sort by

141 publications mentioning mmu-mir-133c (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-133c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 262
a Ischemic upregulated miR-133 expression in MI hearts, while t-AUCB suppressed miR-133 expression in a dose -dependent manner. [score:10]
In addition, miR-133 overexpression inhibited expression of the target mRNA, whereas t-AUCB reversed the effects. [score:9]
First, the proarrhythmic factor miR-133 is upregulated in response to MI, and the sEHI t-AUCB negatively regulates miR-133 expression. [score:7]
In line with this, up-regulation of miR-133 and down-regulation of KCNQ1 and KCNH2 mRNA/protein were observed in ischemic myocaridum, whereas administration of sEHIs produced an opposite effect. [score:7]
In addition, Chen et al. [20] showed that SRF is a target of miR-133 and that miR-133 overexpression inhibited the SRF 3′ UTR luciferase reporter gene. [score:7]
Here, we demonstrate for the first time that the sEHI t-AUCB dose -dependently suppresses miR-133 upregulation in the ischemic myocardium, which might be responsible for the anti-arrhythmic effect of the sEHI. [score:6]
SRF protein upregulation might be a mechanism by which sEHIs reduce miR-133 expression. [score:6]
Fig. 3t-AUCB prevented upregulation of miR-133 and restored the expression of KCNQ1 and KCNH2 mRNA in ischemic myocardium. [score:6]
A study has revealed that miR-133 upregulation increases action potential duration and thereby prolongs the QT interval by decreasing functional expression of the KCNQ1 (potassium voltage-gated channel subfamily Q member 1)-encoded slow delayed rectifier K [+] current (I [Ks]) channel in human cardiac progenitor cells [16]. [score:6]
In line with this, Angelini et al. [34] reported that miR-133 was downregulated in transgenic mice with cardiac-specific overexpression of SRF. [score:6]
The result further demonstrated that sEHi indirect effected the expression of KCNQ1 and KCNH2 mRNA via suppression miR-133. [score:6]
SRF controls the muscle-specific expression of miR-133; miR-133 represses SRF expression. [score:5]
In agreement with its miR-133–reducing effect, we demonstrate that t-AUCB restored the expression of the miR-133 target genes, i. e., KCNQ1 and KCNH2 mRNA and protein, in the ischemic myocardium. [score:5]
Therefore, we speculated that a sEHI would affect KCNQ1 and KCNH2 mRNA and protein expression, in part by suppressing miR-133. [score:5]
By contrast, it has been proposed that SRF suppresses miR-133 expression [15, 20, 24, 33]. [score:5]
TargetScan indicated that some arrhythmia-related mRNA encoding K channels, such as KCNQ1 and KCNH2, as possible targets of miR-133. [score:5]
To this end, we determined the effects of the sEHI trans-4-[4-(3-adamantan-1-yl-ureido)-cyclohexyloxy]-benzoic acid (t-AUCB) on the expression of miR-133, its target arrhythmia–related genes (KCNQ1 and KCNH2), and serum response factor (SRF), an important transcriptional factor in cardiomyocytes. [score:5]
Furthermore, miR-133 can also inhibit the expression of KCNH2 (potassium voltage-gated channel subfamily H member 2), which encodes the ether-a-go-go related gene (ERG) channel subunit responsible for delayed rectifier K [+] current (I [kr]), resulting in slowed repolarization and prolonged QT interval in the heart [17]. [score:5]
miR-133 knockdown by the antisense molecule AMO-133 prevented QT prolongation and QRS widening by restoring ERG protein expression. [score:4]
Of these, the muscle-specific miR-133 was downregulated in the ischemic myocardium. [score:4]
Moreover, Belevych et al. [25] reported that miR-133 upregulation led to abnormal myocyte Ca [2+] handling and increased propensity for arrhythmogenesis. [score:4]
Many studies have shown that miR-133 upregulation might be a proarrhythmic factor in the heart. [score:4]
However, the mechanism responsible for miR-133 downregulation by t-AUCB remains poorly understood. [score:4]
Finally, the activator SRF might trigger the t-AUCB–induced miR-133 downregulation. [score:4]
Among them, two proarrhythmic miRNAs, i. e., miR-1 and miR-133, were downregulated in the MI mice after t-AUCB treatment (Additional file 1: Figure S2B). [score:4]
Therefore, sEHI downregulation of miR-133 might confer protection against arrhythmia. [score:4]
b The upregulation of miR-133 was exacerbated by agomir in MI hearts, but alleviated by t-AUCB. [score:4]
KCNQ1 and KCNH2 mRNA and protein are directly negatively modulated by miR-133, which can target the 3′ UTR of KCNQ1 and KCNH2 mRNA [14, 28, 29]. [score:4]
The upregulated miR-133 was abrogated in a dose -dependent manner in MI mice treated with t-AUCB (Fig. 3a). [score:4]
We found that the SRF protein downregulation was accompanied by increased miR-133 levels after MI. [score:4]
Here, we observed the upregulation of miR-133 in ischemic myocardium at 24 h post-MI compared with sham group by using miRNA microarray in a mouse mo del of MI. [score:3]
However, t-AUCB showed no effect on the expression of miR-133 in sham-operated mice. [score:3]
We used computational predictions to identify the possible miR-133 targets. [score:3]
As miRNAs can affect the stability of specific target mRNAs through post-transcriptional repression, we investigated the effects of miR-133 on the expression of KCNQ1 and KCNH2 mRNA. [score:3]
Therefore, miR-133 could be a new target for treating ischemic arrhythmias. [score:3]
Abnormal miR-133 expression provokes cardiac arrhythmias by repressing several K [+] channel genes. [score:3]
Shan et al. [17] reported that increased miR-133 expression contributed to arsenic -induced cardiac electrophysiological disorders by repressing ERG protein levels in a guinea pig mo del. [score:3]
More important, we further demonstrated that sEHi t-AUCB could restore the expression of KCNQ1 and KCNH2 mRNA, which were repressed by the agonist miR-133 agomir. [score:3]
The miR-133 activator agomir-133 was transfected into cells to construct the miR-133 overexpression mo del. [score:3]
More strikingly, the aberrant expression of miR-133 has been linked to many cardiac disorders, such as cardiac hypertrophy, heart failure, myocardial infarction and cardiac arrhythmia [15]. [score:3]
This could be explained by the fact that surviving cardiomyocytes can release miR-133a–containing exosomes into the circulating blood after calcium ionophore stimulation, resulting in decreased miR-133 expression in the border zone of the infarcted myocardium and elevated levels of circulating miR-133. [score:3]
In MI mice, sEHI t-AUCB can repress miR-133, consequently stimulating KCNQ1 and KCNH2 mRNA and protein expression, suggesting a possible mechanism for its potential therapeutic application in ischemic arrhythmias. [score:3]
Consistently, the present study demonstrates an inverse relationship between SRF protein and miR-133 expression. [score:3]
To confirm the microarray results, the changes in miR-133 expression were validated using qRT-PCR. [score:3]
It is therefore expected that t-AUCB can restore the impaired SRF protein after ischemia by suppressing miR-133 levels. [score:3]
For example, miR-133 was enriched in muscle tissues and myogenic cells, and it was found to be involved in diverse physiological processes including carcinogenesis, myocyte differentiation, and disease. [score:3]
Effects of different doses of agomir-133 (15, 25, 40 nM) on expression of miR-133 in ischemic myocardium. [score:3]
In contrast, Kuwabara et al. [26] reported that miR-133 expression was decreased in the border zone at 24 h after coronary ligation in a mouse mo del of MI; in situ hybridization determined that the hybridization signal of miR-133 had almost disappeared. [score:3]
Here, we determined the effects of t-AUCB on miR-133 expression in the ischemic myocardium of MI mice. [score:3]
Soluble epoxide hydrolase inhibitors, miR-133 Ischemic arrhythmia Life-threatening ischemic arrhythmias occurring following myocardial infarction (MI) are a common cause of sudden cardiac death. [score:3]
miR-133 overexpression can enhance myoblast proliferation by repressing SRF protein. [score:3]
In conclusion, the sEHI t-AUCB increases KCNQ1 and KCNH2 mRNA and protein by suppressing miR-133 under ischemic arrhythmia conditions. [score:3]
MicroRNA-133 mediates cardiac diseases: mechanisms and clinical implications. [score:2]
As miR-1 and miR-133 have the same proarrhythmic effects in the heart, we assumed that the beneficial effects of sEHIs might also relate to the regulation of miR-133. [score:2]
miR-133 expression was increased by 3.3-fold in the MI group as compared with the sham group (Fig.   3a, P < 0.05). [score:2]
As we have previously demonstrated the role of miR-1 in the ischemic arrhythmia–related gene network [18, 19], we wanted to explore the regulatory function of miR-133 in arrhythmia in the present study. [score:2]
miR-133 expression was increased by 3.1-fold in the MI group as compared with the sham group. [score:2]
Furthermore, SRF might participate in the negative regulation of miR-133 by t-AUCB. [score:2]
Fig. 5SRF signaling pathway participated in regulation of miR-133 by sEHi. [score:2]
Moreover, miR-133 regulates the proteins involved in Ca [2+] handling [37]. [score:2]
Therefore, we hypothesize in the present study that the beneficial effects of sEHIs might also be related to the regulation of miR-133. [score:2]
However, co-application of 0.1 mg/L t-AUCB and miR-133 agomir could rescue this effect. [score:1]
miR-133 level were quantificated by real-time PCR with RNA samples isolated from mice hearts 24 h after MI. [score:1]
As miR-1 and miR-133 are clustered on the same chromosome loci and transcribed together in a tissue-specific manner [20], we speculated that miR-133 might also contribute to the anti-arrhythmic action of sEHIs. [score:1]
The elevated plasma miR-133 was believed to mainly originate from the infarcted myocardium and the border zone. [score:1]
This increased tendency of miR-133 was abolished by pretreatment with t-AUCB. [score:1]
Second, we demonstrate, for the first time, that t-AUCB can abolish the repressing effects of miR-133 on KCNQ1 and KCNH2 mRNA and protein in MI mouse hearts. [score:1]
In contrast, transfection of miR-133 agomir promoted ischemic arrhythmias. [score:1]
The aim of the present study was to complement and extend our earlier studies by investigating whether the beneficial effects of sEHIs are also related to miR-133 expression except miR-1 in a mouse mo del of MI. [score:1]
In fact, there was a negative feedback loop between miR-133 and SRF protein. [score:1]
The mRNA levels of miR-133, its target genes (KCNQ1 [potassium voltage-gated channel subfamily Q member 1] and KCNH2 [potassium voltage-gated channel subfamily H member 2]), and serum response factor (SRF) were measured by real-time PCR; KCNQ1, KCNH2, and SRF protein levels were assessed by western blotting. [score:1]
MI group; & P<0.05 vs agomir-133 + MI group, n = 5 We injection the agonist miR-133 agomir (25 nM) via the tail vein and found that agomir treatment caused a 13.0-d increase in miR-133 level in the MI mice (Fig. 3b, P < 0.05). [score:1]
MI group; & P<0.05 vs agomir-133 + MI group, n = 5We injection the agonist miR-133 agomir (25 nM) via the tail vein and found that agomir treatment caused a 13.0-d increase in miR-133 level in the MI mice (Fig. 3b, P < 0.05). [score:1]
We not examine the relationship between the incidence of ischemic arrhythmia and miR-133 levels in the ischemic myocardium. [score:1]
Agomir of miR-133 (25 nM of ribonucleotide diluted in 0.2 mL saline) were injected via the tail vein after occlusion. [score:1]
In contrast, Niu et al. [35] showed a positive correlation between SRF protein and miR-133. [score:1]
Potential role of SRF in miR-133 reduction by t-AUCB. [score:1]
miR-1 and miR-133 have the same effects on cardiac arrhythmia, as they are both proarrhythmic [17, 25]. [score:1]
Effects of t-AUCB on miR-133, KCNQ1 and KCNH2 mRNA levels in MI mice. [score:1]
MI group [&] P<0.05 vs agomir-133 + MI group, n = 5–10 for each group miR-133 plays an important role in ischemic arrhythmogenesis. [score:1]
[1 to 20 of 80 sentences]
2
[+] score: 134
Of extreme relevance, WB analysis showed that the combination of miRNA499 plus miRNA133 upregulated the protein expression of both Cx43 and cTnT (Fig. 6B). [score:6]
Gene and protein expression analysis showed that miRNA499 and miRNA133 are able to induce the differentiation of AMSC into cells expressing typical cardiac markers such as Nkx2.5, GATA4, cTnT, Cx43, Ryr2, and Cav1.2. [score:5]
At the 14 days time point, WB showed that miRNA1 alone had no effect on both Cx43 and cTnT, miRNA133 increased only the expression of cTnT, while miRNA499 was able to markedly increase the expression of both Cx43 and cTnT (Fig. 3A). [score:5]
The coexpression of miRNA499 and miRNA133 further increased the expression of the atrial marker Mlc. [score:5]
Expression of cardiac cytoskeletal protein (α-sarcomeric actinin) and of other important proteins involved in cardiac excitation/contraction (EC)-coupling (Cav1.2, SERCA2a, and RyR2) was analyzed by ICC on EB coexpressing miRNA499 and miRNA133, selected from the same batch of EB showing caffeine-responsiveness. [score:5]
ICC further confirmed that miRNA499 and miRNA133 coexpression was able to induce the expression of cardiac-specific proteins like cTnT, Cx43, Serca2a, and Cav1.2 (Fig. 6C) even in the absence of DMSO. [score:5]
When miRNA499 and miRNA133 were coexpressed, we documented a significant increase in both GATA4 and Nkx2.5 expression compared with all other conditions tested (Fig. 2A, 2B). [score:4]
However, the coexpression of miRNA499 and miRNA133 resulted in a significantly higher expression of both cardiac markers compared with the other conditions tested (Fig. 7A). [score:4]
Recently, it has been suggested that certain miRNA are powerful regulators of cardiac differentiation processes [32], and it has been shown that miRNA1, miRNA133, and miRNA499 are highly expressed in muscle cells [32]. [score:4]
