sort by

6 publications mentioning mdm-MIR162a

Open access articles that are associated with the species Malus domestica and mention the gene name MIR162a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 54
Other miRNAs from this paper: mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162b, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR319a, mdm-MIR319b, mdm-MIR393a, mdm-MIR393b, mdm-MIR393c, mdm-MIR398a, mdm-MIR398b, mdm-MIR398c, mdm-MIR399a, mdm-MIR399b, mdm-MIR399c, mdm-MIR399d, mdm-MIR399e, mdm-MIR399f, mdm-MIR399g, mdm-MIR399h, mdm-MIR399i, mdm-MIR399j, mdm-MIR3627a, mdm-MIR3627b, mdm-MIR3627c, mdm-MIR391, mdm-MIR535a, mdm-MIR535b, mdm-MIR535c, mdm-MIR535d, mdm-MIR827, mdm-MIR5225c, mdm-MIR159c, mdm-MIR5225a, mdm-MIR5225b, mdm-MIR319c, mdm-MIR7125, mdm-MIR7126, mdm-MIR393d, mdm-MIR393e, mdm-MIR393f, mdm-MIR171o, mdm-MIR7128, mdm-MIR858, mdm-MIR1511, mdm-MIR3627d, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR399k, mdm-MIR319d, mdm-MIR319e, mdm-MIR319f, mdm-MIR319g, mdm-MIR171p, mdm-MIR393g, mdm-MIR393h, mdm-MIR319h, mdm-MIR171q, mdm-MIR172p
The expression patterns of these miRNAs and their targets could be divided into four types: (1) mdm-miR156, mdm-miR160, mdm-miR535 and their targets, the SBP, AP2, AP2-like, ARF16, AFB, DC19 and RD19 genes, had the highest expression levels in roots but relatively low expression levels in fruit (Figure  9A,B,D,F and H); (2) mdm-miR393, mdm-miR398a, mdm-miR398b and their targets, the SPL2, SPL9 and ACA8 genes, were found to be expressed most abundantly in flowers but had relatively low expression levels in fruit and roots (Figure  9A,C,E,F,G and H); (3) mdm-miR172, mdm-miR162, mdm-miR162, mdm-miR5225 and their targets, the ARF17, LETM1-LIKE and ADH2 genes, showed high expression levels in leaf tissue but relatively low levels were observed in stems (Figure  9B,D,E,G and I); (4) mdm-miR858 and mdm-miR3627 and their targets, the TIR1 and MYB5 genes, had high expression levels in fruit but low levels in stems (Figure  9C,G and J). [score:25]
The expression profiles of mdm-miR162, mdm-miR535, mdm-miR858, mdm-miR3727 and miR5225 were up-regulated in J leaves compared with A leaves during leaf development, while mdm-miR398a and mdm-miR398b were down-regulated in J leaves compared with A leaves, implying that these miRNAs may participate in the regulating leaf development and other biological processes (Figure  7F,G,H and I). [score:10]
The expression of miRNAs and their targets in leaves of different ages: mdm-miR156 (A); mdm-miR172 (B); mdm-miR393 (C); mdm-miR160 (D); mdm-miR162 (E); mdm-miR535 (F); mdm-miR3627 and mdm-miR5225 (G); mdm-miR398a (H); mdm-miR398b (I); and mdm-miR858 (J). [score:5]
The expression of miRNAs and their targets in A and J leaves: mdm-miR156 (A); mdm-miR172 (B); mdm-miR393 (C); mdm-miR160 (D); mdm-miR162 (E); mdm-miR535 (F); mdm-miR3627and mdm-miR5225 (G); mdm-miR398a (H); mdm-miR398b (I); and mdm-miR858 (J). [score:5]
Expression of miRNAs and their targets in different tissue: mdm-miR156 (A); mdm-miR172 (B); mdm-miR393 (C); mdm-miR160 (D); mdm-miR162 (E); mdm-miR535 (F); mdm-miR3627 and mdm-miR5225 (G); mdm-miR398a (H); mdm-miR398b (I); and mdm-miR858 (J). [score:5]
