR398c, gma-MIR2118a, gma-MIR2118b, gma-MIR862a, gma-MIR1507c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR171j, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR171l, gma-MIR2111a, gma-MIR393b, gma-MIR399a, gma-MIR828a, gma-MIR156p, gma-MIR828b, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR2111e, gma-MIR2111f, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1515b, gma-MIR398d, gma-MIR399i, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
The highest read abundance (31,416 RPM and 20,776 RPM) was detected for gma-miR159, and was 2–25-fold greater than other relatively abundant miRNA families, including gma-miR396, gma-156, miR168, and miR166, whose total abundance ranged from 1,000 to 15,000 RPM (Table S2). [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: gma-MIR159a, gma-MIR166a, gma-MIR166b, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR393a, gma-MIR171b, gma-MIR482a, gma-MIR1507a, gma-MIR1509a, gma-MIR1510a, gma-MIR1512a, gma-MIR1518, gma-MIR396c, gma-MIR1507b, gma-MIR1510b, gma-MIR2109, gma-MIR2119, gma-MIR1509b, gma-MIR396d, gma-MIR482b, gma-MIR169d, gma-MIR171c, gma-MIR169e, gma-MIR159d, gma-MIR396e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR398c, gma-MIR408d, gma-MIR2118a, gma-MIR2118b, gma-MIR482c, gma-MIR1507c, gma-MIR4996, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR5037c, gma-MIR171j, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR482d, gma-MIR1512b, gma-MIR171l, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR171m, gma-MIR171n, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR399b, gma-MIR396j, gma-MIR171q, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR482e, gma-MIR399c, gma-MIR171r, gma-MIR399d, gma-MIR399e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR169u, gma-MIR399h, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR398d, gma-MIR9727, gma-MIR9750, gma-MIR399i, gma-MIR399j, gma-MIR399k, gma-MIR169w, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
The most abundant miRNAs in all libraries were conserved miRNAs such as miR482, miR159, and miR396, while several legume specific miRNAs, such as miR1510, miR2109, miR2118, miR4996, and miR1509, were also highly abundant. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR1507a, gma-MIR1508a, gma-MIR1509a, gma-MIR1510a, gma-MIR1523a, gma-MIR1528, gma-MIR1535a, gma-MIR167d, gma-MIR396c, gma-MIR1507b, gma-MIR1508b, gma-MIR1510b, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR1509b, gma-MIR396d, gma-MIR4366, gma-MIR4382, gma-MIR4389, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR4411, gma-MIR171c, gma-MIR169e, gma-MIR4412, gma-MIR4413a, gma-MIR156g, gma-MIR159d, gma-MIR4416a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR408d, gma-MIR1507c, gma-MIR1508c, gma-MIR1535b, gma-MIR4996, gma-MIR1523b, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR5374, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR396h, gma-MIR4413b, gma-MIR167j, gma-MIR171l, gma-MIR5667, gma-MIR5761a, gma-MIR4416c, gma-MIR5761b, gma-MIR4416b, gma-MIR156p, gma-MIR171m, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR169o, gma-MIR171p, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR171r, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR167k, gma-MIR167l, gma-MIR169w
Some identified miRNA families such as miR156, miR160, miR164, miR166, miR396, and miR397 are highly conserved in many plant species, such as Arabidopsis thaliana, Oryza sativa, and Zea mays. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR319a, gma-MIR319b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR319c, gma-MIR156b, gma-MIR169a, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR482a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR169e, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR168b, gma-MIR169f, gma-MIR169g, gma-MIR319d, gma-MIR319e, gma-MIR319f, gma-MIR482c, gma-MIR530a, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR403a, gma-MIR403b, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR397a, gma-MIR397b, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR319g, gma-MIR319h, gma-MIR319i, gma-MIR319j, gma-MIR319k, gma-MIR319l, gma-MIR319m, gma-MIR396h, gma-MIR482d, gma-MIR167j, gma-MIR2111a, gma-MIR530b, gma-MIR828a, gma-MIR156p, gma-MIR530c, gma-MIR828b, gma-MIR530d, gma-MIR156q, gma-MIR169o, gma-MIR319n, gma-MIR530e, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR169t, gma-MIR2111e, gma-MIR2111f, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR169u, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR169v, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, gma-MIR319o, gma-MIR319p, gma-MIR167k, gma-MIR319q, gma-MIR167l, gma-MIR169w
Seven miRNA families (miR159, miR162, miR164, miR169, miR395, miR396, and miR397) most likely evolved in the common ancestor of spermatophytes, as they were present in both gymnosperm and angiosperm lineages. [score:1]
[1 to 20 of 1 sentences]
[+] score: 1
Other miRNAs from this paper: gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR398a, gma-MIR398b, gma-MIR156b, gma-MIR167c, gma-MIR390a, gma-MIR390b, gma-MIR393a, gma-MIR482a, gma-MIR1511, gma-MIR1512a, gma-MIR1515a, gma-MIR167d, gma-MIR396c, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR172f, gma-MIR156g, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR390c, gma-MIR398c, gma-MIR482c, gma-MIR167h, gma-MIR396f, gma-MIR396g, gma-MIR167i, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR319l, gma-MIR396h, gma-MIR482d, gma-MIR1512b, gma-MIR167j, gma-MIR2111a, gma-MIR1512c, gma-MIR393b, gma-MIR399a, gma-MIR156p, gma-MIR172k, gma-MIR156q, gma-MIR172l, gma-MIR156r, gma-MIR399b, gma-MIR396j, gma-MIR156s, gma-MIR396k, gma-MIR2111b, gma-MIR2111c, gma-MIR166k, gma-MIR2111d, gma-MIR156t, gma-MIR482e, gma-MIR399c, gma-MIR399d, gma-MIR399e, gma-MIR166l, gma-MIR2111e, gma-MIR2111f, gma-MIR399f, gma-MIR399g, gma-MIR166m, gma-MIR399h, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR390d, gma-MIR390e, gma-MIR390f, gma-MIR390g, gma-MIR393c, gma-MIR393d, gma-MIR393e, gma-MIR393f, gma-MIR393g, gma-MIR393h, gma-MIR393i, gma-MIR393j, gma-MIR393k, gma-MIR1515b, gma-MIR398d, gma-MIR399i, gma-MIR167k, gma-MIR167l, gma-MIR399j, gma-MIR399k, gma-MIR399l, gma-MIR399m, gma-MIR399n, gma-MIR399o
miR396 affects mycorrhization and root meristem activity in the legume Medicago truncatula. [score:1]
[1 to 20 of 1 sentences]