Most importantly, by simultaneously over -expressing miRNA499 and miRNA133 the number of P19 cells expressing cTnI was 30-fold greater compared with the standard differentiation protocol. [score:4]
Real-time PCR analysis showed that also in P19 cells not exposed to DMSO, treatment with miRNA499 and miRNA133 upregulated GATA4 (+4.9-fold, p < . [score:4]
However, when we coexpressed miRNA499 together with miRNA133 the results were significantly and strikingly superior compared with the over -expression of miRNA499 alone. [score:4]
The Combination of miRNA499 and miRNA133 Increases the Expression of Cardiac-Specific Genes. [score:3]
ICC experiments confirmed that Cx43 and cTnT were convincingly turned on upon over -expression of miRNA449 alone and even more so in combination with miRNA133 (Fig. 3B). [score:3]
In particular, untreated EB showed responses compatible with Ca [2+] -dependent electrical activity, typical of immature CMC, while Na [+] -dependent excitability was recorded in EB over -expressing miRNA499 and miRNA133. [score:3]
CMC derived from P19 cells over -expressing miRNA499 and miRNA133 develop EC-coupling properties typical of mature CMC. [score:3]
miRNA133 increased the expression of Nkx2.5 (+1.3-fold vs. [score:3]
Coexpression of miRNA499 and miRNA133 sharply increased the proportion of caffeine-responsive cells. [score:3]
Importantly for translational purposes, we have also shown that the same combination miRNA499 and miRNA133 is a powerful inducer of cardiac differentiation for human MSC. [score:3]
WB (Fig. 7B) and ICC (Fig. 7C,D) analysis confirmed that AMSC treated with miRNA499 and miRNA133 differentiated in cells expressing Cx43 and cTnT (Fig. 7B, 7C) but also Cav1.2 and Ryr2 (Fig. 7D). [score:3]
Coexpression of miRNA499 and miRNA133 induced a 3.5-fold increase in the number of responsive cells with respect to cells exposed to DMSO (p < . [score:3]
WB and ICC analysis confirmed that cardiac proteins are indeed expressed at higher levels when P19 cells are cotransfected with miRNA499 plus miRNA133. [score:3]
Cardiac-Specific Proteins Are Highly Expressed in P19 Cells Treated with miRNA499 and miRNA133. [score:3]
As already observed in P19 cells, the combination of miRNA499 with miRNA133 triggered the over -expression of both the nuclear transcription factor GATA4 (+13-fold, p < . [score:3]
In addition, the expression of genes encoding for cardiac-specific transcription factors, such as GATA4 and Nkx2.5, and cardiac-specific proteins, such as Cx43 and cTnT, was enhanced in cells treated with miRNA499 plus miRNA133. [score:3]
It is currently unknown whether the concomitant over -expression of miRNA1, miRNA133, and miRNA499 or if the combination of two of these miRNA would result in a synergistic action, further increasing the efficiency of cardiac differentiation. [score:3]
After 14 days, Cx43 was significantly over-expressed in cells treated with miRNA133 or miRNA499 and cTnT was significantly higher in the miRNA499 group compared with naïve cells (Fig. 7A). [score:2]
At day 14, the over -expression of miRNA1 or miRNA133 alone or their combination did not increase the number of beating clusters compared with DMSO treatment (Fig. 1A). [score:2]
It has been shown that miRNA1 and miRNA133 are important regulators of embryonic stem cell (ESC) differentiation into CMC. [score:2]
naïve, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1; †, p < . [score:1]
To strengthen our observation, we aimed to test whether treatment with miRNA499 plus miRNA133 in the absence of DMSO exposure was sufficient to trigger cardiac differentiation. [score:1]
The treatment of EB with both pre-miRNA499 and pre-miRNA133 resulted in the strongest activation of the cTnI promoter (Fig. 1B). [score:1]
001), 4.1-fold versus miRNA133 alone (p < . [score:1]
Figure 7Amniotic mesenchymal stromal cells (AMSC) differentiation using miRNA499 and miRNA133 precursors. [score:1]
Figure 5MEA and twitch recordings of embryoid bodies treated with pre-miRNA499 together with pre-miRNA133. [score:1]
001), and miRNA133 (+2.7-fold; p < . [score:1]
It was impossible to document the same results using different combination of miRNAs, confirming that only the couple miRNA499/miRNA133 triggers the differentiation of MSC toward a cardiac-like phenotype. [score:1]
naïve, scramble miRNA, miRNA133, miRNA1 + 499 and p < . [score:1]
DMSO, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1, and p < . [score:1]
These data strongly suggest a synergistic effect of miRNA499 and miRNA133. [score:1]
In particular, miRNA133 seems more crucial in controlling cell proliferation by repressing serum response factor and cyclin D2 [17, 24]. [score:1]
In summary, we demonstrated that miRNA499 and miRNA133 act in a synergic manner inducing P19 differentiation into CMC even in the absence of DMSO. [score:1]
Therefore, the effect of miRNA499 and miRNA133 synergism on cardiogenic differentiation was further tested based on the notion that mature excitation-contraction coupling relies on the presence of Ryrs-operated intracellular Ca [2+] stores. [score:1]
Finally, functional analysis showed that the percentage of responsive EB grown without DMSO but transfected with pre-miRNA499 and pre-miRNA133 did not significantly differ from the percentage of EB grown in the presence of 0.5% DMSO (Fig. 6D). [score:1]
After 14 days, quantification of late cardiac-specific genes confirmed the synergistic effect exerted by miRNA499 and miRNA133 (Fig. 2C, 2D). [score:1]
DMSO and miRNA133; *, p < . [score:1]
DMSO, scramble miRNA, miRNA1, miRNA133, and miRNA499 + 1; †, p < . [score:1]
The Synergic Effect of miRNA499 and miRNA133 on AMSC. [score:1]
To verify whether miRNA499 and miRNA133 exert their effects also on other cell types, we tested our protocol on AMSC. [score:1]
DMSO, miRNA1 and miRNA133; ‡, p < . [score:1]
In particular, it has been clearly shown that miRNA133 and miRNA1 promote myoblast proliferation and differentiation, respectively, and that miRNA499 enhances the differentiation of cardiac progenitor cells into CMC [17– 20]. [score:1]
Although miRNA1 and miRNA133 are cotranscribed, the function of miRNA133 is different from miRNA1. [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, and miRNA1 + 499; #, p < . [score:1]
After 4 days, the EB were transferred to plastic culture dishes in the presence of differentiation medium, and transfected with precursor molecules (pre-miRNA) for miRNA499 (PM11352, 10 nM), miRNA1 (PM10617, 10 nM), and miRNA133 (PM10413, 5 nM) in different combinations or with scrambled miRNA used as a negative CTRL (AM17110, 5 nM) (Supporting Information Table S1). [score:1]
Our results clearly showed that miRNA499 is a powerful activator of cardiac differentiation, particularly in comparison with miRNA1 and miRNA133. [score:1]
naïve, scramble miRNA, miRNA1, miRNA133, miRNA1 + 499 and p < . [score:1]
Furthermore, the spontaneous mechanical activity response of miRNA499 and miRNA133 transfected cells to modulators of Ca [2+] handling effectors (CaV, RyRs, and IP3R) is consistent with that expected for cardiac but not skeletal muscle. [score:1]
miRNA precursors were diluted in Opti-MEM I medium at the following concentration: miRNA1 and miRNA499 precursors 10 nM, miRNA133 precursor and scrambled miRNA 5 nM. [score:1]
In order to confirm the synergic action of miRNA499 with miRNA133, we tested this combination also in AMSC. [score:1]
The synergistic effect exerted by the combination of miRNA133 and miRNA499 was confirmed by activation of the cTnI cardiac-specific promoter (Fig. 1B). [score:1]
[1 to 20 of 60 sentences]
3
[+] score: 129
Consistent with others' findings [15], both miR-1 and miR-133 were found to be robustly up-regulated during C2C12 differentiation whereas YY1 expression was gradually down-regulated (Fig. 2A). [score:9]
However, YY1 expression level was found to be up-regulated at all time points examined (Fig. 2D, right), indicating that the down-regulation of miR-1 and miR-133 could be caused by elevated YY1 levels. [score:9]
Although miR-1 and miR-133 are clustered on the same chromosomal loci and transcribed together as a single transcript, there seems to be a stronger regulation on miR-133 by YY1 than on miR-1 as depleting YY1 increased miR-133 to a much higher levels than that of miR-1 (Fig. 2F) and over -expressing YY1 also down-regulated miR-133 more than miR-1 (data not shown). [score:7]
As expected, both miR-1 and miR-133 levels were up-regulated (Fig. 2C, middle and right), showing an inverse relationship with YY1 expression. [score:6]
In contrast, synthesis of miR-133 inhibits myogenesis through the down-regulation of serum response factor (SRF) which maintains myoblasts in a proliferative state [15]. [score:6]
Expression folds are shown with respect to siNC where miR-1 and miR-133 levels were set to a value of 1. (G) Expression of the primary transcripts of miR-1-2/miR-133a-1 was detected by qRT-PCR in C2C12 transfected with siYY1 or siNC oligos, and normalized to GAPDH. [score:5]
Expression folds are shown with respect to TNF treated cells where miR-1 or miR-133 levels were set to a value of 1. (B) Expression of miR-1 and miR-133 was measured in C2C12 myoblasts stably expressing Vector or the IκBα-SR transgene. [score:5]
Figure S2 NFκB suppresses miR-1 and miR-133 expression through YY1. [score:5]
from qRT-PCR analysis (Fig. 6D) revealed that the expressions of miR-1 and miR-133 were up-regulated in siYY1 injected muscles compared to siNC injected muscles at all three time points (day 2, 4 and 6) during muscle regeneration. [score:5]
Expression folds are shown with respect to siNC where miR-1 and miR-133 levels were set to a value of 1. (E) Western blotting was performed to analyze the expression of YY1, Pax7, MyoD and Myogenin. [score:5]
Collectively, our data from the above studies suggest that YY1 negatively regulates miR-1 and miR-133 expression both in physiological and pathological muscle conditions. [score:4]
Among all the putative YY1 target miRNAs, miR-1 and miR-133 families are particularly attractive considering the pivotal roles of these muscle miRs in regulating myogenesis [5]. [score:4]
We reasoned there may be two possibilities: first, it may be attributed to the fact that three copies of miR-133 are under regulation by YY1 whereas only two copies of miR-1 are subjected to YY1 regulation (Fig. 3A–C). [score:3]
In addition, our studies focused on the regulation of YY1 on miR-1 and its downstream event; it will be interesting to explore how YY1 regulated miR-133 affect satellite cell proliferation and differentiation processes. [score:3]
Since YY1 is a transcriptional target of NF-κB [19], we reasoned that miR-1 and miR-133 should also come under negative control of NF-κB. [score:3]
The rapid induction of miR-133 during differentiation and its high expression level in muscle tissue seems to contradict its documented role as growth-stimulatory and anti-myogenic. [score:3]
miR-1 is shown to promote myoblast differentiation while miR-133 promotes myoblast proliferation and inhibits myogenic differentiation [15]. [score:3]
Second, in addition to regulating the transcription of primary miR-1/133 transcripts, YY1 may also exert regulation at a later stage of miR-1/133 biogenesis, resulting in different rates of miR-1 and miR-133 production. [score:3]
Expression folds are shown with respect to 3 day old mice where miR-1 and miR-133 levels were set to a value of 1. (D) TA muscles were isolated from 3 w, 4 w, 5 w, 8 w and 10 w old C57BL/6 wild type mice or mdx mice. [score:3]
Consistent with this thinking, treatment of C2C12 myoblasts with TNFα as an activator of NF-κB reduced miR-1 and miR-133 expression (Suppl. [score:3]
Expression folds are shown with respect to wild type where miR-1, miR-133 or YY1 levels were set to a value of 1. (E) C2C12 myoblasts or (F) primary myoblasts were transfected with either negative control (siNC) or siRNA oligos against YY1 (siYY1). [score:3]
Expression folds are shown with respect to day 0 where miR-1 and miR-133 levels were set to a value of 1. Quantitative values are represented as means ± S. D. (B) YY1 expression was measured by Western blotting. [score:3]
The expression profiles of miR-1 and miR-133 were examined by qRT-PCR analysis. [score:3]
These findings suggest that miR-1 and miR-133 are subjected to regulation by NF-κB-YY1 signaling. [score:2]
Thus miR-1, miR-133 and miR-206 play central regulatory roles in muscle biology and are called muscle miRs. [score:2]
The expression of miR-133 displayed a similar change but the decrease in degeneration stage was much stronger (∼10 fold) and the elevation in regeneration stage was lower compared to miR-1 level. [score:2]
When performed in primary myoblasts, knocking down of YY1 led to an even more significant increase of miR-1 and miR-133 (13.5 and 273 fold, respectively) (Fig. 2F). [score:2]
Similar to mature miR-1 and miR-133, the level of pri-miR-1/133 transcripts was found to be induced upon siYY1 knockdown (Fig. 2G). [score:2]
As shown in Fig. 2B, when induced to differentiation by serum withdrawal, a sharp increase of both miR-1 and miR-133 expression was detected compared to GM cells. [score:2]
Our view is consistent with a recent report demonstrating that miR-1 and miR-133 produced opposing effects on apoptosis in cardiomyocytes despite the similar regulation [38]. [score:2]
Total RNAs were collected from cells differentiated (DM) for 0, 1, 3 or 5 days and used for measuring miR-1 and miR-133 expression levels. [score:1]
Findings from the current studies demonstrate a repression of miR-1, miR-133 and miR-206 by YY1. [score:1]
The above findings thus confirm the presence of a transcriptional repression of miR-1 and miR-133 by YY1. [score:1]
As visualized by Cytoscape, miR-1, miR-133, miR-206 as well as miR-29 are all under transcriptional repression by YY1. [score:1]
miR-1 and miR-133 expression was then measured by qRT-PCR normalized to U6. [score:1]
s were then cultured for 48 hours, at which time miR-1 and miR-133 expressions were measured by qRT-PCR and normalized to U6. [score:1]
Total RNAs were isolated and qRT-PCR was subsequently performed to measure the expression of miR-1 and miR-133, normalized to U6 (middle and right). [score:1]