The known miRNA targets included some TFs, including SPL2 (mdm-miR156), SPL9 (mdm-miR156), ARF16 (mdm-miR160) and MYB5 (mdm-miR858), and others contained several regulatory proteins, including the LETM1-LIKE protein (mdm-miR162), AUX signaling F-box 2 protein (mdm-miR393) and the AT hook motif DNA -binding family protein (mdm-miR3627) (Table  3). [score:4]
[1 to 20 of 6 sentences]
2
[+] score: 26
SmallRNA SmallRNA_seq Transcript Transcript Annotation KEGG_pathways Alignment Score Alignment Range P-value mdm-miR403a TTAGATTCACGCACAAACTCG XM_008373619.1 Argonaute – 1 3231–3251 0.00E+00 mdm-miR397a_L+1R+2_1ss22AG ATTGAGTGCAGCGTTGATGAAGGT XM_008365682.1 Nitrite reductase (NO-forming) ko00910(Nitrogen metabolism) 2.5 738–760 0.00E+00 mdm-miR172a_R+1_1 AGAATCTTGATGATGCTGCAA XM_008359912.1 AP2-like factor, euAP2 lineage – 2 1715–1735 0.00E+00 mdm-miR396c_R-2 TTCCACAGCTTTCTTGAAC XM_008372783.1 E3 ubiquitin-protein ligase ko04120(Ubiquitin mediated proteolysis); ko04144(Endocytosis) 4 2420–2438 8.13E−42 mdm-miR3627a_R-1 TCGCAGGAGAGATGGCACT XM_008393337.1Ca [2+]-transporting ATPase – 1.5 334–352 8.36E−76 mdm-miR162a TCGATAAACCTCTGCATCCAG XM_008360618.1 Endoribonuclease Dicer – 2 3720–3741 2.00E−31 gma-MIR5368-p3_1ss3GA CCAAGGGACAGTCTCAGGT XM_008373238.1 Autophagy-related protein 7 ko04140(Regulation of autophagy) 3 946–964 3.22E−20 gma-MIR5368-p5_1ss2AT GTGAGATACCACTCTGGA XM_008360074.1 Cellulose synthase A – 4 1825–1842 5.69E−09 ppe-MIR172c-p5 GCGGCATCATCAAGATTCAC XM_008393540.1 Monodehydroascorbate reductase ko00053(Ascorbate and aldarate metabolism) 4 518–536 1.92E−28 PC-3p-202837_7 AGGAATGTAAAATGAGATT XM_008392258.1 Pyruvate dehydrogenase kinase – 3.5 909–928 1.69E−19 PC-3p-370429_4 AGTGTAGAATGAGATTTTTTGAAG XR_524420.1 Glutathione S-transferase ko00980(Metabolism of xenobiotics by cytochrome P450);ko00982(Drug metabolism - cytochrome P450) 3 514–537 1.69E−08 PC-5p-154495_9 AGATGAATTTGAATTTTGAGATTT XM_008355882.1 ATP -binding cassette ko02010 (ABC transporters) 2.5 2608–2631 1.61E−29 Target annotation of differentially expressed miRNAs in apple response to VmThe GO annotation showed that these target genes could participate in various cellular processes, such as apoptosis, transcription regulation, auxin -mediated signaling pathway, ATP binding, DNA binding and protein binding activity (Table S6). [score:9]
The gene mdm-miR162 was down-regulated at 12 hpi, while the expression of the corresponding target gene DCL1 began to increase and peaked at four-fold of the control. [score:8]
SmallRNA SmallRNA_seq Transcript Transcript Annotation KEGG_pathways Alignment Score Alignment Range P-value mdm-miR403a TTAGATTCACGCACAAACTCG XM_008373619.1 Argonaute – 1 3231–3251 0.00E+00 mdm-miR397a_L+1R+2_1ss22AG ATTGAGTGCAGCGTTGATGAAGGT XM_008365682.1 Nitrite reductase (NO-forming) ko00910(Nitrogen metabolism) 2.5 738–760 0.00E+00 mdm-miR172a_R+1_1 AGAATCTTGATGATGCTGCAA XM_008359912.1 AP2-like factor, euAP2 lineage – 2 1715–1735 0.00E+00 mdm-miR396c_R-2 TTCCACAGCTTTCTTGAAC XM_008372783.1 E3 ubiquitin-protein ligase ko04120(Ubiquitin mediated proteolysis); ko04144(Endocytosis) 4 2420–2438 8.13E−42 mdm-miR3627a_R-1 