Real-time PCR was performed to measure the expression levels of miR-1 and miR-133 normalized to U6 (middle). [score:1]
By qRT-PCR assay, both miR-1 and miR-133 levels increased over two folds upon YY1 depletion (Fig. 2E), suggesting that there is a negative regulation of miR-1 and miR-133 by YY1. [score:1]
RNAs and proteins were then extracted from injected muscles at the indicated days post-injection, and qRT-PCR was performed to measure the expression of miR-1 and miR-133, normalized to U6. [score:1]
Muscles miRs constitute two distinct families, the miR-1 family (miR-1-1, miR-1-2, and miR-206) and the miR-133 family (miR-133a-1, miR-133a-2, and miR-133b). [score:1]
We noticed that the level of miR-1 rose faster during both C2C12 myoblast differentiation and CTX induced muscle regeneration, leading us to speculate that the predominant increase in miR-1 overweighs that in miR-133, favoring the progression of myogenic differentiation. [score:1]
[1 to 20 of 42 sentences]
4
[+] score: 126
The result showed that miR-2 and miR-133 downregulated the luciferase activity by targeting the 3′-UTR of the cyclin B (Figure  5), indicating that miR-2 and miR-133 are involved in inhibiting the expression of the crab cyclin B gene. [score:10]
Thus we postulated that the high expression of miR-2 and miR-133 at MI arrest might be related to translation inhibition of the cyclin B. To test this hypothesis, the direct interactions between the miRNAs and their target sites of the crab cyclin B gene were examined using a luciferase 3′-UTR reporter assay. [score:9]
Further expression analysis using double-luciferase reporter genes assay showed that miR-2 and miR-133 can downregulate the 3′-UTRs of the crab cyclin B gene, indicating that they could inhibit the translation of the cyclin B. confirmed that cyclin B protein is completely disappeared in fertilized egg at the metaphase-anaphase transition of meiosis I, suggesting that miR-2 and miR-133 could function in destruction of cyclin B near the end of MI. [score:9]
These results indicated that miR-2 and miR-133 can downregulate the target gene expression by miRNA binding sites in the 3′-UTR of cyclin B. Figure 5 s of the miRNAs silence effects using pGL3/cyclin B 3′-UTR (A) and pGL3/cyclin B 3′-UTR mutant (B) reporter vectors. [score:8]
Furthermore, expression analysis revealed that miR-2 and miR-133 exhibited higher expression at MI arrest of meiosis and both of miR-2 and miR-133 can bind the 3′-UTR of the crab cyclin B, indicating that miR-2 and miR-133 is involved in the regulation of cyclin B expression during meiotic maturation of oocyte in the mitten crab. [score:8]
Although miR-2 and miR-133 displayed a higher expression at MI meiosis, no significant difference of the expression level was found for all the selected miRNAs including miR-2 and miR-133 in 24 hours post GnRH injection, indicating GnRH cannot induce expression of the miRNAs. [score:7]
This result strongly suggest that miR-2 and miR-133 are involved in regulating the expression of the cycin B at the transition from MI to anaphase of meiosis I, and that miRNAs might have not been globally suppressed during meiosis of the crab oocyte. [score:6]
After normalized against U6 snRNA, the relative expression level of miR-2 and miR-133 significantly increased at MI (Figure  4) whereas the other eight miRNAs exhibited stable expression from GV to MI among all the groups (data no shown). [score:5]
Surprisingly, no significant difference of the expression level was found for the both miRNAs tested in 24 hours (data no shown), indicating GnRH cannot induce expression of miR-2 and miR-133. [score:5]
miR-2 and miR-133, which were predicted to target the crab cyclin B gene, displayed high expression in MI arrest stage relative to GV stage. [score:5]
To further test whether the differential expression of miR-2 and miR-133 at MI results from the induction of GnRH, we examined the detail expression profile of miR-2 and miR-133 in a period of 24-hour after injection of GnRH. [score:5]
The result was confirmed by western blot analysis and, in which the crab cyclin B protein disappeared and cyclinB-cdc2 kinase activity sharply dropped to the basal level in fertilized eggs at the transition from MI to anaphase I of meiosis, supporting the notion that cyclin B could be a direct target for miR-2 and miR-133 and the degradation of cyclin B is required for the fertilized egg to exit from MI to anaphase I of meiosis. [score:4]
miR-2 and miR-133 exhibit differential expression during the meiotic maturation of the oocytes and have activity in regulating the 3′-UTR of the crab cyclin B gene. [score:4]
There must be other unknown mechanism for regulation of differential expression of miR-2 and miR-133 during oocyte maturation. [score:4]
The present study showed that two miRNAs (miR-2 and miR-133) exhibited significantly increased expression from GV to MI stage (Figure  4). [score:3]
GnRH can induce GVBD but has not effect on miR-2 and miR-133 expression. [score:3]
To determine whether there are direct interactions between miR-2, miR-133, miR-7, miR-79 and their target sites of the crab cyclin B gene, we used a luciferase 3′-UTR reporter assay to measure the inhibitory effects of these miRNAs. [score:3]
Luciferase reporter genes assay demonstrated that miR-2 and miR-133 have activity and can downregulate the 3′-UTRs of the cyclin B gene. [score:3]
To identify miRNAs differentially expressed during the crab oocyte maturation, the relative abundance of miR-2, miR-7, miR-79, miR-133 and other six selected miRNAs in the ovaries at GV and MI stages was assessed by quantitative real-time PCR. [score:3]
As shown in Figure  2, the 5′ seed sequences of miR-2, miR-7 miR-79 and miR-133 were revealed to be complementary to their corresponding target sites such as GY-box, Brd-box, and K-box in 3′-UTR of the crab cyclin B gene. [score:3]
Figure 4 Quantitative real-time PCR analysis of miR-2 (A) and miR-133 (B) expression in the ovaries of the mitten crab. [score:3]
Therefore, we inferred that the increased expression of miR-2 and miR-133 observed at MI was independent of GnRH injection. [score:3]
Figure 2 The potential miRNA target sites of miR-2, miR-7, miR-79 and miR-133 in the 3′-UTR of the crab cyclin B as detected by RNAhybrid [19]. [score:3]
miR-2 and miR-133 were revealed to have a role in the regulation of 3′-UTR of the crab cyclin B gene. [score:2]
miR-2 and miR-133 can regulate the 3′-UTR of the crab cyclin B gene. [score:2]
To verify whether the protein level of cyclin B drops during meiosis of oocytes, GV-, GVBD-oocytes and fertilized eggs were submitted to western blot analysis using an antibody against the crab cyclin B. The results showed that the crab cyclin B protein was present in GV- and GVBD-oocytes but disappeared in fertilized eggs at the time of transition from MI to anaphase of meiosis (Figure  6A), suggesting the potential role for the miR-2 and miR-133 in regulating the destruction of the cyclin B protein. [score:2]
The 5′ seed sequences of four miRNAs, miR-2, miR-7, miR-79 and miR-133, were revealed to complementary to miRNA binding sites in 3′-UTR of the cyclin B. Quantitative real time PCR analysis showed that miR-2 and miR-133 are much more abundant in the first metaphase (MI) of meiosis than in germinal vesicle (GV) stage. [score:1]
The miR-133 was identified with the smallest free energy value (Figure  2). [score:1]
Interestingly, many putative binding sites for miRNAs including miR-2 and miR-133 were found in 3′-UTR of the crab cyclin B transcript (Figure  3). [score:1]
After cotransfected HEK 293 T cells, miR-2 and miR-133 mimics significantly reduce the luciferase activity from the reporter construct containing the cyclin B 3′-UTR, whereas miR-7, miR-79 and negative control mimics have no effect on the luciferase activity (Figure  5A). [score:1]
[1 to 20 of 30 sentences]
5
[+] score: 77
In contrast, as miR-1 and miR-133 are upregulated, expression of their targets may possibly be suppressed in P347S mice. [score:10]
Interestingly, expression of miR-1 and miR-133 were found to be decreased in cardiac hypertrophy, whereas their over -expression inhibited hallmarks of induced cardiac hypertrophy in vitro and in vivo [22]. [score:7]
Additionally, target transcripts for miR-1 and miR-133 comprise mRNA processing factors (for example, Syf11 [SYF2 homolog RNA splicing factor], Prpf8, and Hnrpl [heterogeneous nuclear ribonucleoprotein L]), an apoptosis inhibitor (Faim [Fas apoptotic inhibitory molecule]), and proteins that are involved in intracellular trafficking and motility (for example, Ktn1 [Kinectin 1]), Actr10 [ARP10 actin related protein 10 homolog], and Myh9 [non-muscle myosin heavy chain polypeptide 9]; see). [score:7]
Using a bioinformatics approach, potential target genes for miR-96, miR-183, miR-1, and miR-133 were predicted and screened against genes expressed in the mouse retina [41, 42] and 488 genes linked with eye diseases [40]. [score:7]
Expression of miR-1 and miR-133 decreased by more than 2.5-fold (P < 0.001), whereas expression of miR-96 and miR-183 increased by more than 3-fold (P < 0.001) in Pro347Ser retinas, as validated by qPCR. [score:5]
Similarly, the observed increased expression of miR-1 and miR-133 in the P347S retina may possibly suggest that a compensatory mechanism has been activated in the mutant retina in an attempt to prevent photoreceptor cell death. [score:3]
Expressions of miR-1, miR-9*, miR-26b, miR-96, miR-129-3p, miR-133, miR-138, miR-181a, miR-182, miR-335 and let7-d were explored by in situ hybridization (ISH) using locked nucleic acid (LNA) probes (Exiqon). [score:3]
In light of this, it is unlikely that the significant changes observed in the expression of miR-96, miR-183, miR-1 and miR-133 are due to the altered cellular composition of the P347S retina. [score:3]
Potential retina specific targets of miR-1, miR-96, miR-133, and miR-183 were generated through computational means. [score:3]
A subset of highly ranked potential targets for miR-96, miR-183, miR-1 and miR-133 are implicated in the visual cycle (for example Abca4, Pitpnm1 [membrane associated phosphatidylinositol 1], and Pde6a), in cytoskeletal polarization (for example, Crb1 and Clasp2 [CLIP associating protein 2]), and in transmembrane and intracellular signaling (for example, Clcn3 [chloride channel 3], Grina [N-methyl-D-aspartate -associated glutamate receptor protein 1], Gnb1 [guanine nucleotide binding protein beta 1 polypeptide] and Gnb2 [guanine nucleotide binding protein beta 2 polypeptide]). [score:3]
Note that for a number of miRs (for example, miR-1, miR-133, and miR-96), both Ambion and Exiqon microarrays detected similar alterations in expression between the P347S mutant and wild-type retinas. [score:3]
Among others, expression of miR-96, miR-183, miR-1, and miR-133 exhibited significant alterations in P347S mice by microarray analysis, and these changes were validated by qPCR. [score:3]
Potential target transcripts for miR-96, miR-183, miR-1 and miR-133 predicted by miRanda [39] were retrieved from the Sanger miR Database [37]. [score:3]
lists potential retinal target transcripts with the highest rankings for miR-96, miR-183, miR-1, and miR-133. [score:3]
Many genes encoding factors that are involved in mRNA processing and splicing, and RNA -binding proteins belong to the predicted targets for miR-1 and miR-133. [score:3]
Expressions of mouse microRNA (miR)-96, miR-183, miR-133 and miR-1 were analyzed using Ambion miR microarrays (green, 'A-' in legend), Exiqon miR microarrays (blue, 'E-' in legend), and quantitative real-time reverse transcription polymerase chain reaction (qPCR; magenta). [score:3]
More specifically, significant differences in expression of miR-1, miR-96, miR-133, and miR-183 in retina were observed between RHO mutant and wild-type mice. [score:3]
In contrast, miR-1 and miR-133 levels increased by more than 3-fold in retinas of P347S mice. [score:1]
MiR-1, miR-96, miR-133, and miR-183 are highlighted in red; h and m in labels refer to human and mouse miRs. [score:1]
The above conditions were met by miR-1, miR-96, miR-133, and miR-183 (highlighted in red in Figure 4b,c); these miRs were therefore selected for qPCR quantification. [score:1]
Figure 6 displays corresponding data from the two different microarrays and qPCR analyses for miR-96, miR-183, miR-1, and miR-133. [score:1]
In summary, expression of miR-96 and miR-183 decreased by more than 2.5-fold (P < 0.001) in mutant retinas, whereas miR-1 and miR-133 increased by more than 3-fold (P < 0.001), as measured using qPCR. [score:1]
[1 to 20 of 22 sentences]
6
[+] score: 55
However, after differentiation, TetR-KRAB inhibition of GFP expression was severely impaired, indicating that the miR-133 expression silenced TetR-KRAB production. [score:7]
In contrast, in cells infected with the lentiviral vector carrying miR-133 target sequences we observed a significant reduction of GFP expression in undifferentiated cells after doxycyline removal, indicating that the TetR-KRAB regulation functioned according to the intended design. [score:6]
However, in mice injected with AAV carrying miR-133 target sequences, there was no variation of GFP expression in the absence or presence of doxycycline (Fig. 6d). [score:5]
We designed two DNA cassettes containing the TetR-KRAB coding sequence with four copies of miR-133 or without miRNA target sequences located in the downstream untranslated region. [score:5]
A slight decrease in GFP expression persists in the differentiated cells, which is likely to be a result of a small number of undifferentiated cells expressing little or no miR-133. [score:5]
The intended regulation by doxycyline persisted in muscles injected with AAV that did not contain the miRNA target sequences although no significant effect of doxycycline was recorded in mice injected with the miR-133-regulated vector (Fig. 6c, d). [score:5]
Muscle-specific miR-133, liver specific miR-122, or hematopoietic specific miR-142 target sequences were shown to work synergistically with the TetR-KRAB cassette and enable tissue-specific expression. [score:5]
Differentiated or undifferentiated C2C12 cells were transduced at a MOI of 10 with miR-133-CMV-GFP regulated or miR-122-CMV-GFP regulated lentiviral vectors. [score:3]
The first included a constitutively active promoter (PGK, phosphoglycerate kinase or CMV, cytomegalovirus) driving a TetR-KRAB sequence, which was linked to four tandem repeats of a target sequence designed to be perfectly complementary to miR-122 (TGG AGTGTGACAATGGTGTTTGTGT), miR-142.3p (TCCATAAAGTAGGAAACACTACA) and miR-133 (ACAGCTGGTTGAAGGGGACCAA). [score:3]
To this end we designed lentiviral vectors containing four copies of perfectly complementary miR-133 targets downstream of the Tet-KRAB-encoding sequence. [score:3]
We confirmed that expression of miR-133 increased when C2C12 cells underwent myoblast differentiation (Fig. 5b). [score:3]
AAV carrying miR-133 target sequences were injected in the penile vein of mice (n = 8). [score:3]
We have verified that miR-133-CMV-GFP regulated AAV vectors was efficient in liver in which the endogenous miR is absent. [score:2]
[1 to 20 of 13 sentences]
7
[+] score: 46
In silico miRNA Target Selection PipelineTarget sites for mmu-miR-1a-3p (miR-1), miR-133a-1 (miR-133), miR-142a-3p (miR-142), miR-183-5p (miR-183), miR-96-5p (miR-96) and miR-182-5p (miR-182) were predicted employing Diana-microT (v. 3.0) 61, miRanda (Aug 2010 release) 62 and TargetScan tools (v. 6.2) 4, and filtered for sites predicted by at least two prediction tools. [score:7]
The data above suggest that miR-1 suppresses Ctbp2 in R347 retinas and that miR-1 (and possibly miR-133) may regulate synaptic remo deling at photoreceptor synapses by targeting Ctbp2. [score:6]
In Silico Target SelectionAltered expression of miR-1, miR-133, miR-142 and miR-183/96/182 in the R347 mouse mo del has been observed 12. [score:5]
As the Ctbp2 3′UTR also has a predicted target site for miR-133, miR-1/133 may co-target Ctbp2 (Fig. 3g); however this was not tested in our study. [score:5]
Target sites for mmu-miR-1a-3p (miR-1), miR-133a-1 (miR-133), miR-142a-3p (miR-142), miR-183-5p (miR-183), miR-96-5p (miR-96) and miR-182-5p (miR-182) were predicted employing Diana-microT (v. 3.0) 61, miRanda (Aug 2010 release) 62 and TargetScan tools (v. 6.2) 4, and filtered for sites predicted by at least two prediction tools. [score:5]
The miR-1/133 cluster and Ctbp2 are co-expressed in photoreceptors; expression of both miR-1 and miR-133 is increased by ~20-fold in R347 versus wt photoreceptors (Table 2) 12. [score:5]
Specifically, 23, 10, 6, 18, 35 potential target genes were identified for miR-1, miR-133, miR-142, miR-183, miR-96 and miR-182, respectively (Supplementary Table S3). [score:3]
Of the six miRNAs of interest, the Ctbp2 3′UTR contains predicted target sites for miR-1 and miR-133 (Fig. 3g), the levels of which were significantly increased in R347 versus wt retinas (Table 2) 12. [score:3]
Altered expression of miR-1, miR-133, miR-142 and miR-183/96/182 in the R347 mouse mo del has been observed 12. [score:3]
Ctbp2 protein in R347 versus wt retinas was decreased by ~50% (Table 2, LC-MS/MS) suggesting that miR-1 and miR-133 may target Ctbp2; the potential miR-1-Ctbp2 mRNA interaction was further tested in the study. [score:3]
miR-1 and miR-133 form a miRNA cluster and can influence neuronal function 42. [score:1]
[1 to 20 of 11 sentences]
8
[+] score: 38
miR-133 also inhibits the translation of polypyrimidine tract -binding protein (nPTB), which controls differential transcript splicing during skeletal-muscle differentiation [20]. [score:5]
We have previously reported that the expression of muscle-specific miR-1 and miR-133 is induced during skeletal muscle differentiation and miR-1 and miR-133 play central regulatory roles in myoblast proliferation and differentiation in vitro. [score:4]
Furthermore, miR-1 and miR-133 are also important regulators of cardiomyocyte differentiation and heart development [22- 24]. [score:3]
We found that the expression levels of miR-1, miR-133 and miR-206 were higher in the skeletal muscle of one month-old mdx mice (Figure 1A). [score:3]
A subset of miRNAs, miR-1, miR-133, miR-206 and miR-208, are either specifically or highly expressed in cardiac and skeletal muscle and are called myomiRs [6, 7, 13]. [score:3]
Among them, miR-133 was shown to promote the proliferation of myoblasts and inhibits their differentiation in cultured skeletal muscle myoblasts. [score:3]
Additionally, embryonic stem (ES) cell differentiation towards cardiomyocytes is promoted by miR-1 and inhibited by miR-133 [22]. [score:3]
Recently, miR-133 genes (miR-133a-1 and miR-133a-2) were knocked out from the mouse genome. [score:2]
Paradoxically, miR-1 and miR-133 exert opposing effects to skeletal-muscle development despite originating from the same miRNA polycistronic transcript. [score:2]
Normal skeletal muscle development in miR-133 transgenic mice. [score:2]
miR-133 enhances myocyte proliferation, at least in part, by reducing protein levels of SRF, a crucial regulator for muscle differentiation [18, 19]. [score:2]
In order to further investigate the function of miR-133 in vivo, we took a gain-of-function approach and generated transgenic mice to overexpress miR-133a-1 in skeletal muscle. [score:1]
Our results are consistent with a recent report in which miR-133 loss-of-function mice did not induce overt defects in skeletal muscle [24]. [score:1]
Among them, miR-1, miR-133, miR-206, miR-208 and miR-499 have been described as muscle specific miRNAs, or myomiRs [6, 13]. [score:1]
In this study, we attempted to determine the function of miR-133 in skeletal muscle. [score:1]
Interestingly, miR-1 and miR-133 also produce opposing effects on apoptosis [21]. [score:1]
Hematoxylin and eosin (H&E) staining for skeletal muscle tissue sections of diaphragm from 6 month old wild type (Wt) and miR-133a transgenic mice (MCK-miR-133). [score:1]
[1 to 20 of 17 sentences]
9
[+] score: 36
Again data from quantitative RT-PCR and bioluminescence analysis indicated a similar miRNA expression pattern, i. e. expression of miRNA-133 and almost undetectable expression of miRNA-122 and -221 in differentiated C2C12 cells (Supplementary Figure S2). [score:7]
As miRNA-122 is exclusively expressed in the liver (32) and miRNA-133 is a muscle-tissue–specific miRNA (34), we enquired whether RILES would have the potential to discriminate the expression of these two miRNAs in the liver of the mice. [score:5]
As miRNA-133 is constitutively expressed in the adult stage of skeletal muscles (34), we conducted a bioluminescence kinetic analysis of miRNA-133 expression in the tibialis anterior muscle of the mice. [score:5]
We thus attempted to monitor the expression pattern of miRNA-1, miRNA-133 and miRNA-206 in the skeletal muscles of the anterior tibialis of the mice. [score:3]
No statistical difference (P > 0.05) was found between the pRILES/133T and pRILES groups, indicating, as expected, that miRNA-133 was not expressed in the liver. [score:3]
Quantitative RT-PCR demonstrated that miRNA-122 is expressed in the liver in contrast to miRNA-133, which was almost undetectable in the liver samples. [score:3]
These data indicate that the expression of miRNA-133 in the liver is not sufficient to repress a sufficient amount of CymR transcript to switch-ON the RILES in the liver of the mice. [score:3]
MiRNA-122 and miRNA-221 were oppositely expressed in HUH7 and HLE cells, while miRNA-133 was not significantly detected. [score:3]
Similar specificity of data was also found in C2C12 myoblast cells differentiated in myotubes in vitro to induce expression of the muscle-specific miRNA-133 (34). [score:3]
In contrast luciferase induction was detected only in cells transfected with pRILES/122T, pRILES/133T and pRILES/221T in presence of the corresponding miRNA-122, miRNA-133 and miRNA-221 (Figure 2C–E). [score:1]
[1 to 20 of 10 sentences]
10
[+] score: 33
Previous reports have demonstrated that β-adrenergic stimulation suppresses microRNA-133 (miR-133) expression in a myocyte enhancer factor 2 (Mef2c) -dependent manner, which results in direct de-repression of PRDM16 expression in brown adipose tissue (BAT) [42– 45]. [score:8]
β-adrenergic stimulation after cold exposure is reported to suppress myocyte enhancer factor 2 (Mef2) expression, which results in remarkable downregulation of microRNA-133 (miR-133) in BAT [42, 44]. [score:8]
The downregulation of mir-133 directly de-repression of PRDM16 expression [43, 45]. [score:7]
EPO upregulates PRDM16 via β-adrenergic receptor/Mef2c/ miR-133 cascade of interscapular brown adipose tissue (iBAT) in high-fat diet induced obese mice. [score:4]
These data suggest that EPO upregulates PRDM16 through EpoR/STAT3 and β-adrenergic receptor/Mef2/miR-133 signaling pathway, which results in the enlargement of iBAT mass. [score:4]
Effect of erythropoietin (EPO) on the β-adrenergic receptor/Mef2/miR-133 pathway in interscapular BAT. [score:1]
In summary, we found that: 1) EPO facilitates energy expenditure by increasing classical BAT mass; 2) EPO stimulates EpoR/STAT3 and β-adrenergic receptor/Mef2c/miR-133 pathways, resulting in enhancement of PRDM16 of classical BAT; 3) EPO promoted secretion of classical BAT’s derived-FGF21; and 4) EPO ameliorated obesity and glucose homeostasis in high-fat diet -induced obese mice. [score:1]
[1 to 20 of 7 sentences]
11
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
12
[+] score: 28
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
A few notable exceptions are miR-499, an miRNA abundantly expressed in the heart (Figure 2A), which is represented by only one read (Table 2), and the miR-133 family, which is preferentially and abundantly expressed in the heart (Figure 2), and represented by only 7 reads (Table 1). [score:5]
The expression patterns of miR-1 and miR-133 largely overlapped in many tissues examined in this study (Figure 2). [score:3]
These two miRNA genes – miR-1 and miR-133 – exist as a cluster and thus are always expressed together in mouse [42]. [score:3]
Several miRNAs (miR-1, miR-133, miR-499, miR-208, miR-122, miR-194, miR-18, miR-142-3p, miR-101 and miR-143) have distinct tissue-specific expression patterns. [score:3]
Like miR-1, miR-133 is a muscle-specific miRNA (Figure 2) because of its abundant expression in many other muscular tissues such as heart and skeletal muscle [45, 46]. [score:3]
Similarly, we found all members of the miR-15, miR-16, miR-18 and miR-133 families in our sequences, suggesting that all members belonging to these miRNA families are expressed in these three (heart, liver and thymus) tissues. [score:3]
Additionally, miR-1 and miR-133 in the heart, miR-181a and miR-142-3p in the thymus, miR-194 in the liver, and miR-143 in the stomach showed the highest levels of expression. [score:3]
For instance, miR-133 is represented only by 4 clones (two reads each for 133a and 133b) in our sequences, which indicates a 100-fold lower expression level compared with that of miR-1 family, if cloning frequency taken as a measure of expression. [score:2]
The discrepancies between the cloning frequency and small RNA blot results for miRNA-1 and miR-133 could not be attributed to the RNA source because the same RNA samples were used for both experiments (cloning and small RNA blot analysis). [score:1]
We also used approximately a similar amount (activity) of [32]P -labelled probe for detection of miR-1 and miR-133. [score:1]
However, our small RNA blot analysis indicated a different picture as miR-133 was detected as abundantly as miR-1 in the heart (Figure 2). [score:1]
[1 to 20 of 11 sentences]
13
[+] score: 27
A dual-detargeted virus named vMC [24]-NC, with miR-124 targets in the 5′ NCR and miR-133 plus miR-208 targets in the 3′ NCR, showed the suppression of replication in both nervous and cardiac tissues but retained full oncolytic potency when administered by intratumoral (10 [6] 50% tissue culture infectious doses [TCID [50]]) or intravenous (10 [7] to 10 [8] TCID [50]) injection into BALB/c mice bearing MPC-11 plasmacytomas. [score:9]
In vivo toxicity testing confirmed that miR-124 targets within the 5′ NCR suppressed virus replication in the central nervous system while miR-133 and miR-208 targets in the 3′ NCR suppressed viral replication in cardiac tissue. [score:9]
This inhibition of viral replication by the 3′ NCR insertions may be due to the presence of miR-142, miR-133, or miR-208 in certain cells or nonspecific effects of the insertions themselves. [score:3]
To enhance its safety profile, microRNA target sequences complementary to miR-124 or miR-125 (enriched in nervous tissue), miR-133 and miR-208 (enriched in cardiac tissue), or miR-142 (control; enriched in hematopoietic tissues) were inserted into the vMC [24] NCRs. [score:3]
Unexpectedly, mice injected with vMC [24]-H2 or vMC [24]-C also had reduced mean viral loads in all three tissues, suggesting that either the placement of the insert can control viral replication in vivo or that there are low to intermediate levels of miR-142, miR-133, or miR-208 present regulating viral tropism. [score:2]
Sequences complementary to miR-142, miR-124, miR-125, miR-133, and miR-208 were successfully incorporated (individually or in combination) into the 5′ and 3′ NCRs of the vMC [24] genome. [score:1]
[1 to 20 of 6 sentences]
14
[+] score: 25
Targeted deletions of miR-1 or miR-133 in mice generally result in impaired cardiac development and function (6 – 11). [score:4]
Although miR-1 and miR-133 cooperate to repress smooth muscle gene expression in the heart (6, 7, 10, 11), miR-1 promotes differentiation of striated muscle progenitors, whereas miR-133 maintains the undifferentiated state in vitro (5, 12, 13). [score:3]
To our knowledge, a selective mature miRNA-protein interaction that limits miRNA activity, independent of miRNA biogenesis, has not been reported and suggests that the differential activity of mature miRNAs, including bicistronically encoded miRNAs, such as miR-1 and miR-133, can be regulated by selective interaction with RNA -binding proteins. [score:2]
Because the miR-1 family promotes differentiation and the miR-133 family keeps muscle in a less mature, more proliferative state (5, 12, 13), the TDP-43- miR-1 family interaction may be important to control the balance of these co-transcribed miRNA families to promote development and maintain adult muscle homeostasis. [score:2]
Given the extended half-life of miRNAs and the observations from deep-sequencing studies that the miR-1 family accounts for up to half of accumulated miRNAs in cardiac and skeletal muscles (20, 21), directly controlling the activity of these critical myogenic regulators and their differential activity as compared with miR-133 may be important to maintain muscle homeostasis. [score:2]
The miR-1 and miR-133 family loci are under transcriptional control of key myogenic proteins including myogenin, MyoD, serum response factor (SRF), myocardin (MYOCD) (3, 4, 16), and myocyte-enhancing factor 2 (MEF-2) (17). [score:1]
FIGURE 1. TDP-43 interacts with the miR-1/miR-206 family, but not miR-133. [score:1]
A, sequence alignment of the miR-1/miR-206 family or the miR-133 family. [score:1]
We concluded that a protein or complex of proteins in C [2]C [12] cells preferentially interacts with the mature form of the miR-1/miR-206 family, but not miR-133, in vitro. [score:1]
We found a prominent band representing an miRNA-protein complex in C [2]C [12] lysates incubated with labeled miR-1 that was effectively lost with the addition of excess unlabeled miR-1 or miR-206, but not with unlabeled miR-133 (Fig. 1 B). [score:1]
This is consistent with the observation that miR-1 and miR-206 levels greatly exceed those of miR-133 in mature muscle (20, 21). [score:1]
To identify proteins that physically interact with and might regulate activity of the miR-1/miR-206 family, but not the miR-133 family (Fig. 1 A), we performed RNA electrophoretic mobility shift assays (EMSAs) seeking proteins that uniquely bind and alter the migration of these miRNAs. [score:1]
Here, we report that TDP-43, an RNA -binding protein that aggregates in individuals afflicted with ALS, physically associates with the mature form of the miR-1/miR-206 family of miRNAs in muscle cells, but not with the co-transcribed miR-133. [score:1]
The same band was observed when fluorescently labeled miR-206 was incubated with C [2]C [12] lysates and could be competed with either miR-1 family member, but not with miR-133 (Fig. 1 B). [score:1]
The miR-1 family, composed of miR-1 and miR-206, whose mature sequences are nearly identical, and the miR-133 family (1, 2) are highly conserved and are enriched in cardiac and skeletal muscle in species as distantly related as flies and humans (3 – 5) (see Fig. 1 A). [score:1]
TDP-43 decreased activity of mature miR-1 and miR-206, but not the co-transcribed miR-133 family, by preventing the bound miRNAs from associating with the RISC. [score:1]
In mammals, up to three genomic loci encode bicistronic transcripts to produce miR-133 and either miR-1 or miR-206. [score:1]
[1 to 20 of 17 sentences]
15
[+] score: 24
Thus, the downregulation of miR-133 and miR-30 may contribute to the development of cardiac fibrosis in DBL mice, as both regulate the profibrotic signalling factor, CTGF [30], which was correspondingly upregulated. [score:9]
These include miR-1, miR-133, miR-30 and miR-150 which often show reduced expression, and miR-21, miR-199 and miR-214 which often show increased expression [6], [7], [8], [9], [11], [12], and they may represent miRNAs with a central role in cardiac remo delling. [score:5]
In vitro suppression of miR-133, using an antisense sequence to sequester miR-133, induces hypertrophy, and in-vivo inhibition of miR-133 by infusion of an adenoviral antagomir causes cardiac hypertrophy [24]. [score:5]
Together, these data further implicate downregulation of miR-1 and miR-133 in the development of HCM, and strategies to maintain their levels may represent a therapeutic opportunity. [score:5]
[1 to 20 of 4 sentences]
16
[+] score: 23
Only 26 (6%) of the total 402 TGGTCCC human miR-133a-3p isomiR targets overlapped with the predicted targets for the abundant human miR-133a-5p, and similarly, 30 (6%) of the total 502 TTGGTCC isomiR targets overlapped with those predicted for human miR-133-5p. [score:7]
Verified mRNA targets of miR-1 and miR-133 include those encoding proteins that are involved in cardiac development, ion channel function, hypertrophy, and fibrosis [11- 16]. [score:4]
In human and murine atrial tissues, miR-133 was the most highly expressed miRNA, comprising approximately 20% of all miRNA sequences. [score:3]
Altered expression of miR-133 itself has been observed in cardiac tissues from patients with AF [18, 19], and conditions that predispose to AF, such as atrial dilation, ventricular hypertrophy, and myocardial ischemia [12, 31]. [score:3]
Altered levels of miR-1 and miR-133 have been observed in atrial tissue samples from patients with AF in several studies [17- 19]. [score:1]
We re-sequenced the MIR1-1, MIR1-2, MIR133A1, MIR133A2, and MIR133B genes, that encode the cardiac-enriched miRNAs, miR-1 and miR-133, in 120 individuals with familial atrial fibrillation and identified 10 variants, including a novel 79T > C MIR133A2 substitution. [score:1]
MiR-1 and miR-133 sequence variants. [score:1]
The muscle-enriched miRNAs, miR-1 and miR-133, are amongst the most abundant of the miRNAs present in the normal heart [9, 10]. [score:1]
In this study, we hypothesized that genetic variation could alter the functional effects of miR-1 and miR-133 and contribute to AF pathogenesis. [score:1]
The 5 loci encoding miR-1 and miR-133 precursor transcripts were re-sequenced in 120 probands with a family history of AF. [score:1]
[1 to 20 of 10 sentences]
17
[+] score: 20
As regards myomiRs, several studies report that miR-1 and miR-133 are under-expressed, while miR-206 is over-expressed in mdx muscles [25– 27]. [score:5]
Zebrafish miR-1 and miR-133 shape muscle gene expression and regulate sarcomeric actin organization. [score:4]
In addition, we demonstrate an up-regulation of both miR-133 and miR-222 4 months after MuStem cell transplantation, highlighting their potential use as novel markers for the follow-up of effects associated with MuStem cell delivery in a dystrophic context. [score:4]
In muscle, specific miRNAs (known as myomiRs), such as miR-1, miR-133 and miR-206, are involved in regulation of the proliferation or differentiation of myogenic cells [13– 16] and are especially regulated by transcription factors implicated in muscle growth and development [17, 18]. [score:4]
Moreover, the pathway analysis performed to provide functional annotation based on KEGG terms (DIANA-miRPath) shows an enrichment of miR-133 in many pathways linked to ubiquitin mediated proteolysis as well as regulation of the actin cytoskeleton. [score:2]
Chen J-F, Man del EM, Thomson JM, Wu Q, Callis TE, Hammond SM, Conlon FL, Wang D-Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 6 sentences]
18
[+] score: 18
[13], [14] Amongst the hundreds of miRs, cardiac fibrosis has been associated with downregulation of miR-29, miR-30, miR-101, and miR-133 families, and with upregulation of miR-21. [score:7]
Cardiac fibrosis is associated with downregulation of miR-29, miR-30, miR-101, and miR-133, and upregulation of miR-21. [score:7]
The intensities for several of these miRs did not change over 3–7 days, including miR-29a, miR-29b, miR-30, miR-101 or miR133 families. [score:1]
There was no significant change in miR-133, miR-30, or miR-101 family members after LPS. [score:1]
[15]– [17] The cardiac fibrosis that develops with decreased miR-133 and miR-30c involves CTGF, [30] which did not change with LPS. [score:1]
Cardiac fibrosis has been associated with decreases in miR-29, [25] miR-133, miR-30, [30] miR-101 [17] and/or increased miR-21 [31], [32] in pathological conditions (e. g. ischemia-reperfusion, hypertrophy and heart failure). [score:1]
[1 to 20 of 6 sentences]
19
[+] score: 17
Other miRNAs from this paper: mmu-mir-133a-1, mmu-mir-133a-2, mmu-mir-133b
The muscle-specific miR-133 has critical functions in the heart and is a powerful inhibitor of cardiac hypertrophy [25, 26, 33] and the transcription factor SRF is an important regulator of several hypertrophy associated genes, such as Nppa, Nppb and Acta1 [34]. [score:4]
Above that, two groups have shown impaired myogenic differentiation after silencing of Malat-1 in vitro [23, 24], possibly via regulation of microRNA-133. [score:2]
Interestingly, only an effect of Malat-1 on vascularization of the retina was shown in Malat-1 KO mice [22], whereas its functions in hind limb ischemia, ERK/MAPK signaling, miR-133 scavenging, and possibly diabetic cardiomyopathy were exclusively shown by posttranscriptional knockdown of Malat-1 [22– 24, 29, 39, 40]. [score:2]
These findings argue against a relevant influence of Malat-1 on ERK/MAPK signaling or miR-133/SRF regulation in the heart. [score:2]
However, no critical role for Malat-1 was found in pressure overload -induced heart failure in mice, despite its reported role in vascularization, ERK/MAPK signaling, and regulation of miR-133. [score:2]
Despite its reported function as regulator of vascularization, activator of ERK/MAPK signaling, and scavenger for the muscle-specific miR-133, we conclude that Malat-1 has no important role for cardiac hypertrophy and failure in vivo. [score:2]
Malat-1 modulates hypoxia -induced vessel growth, activates ERK/MAPK signaling, and scavenges the anti-hypertrophic microRNA-133. [score:1]
Scavenging of miR-133 by Malat-1 may therefore increase levels of SRF, an important mediator of cardiac hypertrophy [27]. [score:1]
Additionally, Malat-1 has been proposed to act as a competing endogenous RNA for microRNA-133, thereby attenuating miR-133 mediated repression of serum response factor (SRF) [24]. [score:1]
[1 to 20 of 9 sentences]
20
[+] score: 17
Given the requisite role of miR-1 and miR-133 in cell survival and development, it is convincing to believe that the redundant transcription complexes directing miR-1 and miR-133a expression are elegantly developed to ensure cells to survive under evolutionary pressure. [score:5]
MiR-1 and miR-133 are muscle-enriched microRNAs, and they have been demonstrated as critical factors involved in both cardiac and skeletal muscle development and diseases [20- 25]. [score:4]
Given the importance of miR-1 and miR-133 in various cardiomyopathy developments, such as cardiac hypertrophy, understanding the precise control of SRF -mediated microRNA gene regulation in the heart will provide an additional perspective for the treatment of SRF dysfunction -mediated cardiomyopathy. [score:3]
Given that individual microRNAs regulate potentially dozens of genes, functions of miR-1 and miR-133 in cardiac muscle and skeletal muscle can be quite distinct [23, 26, 27]. [score:2]
Both miR-1 and miR-133 also participate in cardiomyopathy development including cardiac hypertrophy [25, 28], cardiac fibrosis [29, 30], and arrhythmia [30, 31]. [score:2]
For skeletal muscle, miR-1 facilitates myogenesis, and miR-133 promotes myoblast proliferation [20]. [score:1]
[1 to 20 of 6 sentences]
21
[+] score: 16
We also found that expression levels of ssc-miR-103 and ssc-miR-107 were slightly lower in Dpm than in other types of teeth, ssc-miR-133 a and ssc-miR-133b expression levels were much higher in Dpm than in other types of teeth, and ssc-miR-127 expression increased in Di, Dc, Dpm, and Dm, in that order. [score:7]
Of the five differentially expressed miRNAs that we identified, miR-133 (miR-133a and miR-133b), which is specifically expressed in muscles, is classified as a myomiRNA and is necessary for proper skeletal and cardiac muscle development and function [18]. [score:6]
We also suggested in a previous study that ssc-miR-133 may play key roles in miniature pigs’s tooth development [7]. [score:2]
MiR-133 is one of tissue-specific miRNAs in tooth germ [4], and in Michon’s miRTooth1.0 Database (http://bite-it. [score:1]
[1 to 20 of 4 sentences]
22
[+] score: 16
In hypertrophic adult rat VCMs, down-regulation of miR-1/miR-133 levels promotes automaticity via up-regulation of HCN2/HCN4, but this defect can be reversed by forced expression of miR-1/miR-133 [10], [11]. [score:9]
This observation was consistent with the upregulation of NKX2.5 seen in EBs differentiated from LV-miR-1-transduced, but not LV-miR-133-transduced or WT, H7 hESCs that Srivastava and colleagues reported [8]. [score:4]
Indeed, miR-133 has been implicated in early cardiac differentiation of murine and human ESCs by repressing the non-mesoderm lineages, rather than by directly promoting cardiogenesis per se [8]. [score:2]
Consistently, miR-133 exerts no effects on Ca [2+]-handling and contractile proteins when cardiovascular progenitors of later stages were transduced. [score:1]
[1 to 20 of 4 sentences]
23
[+] score: 16
In integrated analysis of the inverse relationship of expressed miRNAs and mRNAs, mmu-miR-204 expression was reduced in Sca-1 [+]CD31 [−] compared to Sca-1 [+]CD31 [+] cells, using target musculus collagen, type VIII, alpha 1, and musculus enhancer trap locus 4. Reduced levels of miR-1 and miR-133 are observed in mouse ESCs following artificial induction of myocardial differentiation [26]. [score:6]
Analysis of the expression of cardiomyocyte-specific miRNAs miR-1, miR-133a/b, and miR-208a/b and mRNAs MYH6 and TNNT2 showed upregulation of miR-1, miR-133 a/b, miR-208a/b, and MYH6 and TNNT2 in differentiated cardiomyocyte cells compared to freshly isolated Sca-1 [+]CD31 [−] cells (Figure 6). [score:5]
In our study, mmu-miR-1 was not differently expressed and mmu-miR-133 and mmu-miR-208a expression was reduced in Sca-1 [+]CD31 [−] compared to Sca-1 [+]CD31 [+] cells. [score:4]
Among miRNAs expressed in the heart, miR-1, miR-133, miR-208, and miR-499 are the most commonly investigated subtypes. [score:1]
[1 to 20 of 4 sentences]
24
[+] score: 15
miR-1 and miR-206 promoted differentiation of myoblasts through downregulation of HDAC4 and the p180 subunit of DNA polymerase alpha, while miR-133 promoted proliferation through downregulation of serum response factor (SRF) in C2C12 cells (11– 13). [score:7]
Downregulation of miR-1, miR-206, and miR-133 levels has been reported in white adipocytes (41) and in gastrocnemius muscle (42) of DIO mice and in vastus lateralis (43) and plasma (44, 45) of type 2 diabetic patients. [score:4]
Ectopically overexpression of miR-133 in C2C12 cells reduces IGF-1-stimulated phosphorylation of Akt at Serine-473, the Akt activation site (15), which mediates IGF-1 anabolic and anti-catabolic effects due via mTOR by inactivation of Foxo3. [score:3]
We evaluated the evolution of the expression of miR-1a, miR-133, and miR-206 in mice fed a HFD for 4, 8, or 12 weeks. [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 15
Other miRNAs from this paper: mmu-mir-133a-1, mmu-mir-133a-2, mmu-mir-133b
In addition, Zhang et al., showed that TSA enhances cell resistance to hypoxic insult by upregulating miR-133 expression through activation of MAPK-ERK1/2 [24]. [score:6]
For instance, Zhang et al., demonstrated that TSA enhances cell resistance to hypoxic insult by upregulating miR-133 expression through activation of the mitogen-activated protein kinase (MAPK)/extracellular signal-related kinase (ERK) pathway in neonatal cardiomyocytes [24]. [score:6]
Zhang L. Wu Y. Li Y. Xu C. Li X. Zhu D. Zhang Y. Xing S. Wang H. Zhang Z. Tanshinone IIA improves miR-133 expression through MAPK ERK1/2 pathway in hypoxic cardiac myocytes Cell. [score:3]
[1 to 20 of 3 sentences]
26
[+] score: 14
BMP treatment regulates multiple miRNA expression during osteoblastogenesis, and a number of those miRNAs feedback to regulate BMP signaling: [176–179] miR-133 targets Runx2 and Smad5 to inhibit BMP -induced osteogenesis; [176] miR-30 family members negatively regulate BMP-2 -induced osteoblast differentiation by targeting Smad1 and Runx2; 177, 178 miR-322 targets Tob and enhances BMP response. [score:14]
[1 to 20 of 1 sentences]
27
[+] score: 14
The up-regulation of Pmp22 and Mpz proteins in the spinal cord of MLC/SOD1 [G93A] paralleled that of mRNA expression and supports the evidence that these factors are molecular targets of microRNAs, such as miR-1, miR-9, miR-133, and miR-330, that resulted differently modulated in the spinal cord of MLC/SOD1 [G93A] mice compared to wild type littermates. [score:7]
In particular, we found down regulation of mir-1, mir-330, mir-29, mir-133, and mir-9 family members, whose dysregulation can have profound effects on neuronal physiology and pathology, including Huntington, Alzheimer, and Parkinson diseases (Saito and Saito, 2012). [score:5]
Of note, the miRnome profiling revealed the down regulation of mir-330, mir-133, and mir-1, which are involved in denervation and reinnervation processes (Jeng et al., 2009; Tsutsumi et al., 2014). [score:2]
[1 to 20 of 3 sentences]
28
[+] score: 14
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
Bladder cancer-specific expression of TRAIL genes was achieved by employing MREs of miR-1, miR-133 and miR-218. [score:3]
The involved MREs sequences in our study were described in detail in Table  1. Table 1 MiRNA response elements (MREs) for bladder cancer-specific downregulated miRNAs miRNA primer sequences miR-1Forward: 5′-TCGAGACAAACACC ACATTCCAACAAACACC ACATTCCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGGAATGTGGTGTTTGT TGGAATGTGGTGTTTGTC-3′ miR-99aForward: 5′-TCGAGACAAACACC TACGGGTACAAACACC TACGGGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACCCGTAGGTGTTTGT ACCCGTAGGTGTTTGTC-3′ miR-101Forward: 5′-TCGAGACAAACACC GTACTGTACAAACACC GTACTGTACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT ACAGTACGGTGTTTGT ACAGTACGGTGTTTGTC-3′ miR-133Forward: 5′-TCGAGACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTTGGTCCGGTGTTTGT TTTGGTCCGGTGTTTGTC-3′ miR-218Forward: 5′-TCGAGACAAACACC AAGCACAAACAAACACC AAGCACAAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TTGTGCTTGGTGTTTGT TTGTGCTTGGTGTTTGTC-3′ miR-490-5pForward: 5′-TCGAGACAAACACC ATCCATGACAAACACC ATCCATGACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT CATGGATGGTGTTTGT CATGGATGGTGTTTGTC-3′ miR-493Forward: 5′-TCGAGACAAACACC ACCTTCAACAAACACC ACCTTCAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TGAAGGTGGTGTTTGT TGAAGGTGGTGTTTGTC-3′ miR-517aForward: 5′-TCGAGACAAACACC TGCACGAACAAACACC TGCACGAACAAACACCGC-3′Reverse: 5′-GGCCGCGGTGTTTGT TCGTGCAGGTGTTTGT TCGTGCAGGTGTTTGTC-3′The underscored sequences indicated MREs of miR-1, miR-99a, miR-101, miR-133 and miR-218, miR-490-5p, miR-493 and miR-517a. [score:3]
Application of MREs of miR-1, miR-133 and miR-218 restrained exogenous gene expression within bladder cancer cells. [score:3]
Ad-TRAIL-MRE-1-133-218 contained MREs of miR-1, miR-133 and miR-218 that were inserted immediately following TRAIL gene. [score:1]
AACAAACACC GGACCAAAACAAACACC GGACCAAAACAAACACC AAGCACAAACAAACACC AAGCACAA-3′), which contained two copies of miR-1 MREs, two copies of miR-133 MREs and two copies of miR-218 MREs. [score:1]
[1 to 20 of 6 sentences]
29
[+] score: 14
Our group has observed dysregulated miRNA expression in heart samples from CCC patients [21] and acute T. cruzi infection in mice [33] including miR-133 and miR-208, which regulate heart genes related to cardiovascular disease 34– 39. [score:7]
Yu H Lu Y Li Z Wang Q microRNA-133: expression, function and therapeutic potential in muscle diseases and cancerCurr Drug Targets. [score:7]
[1 to 20 of 2 sentences]
30
[+] score: 13
Four myocardial-enriched miRNAs, miR-1, miR-133, miR-499 and miR-208, were confirmed to be highly expressed in ovine heart tissue. [score:3]
For the first time we report that not only are the four cardiac-enriched miR-1, miR-133, miR-499 and miR-208 highly expressed in sheep LV, but also provide information on their isomiRs. [score:3]
In this study, NGS detected high counts of oar-miR-133, while array yielded high expression of hsa-/mmu-/rno-miR-133a-3p, which is one nt longer at the 5′ end compared to oar-miR-133. [score:2]
Oar-miR-133 is currently the only cardiac specific miRNA listed in miRBase 21. [score:1]
Oar-miR-133 was the main form in sheep heart, while hsa-/mmu-/rno-miR-133a-3p and-5p and hsa-/mmu-/rno-miR-133b were detected at much lower counts. [score:1]
Of these, oar-miRNA-133 is the only one presently recorded in miRBase (v21). [score:1]
MiR-1, miR-133, miR-499 and miR-208 are highly enriched myocardial miRNAs 27, 28 and are highly conserved across multiple species including human [29], mouse [30] rat [31] and porcine [32]. [score:1]
The most abundant cardiac-specific miRNA-133 in the sheep heart was oar-miR-133 which has one nt different from hsa-/mmu-/rno-miR-133a-3p (previously hsa-miRNA-133). [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 13
It has been shown that miRNAs are determinants of the physiology and pathophysiology of the cardiovascular system and altered expression of muscle- and/or cardiac-specific miRNAs such as the miRNAs named miR-1, miR-208 and miR-133 in myocardial tissue is involved in heart development and cardiovascular diseases, including myocardial hypertrophy, heart failure and fibrosis [11– 14]. [score:6]
Although, this study focus in the acute phase of the experimental Chagas disease some miRNAs (miR-133, miR-208) were found down regulated at 45 dpi in accordance with previously reported in human heart of Chagas chronic patients [15]. [score:4]
In the study, we have found that the same muscle- and/or cardiac-specific miRNAs, miR-1, miR-133 and miR-208 were downregulated in CCC myocardium as compared to control myocardium [15]. [score:3]
[1 to 20 of 3 sentences]
32
[+] score: 13
Conversely, anti-miR-222 treatment that inhibited endogenous miR-222 exerted no effect on the expression of miR-1, miR-133 and miR-206, probably due to the low miR-222 expression of in C [2]C [12] cells. [score:7]
Several miRs (miR-1, miR-133, and miR-206) have been shown to be specifically expressed in the skeletal muscle [26]– [32]. [score:3]
RNA levels of miR-206, miR-1, and miR-133 in C [2]C [12] cells transfected with miR-222 (5×10 [−8]M) or anti-miR-222 (5×10 [−8]M) were assessed by qRT-PCR; relative gene expression was calculated by the comparative Ct method (2 [−ddCt]). [score:1]
In another series of experiments, C [2]C [12] cells were transfected with miR-222 or antimiR-222 and the expression levels of miR-1, miR-133, miR-206 were measured. [score:1]
Thus, we investigated whether miR-222 is involved in the expression of three myogenic miRs: miR-1, miR-133 and miR-206. [score:1]
[1 to 20 of 5 sentences]
33
[+] score: 12
Recent studies demonstrated that miR-29b, miR-133a, and 133b regulate myoblast proliferation and differentiation [38, 44], and miR-1 and miR-133 have been reported to regulate different aspects of skeletal muscle development in vitro and in vivo [23]. [score:4]
miR-1 and miR-133 modulate skeletal-muscle-cell proliferation and differentiation by repressing the activity of HDAC4 (histone deacetylase 4; a signal -dependent inhibitor of muscle differentiation) and SRF, respectively, thereby establishing negative-feedback loops for muscle-cell differentiation [23]. [score:3]
The expression of miR-133 (miR-133a, miR-133b), miR-1, and miR-181 (miR-181a, miR-181b, and miR-181c) was profiled in muscle from patients affected by myotonic dystrophy type1 and it was observed that they were specifically induced during myogenesis [82]. [score:3]
The pivotal roles of three muscle-specific miRNAs, miR-1, miR-133, and miR-206, in the regulation of myogenesis have been well documented [17, 31, 32]. [score:2]
[1 to 20 of 4 sentences]
34
[+] score: 12
Other miRNAs from this paper: mmu-mir-133a-1, mmu-mir-133a-2, mmu-mir-133b
In addition, Zhang et al. showed that TSA enhances cell resistance to hypoxic insult by upregulating miR-133 expression through activation of MAPK-ERK1/2 [31]. [score:6]
For instance, Zhang et al. demonstrated that TSA enhances cell resistance to hypoxic insult by upregulating miR-133 expression through activation of the mitogen-activated protein kinase (MAPK)/extracellular signal-related kinase (ERK) pathway in neonatal cardiomyocytes [31]. [score:6]
[1 to 20 of 2 sentences]
35
[+] score: 12
Recent studies showed that both the miR-1/miR-206 family and miR-133 family of miRNAs were upregulated in myocytes during differentiation, but their effects on myogenesis were different. [score:4]
It has been reported that the miR-1/206 family promotes myogenesis; however miR-133 inhibits myogenic differentiation and sustains myoblast proliferation [33]. [score:3]
However, no significant changes were found in the levels of miR-1, miR-133, and miR-208b following HDBR (Figures 4(a), 4(c), and 4(e)). [score:1]
High-intensity exercise also caused increased levels of miR-1, miR-133, and miR-206 in the plasma [32]. [score:1]
Our results indicated that starvation induced C2C12 myotubes atrophy led to the secretion of miR-1, miR-23a, miR-133, miR-206, miR-208b, and miR-499 into the culture medium, which could be used as indicators for muscle atrophy. [score:1]
So, the increased levels of miR-1, miR-133, and miR-206 may be at least in part due to the stress caused by the unloading condition. [score:1]
However, the serum profiles of miR-1, miR-133, and miR-208b were different between human and mice, which required further research. [score:1]
[1 to 20 of 7 sentences]
36
[+] score: 12
Incorporation of miRNA target elements (miRTs) corresponding to two muscle-specific cellular miRNAs (miR-133 and miR-206) was shown to mediate silencing of CVA21 gene expression in cells expressing muscle-specific miRNA mimics, in muscle culture lines and, most importantly, in vivo in mice. [score:7]
Target elements corresponding to muscle-specific (miR-133 and miR-206), hematopoetic-specific (miR-142-3p) or tumor-suppressor (miR-145) miRNAs were incorporated in the 3′UTR of CVA21 and protection of HeLa cells transfected with sequence-complementary miRNA mimics (synthetic dsRNAs corresponding to cellular miRNA duplex intermediates) was analyzed (Figure 1B). [score:5]
[1 to 20 of 2 sentences]
37
[+] score: 12
We recently reported that the miR133 microRNA family, which is induced in murine AEC in the setting of hyperoxia, suppresses GM-CSF expression through direct interaction with sequences in this 3′-untranslated region to decrease mRNA stability (Sturrock et al. 2014). [score:8]
Decreased expression of GM-CSF by murine AEC during oxidative stress in vitro is at least in part a consequence of accelerated turnover of GM-CSF mRNA (Sturrock et al. 2010) as a result of the action of a specific microRNA family, miR133, directly affecting its stability (Sturrock et al. 2014). [score:4]
[1 to 20 of 2 sentences]
38
[+] score: 12
Over expression of miR-1 and miR-133 during the in-vitro development of embryoid bodies from mouse embryonic stem cells demonstrated that distinct steps in muscle development are specified by cooperative and opposing interactions between miR-1 and miR-133. [score:5]
The miR-1 and miR-206 promote myogenesis, while miR-133 inhibits myoblast differentiation and promotes proliferation by repressing serum response factor and a key splicing factor[17- 20]. [score:3]
In order to sustain the increased growth observed in Myostatin -null mice elevated satellite cell proliferation, which is regulated by miR-133[19] and differentiation, which is regulated by miR-1 and -206 [19, 19, 21], must occur. [score:3]
miR-1/-206 and miR-133 play opposing roles in modulating skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 4 sentences]
39
[+] score: 10
On the contrary, miR-133 stimulates myoblast proliferation by targeting SRF (Chen et al., 2006), while miR-206 promotes myoblast differentiation targeting the mRNA of PolA1 (Kim et al., 2006), a DNA polymerase subunit. [score:5]
Highly expressed miRNAs in skeletal muscle tissue are termed myomiRs, which include miR-1, miR-133a, miR133-b, miR-206, miR-208, miR208b, miR486, and miR-499 (Van Rooij et al., 2008). [score:3]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
miR-1 and miR-133 modulate skeletal and cardiac muscle growth and differentiation. [score:1]
[1 to 20 of 4 sentences]
40
[+] score: 10
First, miR-133b, another miR-133 family member, is also highly expressed in BAT (than in WAT) and maintains its expression in the miR-133a d KO BAT. [score:5]
In consistency with our study, two recent studies demonstrated that miR-133 can target Prdm16 in both satellite cells and brown adipose cell lines [17], [18]. [score:3]
Previous studies have demonstrated that several myogenic microRNAs (i. e. miR-1, miR-206 and miR-133) are enriched in BAT in relative to WAT [7]. [score:1]
Consistent with our observation, blockage of endogenous miR133 by antisense nucleotides in mice can greatly lower blood glucose levels [18]. [score:1]
[1 to 20 of 4 sentences]
41
[+] score: 10
As shown in Figure 6A, mRNA targets of several miRNA families were found to be significantly upregulated in hypertrophy (false discovery rate (FDR) <0.05), including those targeted by miR-29, miR-1, miR-9, miR-30, and miR-133. [score:8]
In addition, recent studies have implicated regulation of several microRNAs (miRNAs) in hypertrophy, including miR-1, miR-133, and miR-208 [11], [12], [13]. [score:2]
[1 to 20 of 2 sentences]
42
[+] score: 10
Inhibition of miR-133 increases the expression of PRDM16 and the mitochondrial activity [29]. [score:5]
Adrenergic stimulation inhibits expression of miR-133 (a muscle-enriched miRNA) to abolish posttranscriptional silencing of PRDM16. [score:5]
[1 to 20 of 2 sentences]
43
[+] score: 9
Three miRNAs (miRNA-21, miRNA-133, and miRNA-223) were identified by qRT-PCR showing significant upregulation of miRNA-223 by more than 50%. [score:4]
Levels of miRNA-21 and miRNA-133 remained no change in the AF group (Fig. 3E) while the miRNA-223 level reciprocally decreased by 2-fold in the miRNA-223 knockdown mice (Fig. 3F). [score:2]
No significant change was observed from the levels of miRNA-21 and miRNA-133 (Fig. 1E,F). [score:1]
The negative controls, miR-21 and miR-133, were unaltered in AF patients. [score:1]
The negative controls, miR-21 and miR-133, were unaltered in A-TP dogs. [score:1]
[1 to 20 of 5 sentences]
44
[+] score: 9
miR-1 and miR-133 are expressed in cardiac and skeletal muscle and are transcriptionally regulated by the myogenic differentiation factors MyoD, Mef2, and SRF [22]. [score:4]
miR-133 expression was not altered in response to END exercise. [score:3]
miR-133 content remained unchanged in both sedentary and forced-endurance exercise groups. [score:1]
On the other hand, miR-133 enhances myoblast proliferation by repressing the serum response factor [59]. [score:1]
[1 to 20 of 4 sentences]
45
[+] score: 9
In addition, dual fluorescence reporter containing perfect target sequence for miR-430, miR-1, and miR-133 was engineered to monitor the miRNA expression pattern in the zebrafish embryo or mouse embryos (De Pietri Tonelli et al., 2006; Giraldez et al., 2006; Mishima et al., 2009). [score:5]
Zebrafish miR-1 and miR-133 shape muscle gene expression and regulate sarcomeric actin organization. [score:4]
[1 to 20 of 2 sentences]
46
[+] score: 9
The direct proofs showing that miRNAs are involved in cardiac IPost were from recent one report [21], in which the expression of miR-133 and miR-1 were up-regulated by IPost. [score:7]
Recently, He et al. demonstrated that cardiac miR-1 and miR-133 were significantly increased by IPost during reperfusion in an I/R injury rat mo del, indicating some miRNAs may be involved in the regulation of cardiac IPost during reperfusion [21]. [score:2]
[1 to 20 of 2 sentences]
47
[+] score: 9
Cardiac miR-133 overexpression inhibits vasoactive mediators of fibrosis. [score:5]
Figure 1Effects of Cardiac miR-133 overexpression on fibrosis regulators during diabetes. [score:4]
[1 to 20 of 2 sentences]
48
[+] score: 9
We conclude that miR-9, miR-96, miR-133, and miR-146a interact directly with their binding sites in the Gdnf 3’UTR; moreover, miR-9, miR-96, and miR-146a regulate the expression of GDNF in vitro. [score:5]
miR-9, miR-96, miR-133 and miR-146a are novel regulators of GDNF. [score:2]
We identified binding sites for miR-9 and miR-96 in the 3’UTR of Gdnf; in addition, we identified binding sites for miR-133 and miR-146a. [score:1]
Note that miR-9/96/133m contains overlapping sites for miR-9, miR-96, and miR-133, all of which were mutated in this construct. [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 9
The downregulated or lost miRs in our study, such as miR-1 and its cluster partner miR-133, are tumour suppressor miRs, previously identified as consistently downregulated in primary prostate tumours [39]. [score:9]
[1 to 20 of 1 sentences]
50
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In addition to miR-23b, miR-30a, and miR-125b, which, as we showed by qRT-PCR and miRNA-Seq, are upregulated by HDI, several other putative Prdm1 targeting miRNAs, including miR-125a, miR-96, miR-351, miR-30c, miR-182, miR-23a, miR-200b, miR-200c, miR-365, let-7, miR-98, and miR-133, were also significantly increased by HDI. [score:6]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 9
In mouse ST2 MSCs, miR-125b inhibited osteoblast differentiation while miR-133 and miR-135 directly targeted Runx2 and Smad5 production, inhibiting the commitment of C2C12 MSCs into bone precursor cells [14], [15]. [score:8]
Although it has been reported that a number of miRNAs, miR-204/211 [13], miR-125b [14], miR-133 and miR-135 [15], miR-141 and miR-200a [16], and miR-29b [17], were involved in osteoblastic differentiation, a few papers have been reported with regard to the functions of miR-10a, miR-10b, miR-9-3p and miR-19b. [score:1]
[1 to 20 of 2 sentences]
52
[+] score: 9
A total of 11 miRNAs, let-7, miR-9, miR-206, miR-138, miR-133, miR-152, miR-137, miR-128, miR-143, miR-27b and miR-218 were co-expressed by 18 synaptic transmission target genes (Table S6). [score:5]
Again, the GO processes were composed of two sub-trees (Figure 3B), as in development, for shared miRNAs, such as miR-9, miR-206, miR-138, miR-133, miR-152, and miR-128. [score:2]
For synaptic transmission, miR-128, miR-27b, miR-133, miR-206, miR-152 and miR-9 are shared between development and tumor using picTar prediction; miR-128, miR-140, miR-27b, miR-22, miR-133, miR-223 and miR-152 are shared using PITA prediction. [score:2]
[1 to 20 of 3 sentences]
53
[+] score: 8
The muscle enriched miR-1, miR-133, and miR-206 exhibit correlated expression pattern during myogenesis or in muscle regeneration. [score:3]
Interestingly, whereas miR-133 was shown to promote myoblast proliferation by repressing SRF, it is also required for normal myogenic differentiation through the inhibition of uncoupling protein 2 (UCP2) [7, 10]. [score:3]
miR-133 has also been reported to regulate muscle differentiation. [score:2]
[1 to 20 of 3 sentences]
54
[+] score: 8
1003793.g008 Figure 8 (A) qRT-PCR expression analysis of pri-miR1-1, pri-miR1-2, pri-miR133-a1 and pri-miR133a-2 in Myocardin overexpressing embryonic hearts. [score:5]
All three loci produce bicistronic transcripts containing one miRNA from the miR-1/206 family and one from the miR-133 family essentially forming functional units [12] that are under the transcriptional control of heart and muscle specific regulatory programs [13], [14]. [score:2]
To further validate these findings, we transfected miR-1, miR-133 or control miRNA into isolated embryonic cardiomyocytes. [score:1]
[1 to 20 of 3 sentences]
55
[+] score: 8
In recognition that cardiovascular disease and cardiac remo deling is associated with simultaneous dysregulation of several miRNAs (e. g. miR-1, miR-34a, miR-133, miR-199b, miR-320 [11], [15], [36]– [38]) or miRNA families (e. g. miR-34 family [10], miR-208 family [39]), tiny 8-mer seed -targeting LNA-antimiRs could provide an advantage by simultaneous inhibition of entire miRNA seed families [10], [27]. [score:8]
[1 to 20 of 1 sentences]
56
[+] score: 8
We transfected increasing amounts of miR-499 into 293T cells in culture and found dose -dependent inhibition of the Sox6 UTR-luciferase construct, however another cardiac microRNA, miR-133, had no effect regardless of the dose (Fig. 4A ). [score:3]
Several microRNAs, including miR-1, miR-133, miR-206 and miR-208 [17]– [29], are found in cardiac and/or skeletal muscle, and each has a potentially distinct regulatory function. [score:2]
Sox6 3′UTR -mediated repression increased as amounts of miR-499 was increased; this was not observed with miR-133 or when the UTR orientation was reversed, n = 3–4 transfections per condition, *P<0.05. [score:1]
miR-499 was among the top cardiac-enriched microRNAs (Fig. 1A, Table S1), along with the well-studied microRNAs, miR-1 and miR-133. [score:1]
miR-499 is distinct from miR-1 and miR-133 in that it is encoded in only one genomic locus. [score:1]
[1 to 20 of 5 sentences]
57
[+] score: 8
Apparently, the concomitant loss of miR-206, miR-133b and the potential miR-133 sponge in linc-MD1 is compatible with normal muscle development and functions, which might be explained by expression of the miR-1/133a clusters in type I myofibers compensating for deletion of miR-206/133b. [score:4]
We have generated a miR-206/133b knock-out allele by deletion of the genomic region spanning from miR-206 to miR-133b and resulting in removal of the third exon of the linc-MD1 that might act as a miR-133 sponge. [score:2]
Surprisingly, lack of miR-206/133b and the miR-133 decoy, contained in the third exon of linc-MD1, did not have obvious effects on satellite cell proliferation and differentiation. [score:1]
Theoretically, the inactivation of miR-133b might also be counteracted by the loss of the miR-133 sponge function, although the physiological relevance of endogenous competing RNAs has been questioned making this explanation less likely [34]. [score:1]
[1 to 20 of 4 sentences]
58
[+] score: 7
Some miRNAs exhibited appreciable heritability estimates based on gene expression in the CC founder strains, but did not have detectable eQTL in the preCC population (e. g., miR-133). [score:3]
This equates to high-confidence eQTL for 38 % of the miRNAs that were differentially and highly expressed among the founder strains (and 35 % of the total number of miRNAs studied), though surprisingly miR-133 was not one of them. [score:3]
We note in particular the bimodal distributions for two miRNAs, miR-133 and miR-489, suggesting a single, large-effect eQTL for each. [score:1]
[1 to 20 of 3 sentences]
59
[+] score: 7
It is possible that all three miRNAs originate from regenerating fibres, although the high levels of miR-1 and miR-133 expression in mature muscle mean that this is not trivial to demonstrate. [score:3]
The dystromiRs miR-1, miR-133 and miR-206 are present at low levels in myogenic precursor cells, are upregulated during myogenic differentiation and can be considered markers of adopting a muscle lineage (8, 41). [score:3]
We (12), and others (13, 14), have shown that the serum of dystrophic animal mo dels (mdx mouse and CXMD [J] dog) and DMD patients is enriched for the dystrophy -associated miRNAs (dystromiRs): miR-1, miR-133 and miR-206. [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 7
This class of miRNAs, poorly expressed in mdx, was upregulated in exon-skipping -treated animals and included muscle specific (miR-1 and miR-133) and more ubiquitous (miR-29 and miR-30) miRNAs. [score:6]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 7
qPCR of left atrial chambers demonstrated that miR-1, miR-26b, miR-29a, miR-30e, miR-106b, miR-133 and miR-200 are up-regulated in HTD rats as compared to controls (Fig 1), demonstrating a similar microRNA expression profile as in atrial-specific Pitx2 deficient mice [14, 16]. [score:5]
Several lines of evidence have already reported the key regulatory role of miR-1 [60– 62], miR-26 [63], miR-106b [64], miR-133 [65– 66] and miR-200 [64] in arrhythmogenesis. [score:2]
[1 to 20 of 2 sentences]
62
[+] score: 6
Indeed, while miR-1 promotes differentiation of ES cells towards a cardiac fate, miR-133 inhibits differentiation into cardiac muscle [23], [27]. [score:3]
The differential expression of miR-133 in CSCs is therefore clearly indicative of a commitment to the cardiomyocyte lineage, compatible with the maintenance of an undifferentiated, non-proliferative state. [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 6
Other miRNAs from this paper: mmu-mir-133a-1, mmu-mir-25, mmu-mir-133a-2, mmu-mir-133b
The miR-133 family of miRNAs is the most highly expressed miRNAs in cardiac myocytes [42]. [score:3]
Effect of N-acetylcysteine (NAC) on the expression of miR-133 and RhoA, and muscle contraction in diabetes and hyperglycemia. [score:3]
[1 to 20 of 2 sentences]
64
[+] score: 6
Intriguingly, MAPKs are known regulators of miR-1/miR-133 biogenesis [52] and we have recently shown in vascular smooth muscle cell that ERK1/2 activation suppresses miR-133 expression [13], the miR-1 cognate bicistronic gene. [score:6]
[1 to 20 of 1 sentences]
65
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
MiR-206, miR-133, miR-199, miR-100 and miR-195 were implicated in the autophagy pathway targeting BCL2, MTOR and SQSTM1 as possible autophagy gene targets (Table 6). [score:5]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 6
Many miRNAs, such as miR-1, miR-133, miR-29, miR-214, miR-206, miR-486, miR-208b, and miR-499 were involved in the regulation of skeletal myogenesis by binding to its target genes 36, 37. [score:4]
For example, in mice, miR-1 and miR-133 are clustered on the same chromosomal loci and transcribed together in a tissue-specific manner during development, but miR-133 enhances proliferation by repressing serum response factor, whereas miR-1 promotes myogenesis through repressing histone deacetylase 4 [19]. [score:2]
[1 to 20 of 2 sentences]
67
[+] score: 6
Linc-MD1 can sponge miR-133 and miR-135 away from their target mRNAs, thus upregulating MAML1 and MEF2C, respectively [58]. [score:6]
[1 to 20 of 1 sentences]
68
[+] score: 6
The miR-133 mimic transfection into scS KOV3 did not reduce c-MET/EGFR levels, and miR-133 (miR-133-3p and miR-133-5p) inhibitor transfection into shNRF2-S KOV3 did not alter c-MET/EGFR levels (Supplementary Figure 5A). [score:3]
Results showed that miR-133 and miR-542-3p did not target c-MET/EGFR in our system. [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 6
Specific requirements of MRFs for the expression of muscle specific microRNAs, miR-1, miR-206 and miR-133. [score:3]
Insulin-like growth factor-1 receptor is regulated by microRNA-133 during skeletal myogenesis. [score:2]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 3 sentences]
70
[+] score: 6
Mice with targeted deletions of the following putative tumor suppressor miRNAs did not show development of an overt malignancy: miR-145, miR-223, miR-133, and miR-206 (Park et al., 2010). [score:6]
[1 to 20 of 1 sentences]
71
[+] score: 6
Furthermore, several of the dysregulated miRNAs in the HD monkeys are also predicted to target the insulin like growth factor −1 gene (IGF1) or its receptor (IGF1-R), including; miR-128a, miR940, miR-320, and miR133. [score:4]
Correspondingly, although we examined miR-128a regulation of the SP1 transcription factor, other miRNAS identified in this study also bioinformatically bind to SP1 (such as miR-320, miR-133, and miR-181). [score:2]
[1 to 20 of 2 sentences]
72
[+] score: 5
Notably, cardiac-specific miR-1, miR-133, miR-208 and miR-499 were all suppressed by two or more orders of magnitude [34], [35], as were the stemness and cell cycle repressors miR-141 and miR-137 [36]; in contrast, the proliferative miRNAs, miR-222 [37], increased dramatically in MDCs, and miR-221 was undetectable in myocytes but highly expressed in MDCs (Figure 5D). [score:5]
[1 to 20 of 1 sentences]
73
[+] score: 5
Taken together, we identified miR-133 as a novel suppressor of CCL2 in chondrocytes. [score:3]
In the present study, we predicted and selected out the potential miRNAs of CCL2 by choosing the conserved ones, miR-124 and miR-133. [score:1]
The high-throughput screening technology should be used to select out those functional miRNAs besides miR-124 and miR-133 in the future. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-98, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-141, mmu-mir-194-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-203a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-200b, mmu-mir-300, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-343, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-135a-2, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-326, hsa-mir-135b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-21, rno-mir-26b, rno-mir-27b, rno-mir-27a, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-33, rno-mir-98, rno-mir-126a, rno-mir-133a, rno-mir-135a, rno-mir-141, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-203a, rno-mir-211, rno-mir-218a-2, rno-mir-218a-1, rno-mir-300, hsa-mir-429, mmu-mir-429, rno-mir-429, hsa-mir-485, hsa-mir-511, hsa-mir-532, mmu-mir-532, rno-mir-133b, mmu-mir-485, rno-mir-485, hsa-mir-33b, mmu-mir-702, mmu-mir-343, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, hsa-mir-300, mmu-mir-511, rno-mir-466b-1, rno-mir-466b-2, rno-mir-532, rno-mir-511, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466b-8, hsa-mir-3120, rno-mir-203b, rno-mir-3557, rno-mir-218b, rno-mir-3569, rno-mir-133c, rno-mir-702, rno-mir-3120, hsa-mir-203b, mmu-mir-344i, rno-mir-344i, rno-mir-6316, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-3569, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, rno-mir-466b-3, rno-mir-466b-4, mmu-mir-203b
Cesana et al. showed that a long-intergenic ncRNA (lincRNA), linc-MD1, regulates muscle differentiation by interacting with two miRNAs, miR-135 and miR-133, which can bind to MAML1 and MEF2C to regulate their expression levels. [score:5]
[1 to 20 of 1 sentences]
75
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, dme-mir-1, dme-mir-2a-1, dme-mir-2a-2, dme-mir-2b-1, dme-mir-2b-2, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-101a, mmu-mir-124-3, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-137, mmu-mir-140, mmu-mir-142a, mmu-mir-155, mmu-mir-10b, mmu-mir-183, mmu-mir-193a, mmu-mir-203, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-183, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-222, hsa-mir-223, dme-mir-133, dme-mir-34, dme-mir-124, dme-mir-79, dme-mir-210, dme-mir-87, mmu-mir-295, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, dme-let-7, dme-mir-307a, dme-mir-2c, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-193a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-27a, mmu-mir-34a, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-10a, mmu-mir-210, mmu-mir-223, mmu-mir-222, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-411, hsa-mir-193b, hsa-mir-411, mmu-mir-193b, hsa-mir-944, dme-mir-193, dme-mir-137, dme-mir-994, mmu-mir-1b, mmu-mir-101c, hsa-mir-203b, mmu-let-7j, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, mmu-mir-124b
Conserved pre-miRNAs with small variance of 5′-isomiR arm abundances among the four species (e. g. let-7 in Table 3) have lower folding energies (box to the right) than those with large variance (e. g. miR-133 in Table 3). [score:1]
We observed that miRNA orthologues (miR-10, miR-133, miR-137 and miR-79 in Table 3) swapped major miRNAs and 5′-isomiRs and had largely different 5′-isomiR arm abundances across human, mouse, fruitfly and worm. [score:1]
Such seed shift, as previously reported (50), was also identified in miR-133-3p and miR-137-3p across fruitfly and human/mouse (Table 3), and found in miR-79-3p between fruitfly and worm. [score:1]
For example, the major fruitfly dme-miR-133 with the seed ‘UGGUCCC’ is located 2-nt away from the upstream bulge (few 5′-isomiRs), but in human, the 5′-isomiR with the same seed ‘UGGUCCC’ is 3-nt away from the upstream bulge in pre-miR-133a-1/2 hairpins (Supplementary Figure S3B), thus plausibly accounting for a higher 5′ end heterogeneity of miR-133a-1/2 in human. [score:1]
Two conserved miRNA families with multiple members, i. e. miR-133 and miR-10, had individual members with large differential 5′-isomiR arm abundances. [score:1]
[1 to 20 of 5 sentences]
76
[+] score: 5
One samples of fibroblasts (GSM1370494) GATA4, MEF2C, TBX5, MESP1 and MYOCD TFS and miR-133 along with SNAI1 suppression were used to convert fibroblasts to Cardiomyocytes GSE56913 Human 3D-Gene Human Oligo chip 25k V2.1Nam et al. [11] One sample of induced cardiomyocytes (GSM1065980) vs. [score:3]
One samples of fibroblasts (GSM1370499) Gata4, Mef2c, and Tbx5 TFS and miR-133 were used to convert fibroblasts to Cardiomyocytes GSE56913 Mouse 3D-Gene Mouse Oligo chip 24k Figure 1 Schematic view of the direct reprogramming of human fibroblasts to five different cells. [score:2]
[1 to 20 of 2 sentences]
77
[+] score: 5
For example, miR-196 expression affected limb development [8], miR-1 and miR-133 cardiogenesis [9, 10] and skeletal muscle development [11], and miR-181 enhanced myoblast differentiation [12]. [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 5
In addition, accumulating evidence suggests that the aberrant expressions of miRNAs, such as miR-1, miR-133, miR-23a, miR-206, miR-27, miR-628, miR-431 and miR-21 (refs 17, 18, 19, 20, 21, 22, 23, 24), contribute to muscle atrophy. [score:3]
A cluster of myomiRs including miR-1, miR-133 and miR-206 have been found to play important roles in regulating myogenesis and muscle regeneration 16. [score:2]
[1 to 20 of 2 sentences]
79
[+] score: 5
Previous studies showed that miR-1 and miR-133 are highly correlated with heart development, and miR-1 was the first miRNA to be implicated in heart development [22]. [score:3]
An increasing number of miRNAs with different functions in heart development have also been identified, including miR-1, miR-208, miR-133, miR-206, miR-126, miR-143, miR-145, and miR-499; from this group, we analyzed the 7 miRNAs most relevant to postnatal heart growth. [score:2]
[1 to 20 of 2 sentences]
80
[+] score: 5
For instance, linc-MD1 is a muscle-specific intergenic lncRNA that acts as a sponge for miR-133 and miR-135, preventing their suppression of MAML1 and MEF2C and activating muscle-specific gene expression [6]. [score:5]
[1 to 20 of 1 sentences]
81
[+] score: 5
miR-133, regulated by SREBP1 [32], is associated with inflammatory lung disease [36]. [score:4]
control lungs including miR-1, miR-124, miR-29 and miR-133. [score:1]
[1 to 20 of 2 sentences]
82
[+] score: 4
Cluster 6, containing the miR-1/206 and miR-133 family, showed a distinct peak of expression during late involution, between 4 and 6 days after weaning, as well as a second smaller peak during early development from 12 to 15 days of age. [score:4]
[1 to 20 of 1 sentences]
83
[+] score: 4
The methylation profiling of a single down-regulated miRNA-133 as a representative example (bottom panel). [score:4]
[1 to 20 of 1 sentences]
84
[+] score: 4
A muscle-specific lncRNA, linc-MD1, displays decoy activity for two specific miRNAs (miR-133 and miR-135) and regulates the expression of MAML1 and MEF2C in a molecular circuitry affecting the differentiation program [28]. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
Moreover, a role for miRNAs in regulating CTGF expression in cardiomyocytes has been established by Duisters et al., (2009), who showed that increased CTGF transcription during pathological LV hypertrophy in (young) hearts is controlled by miR-30 and miR-133. [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
One study showed that miR-133 and miR-126 regulate GLUT4 transcription and translocation into the plasma membrane in rat muscle tissue [70, 73]. [score:2]
Two other miRNAs, miR-133 and miR-320, also reduce insulin resistance by regulation of glucose transport in adipocytes [70, 71]. [score:2]
[1 to 20 of 2 sentences]
87
[+] score: 4
In the SOD1(G93A) mouse mo del of amyotrophic lateral sclerosis (ALS), miR-133 as well as miR-206 are upregulated at symptomatic stages [13]. [score:4]
[1 to 20 of 1 sentences]
88
[+] score: 4
[44] Upregulation of miR-1 and miR-133 contributes to arsenic -induced cardiac electrical disorders. [score:4]
[1 to 20 of 1 sentences]
89
[+] score: 4
As expected, dystromiRs which are known to be up-regulated in mdx mouse serum (i. e. miR-1 and miR-133) were the least stable. [score:4]
[1 to 20 of 1 sentences]
90
[+] score: 4
Two of the above mentioned miRNAs (miR-30 and miR-133) were targeted by both aspirin and naproxen. [score:3]
In particular, some of the miRNAs modulated by aspirin in mice protected against the formation of microadenomas (miR-16, miR-133, miR-137, and miR-191) were the same that had been found to be modulated by the same NSAID in A/J mice aged 10 weeks. [score:1]
[1 to 20 of 2 sentences]
91
[+] score: 4
miR-133 directly targets the 3’-UTR of Prdm16 [19] and controls the differentiation of satellite cells within skeletal muscle towards an adipogenic or myogenic phenotype [17, 19]. [score:4]
[1 to 20 of 1 sentences]
92
[+] score: 4
Thus, as SRF is a master regulator of contractile genes in SMC [12], the transcription of many contractile smooth muscle genes (Myh11, Acta2) 13, 14 and microRNA (miRNAs; mir-133, mir-143/145) 15, 16 is dependent on the binding of SRF to CArG (CC[A/T] [6]GG) boxes at these loci 17, 18. [score:2]
Dnmt1- KO GI-SMC have significant genomic CpG demethylation, a loss of intercellular connectivity, decreases in necessary SMC transcripts (Myh11, Srf, miR-133, miR-143/145), and increases in both pro-apoptotic genes (Gadd45g, Nr4a1) and miRNAs associated with changes in cellular identity (miR-21a, -148a, -186a, -10b). [score:1]
Dnmt1- KO mice have considerable losses of SMC marker transcripts necessary for mature functioning, including Acta2 (25.7% loss), Myocd (37.4% loss), Myh11 (53.2% loss), Srf(41.7% loss), and Tagln (19.9% loss) (Fig.   4c) as well as reductions in necessary SMC miRNAs miR-143 (31.1% loss), miR-145 (40.8% loss), and miR-133 (70.4% loss) (Fig.   4d). [score:1]
[1 to 20 of 3 sentences]
93
[+] score: 4
Two wi dely conserved miRNAs that display cardiac- and skeletal muscle–specific expression during development and in the adult are miR-1 and miR-133 [33], which are derived from a common precursor transcript (bicistronic) [34], [35]. [score:4]
[1 to 20 of 1 sentences]
94
[+] score: 4
To verify the Solexa sequencing data, we randomly selected five differentially expressed miRNAs (miR-1, miR-206, miR-122, miR-222, and miR-133), and conducted quantitative RT-PCR. [score:3]
The abundance of miR-1, miR-206, miR-122, miR-222, and miR-133 were normalised relative to the abundance of U6 small nuclear RNA (snRNA). [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
For example, miR-1 and miR-133 are specifically expressed in muscles. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
In addition, we found that miR-7a-5p, miR-15b-5p, miR-105, and miR-133-3p exhibited similar expression levels in sedentary strains but were similarly modulated by exercise in SAMP8 and SAMR1 mice (Figures 2D–G). [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
112.267732 12 Duisters RF, Tijsen AJ, Schroen B, Leenders JJ, Lentink V, et al. (2009) miR-133 and miR-30 regulate connective tissue growth factor: implications for a role of microRNAs in myocardial matrix remo deling. [score:2]
Also, the RISC complex may have become saturated with mature miRNA-30c as has been observed in the previously reported miRNA-133 transgenic mice [42], thereby altering general miRNA biogenesis. [score:1]
[1 to 20 of 2 sentences]
98
[+] score: 3
The expression of mir-29b and mir-133 in the heart has been confirmed by northern blot [19]. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
MRFs are involved in the transcriptional regulation of muscle enriched miRNAs (myomiRs), including miR-1, miR-133 and miR-206, and regulatory feedback loops have been identified between miRNAs and MRFs in muscle cells [26, 34– 36]. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
On the contrary, the anti-hypertrophic action of some hormones and microRNA, including the growth hormone-releasing hormone and microRNA-133, involves Epac1 inhibition [10, 11]. [score:3]
[1 to 20 of 1 sentences]