TCGCAGGAGAGATGGCACT XM_008393337.1Ca [2+]-transporting ATPase – 1.5 334–352 8.36E−76 mdm-miR162a TCGATAAACCTCTGCATCCAG XM_008360618.1 Endoribonuclease Dicer – 2 3720–3741 2.00E−31 gma-MIR5368-p3_1ss3GA CCAAGGGACAGTCTCAGGT XM_008373238.1 Autophagy-related protein 7 ko04140(Regulation of autophagy) 3 946–964 3.22E−20 gma-MIR5368-p5_1ss2AT GTGAGATACCACTCTGGA XM_008360074.1 Cellulose synthase A – 4 1825–1842 5.69E−09 ppe-MIR172c-p5 GCGGCATCATCAAGATTCAC XM_008393540.1 Monodehydroascorbate reductase ko00053(Ascorbate and aldarate metabolism) 4 518–536 1.92E−28 PC-3p-202837_7 AGGAATGTAAAATGAGATT XM_008392258.1 Pyruvate dehydrogenase kinase – 3.5 909–928 1.69E−19 PC-3p-370429_4 AGTGTAGAATGAGATTTTTTGAAG XR_524420.1 Glutathione S-transferase ko00980(Metabolism of xenobiotics by cytochrome P450);ko00982(Drug metabolism - cytochrome P450) 3 514–537 1.69E−08 PC-5p-154495_9 AGATGAATTTGAATTTTGAGATTT XM_008355882.1 ATP -binding cassette ko02010 (ABC transporters) 2.5 2608–2631 1.61E−29 The GO annotation showed that these target genes could participate in various cellular processes, such as apoptosis, transcription regulation, auxin -mediated signaling pathway, ATP binding, DNA binding and protein binding activity (Table S6). [score:5]
One DCL1, one AGO2, and two AGO1 transcripts were identified to be the target genes of mdm-miR162, mdm-miR403a, mdm-miR159c, and mdm-miR168b. [score:3]
Based on the results of degradome sequencing, we found four transcripts of the “switch” gene controlling miRNA generation (Dicer1), which could be cleaved by three different but highly homologous miRNAs from the same family of miR162. [score:1]
[1 to 20 of 5 sentences]
3
[+] score: 24
Other miRNAs from this paper: mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR168a, mdm-MIR168b, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR390a, mdm-MIR390b, mdm-MIR390c, mdm-MIR390d, mdm-MIR390e, mdm-MIR390f, mdm-MIR393a, mdm-MIR393b, mdm-MIR393c, mdm-MIR394a, mdm-MIR394b, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR397a, mdm-MIR397b, mdm-MIR398a, mdm-MIR398b, mdm-MIR398c, mdm-MIR399a, mdm-MIR399b, mdm-MIR399c, mdm-MIR399d, mdm-MIR399e, mdm-MIR399f, mdm-MIR399g, mdm-MIR399h, mdm-MIR399i, mdm-MIR399j, mdm-MIR403a, mdm-MIR403b, mdm-MIR408a, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR159c, mdm-MIR393d, mdm-MIR393e, mdm-MIR393f, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR399k, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR393g, mdm-MIR393h, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR169o
Several miRNAs were expressed to similar levels in all tissues tested, e. g. miR396 was highly expressed in all tissues and miR162 showed moderate to low levels of expression in all tissues; miR164 and miR393 were barely detectable in the shoot apex, whereas miR160, miR169 and miR390 were more abundant in the shoot apex than other tissues; miR398, miR403 and miR408 appeared up-regulated in leaf. [score:10]
Conservation status miRNA family Arabidopsis Oryza(rice) Populus(poplar) Predicted target gene(s) miR156 √ √ √Squamosa promoter -binding proteins[57] miR159/319 √ √ √GAMYB transcription factors[57] miR160 √ √ √Auxin response factors (ARF) [57] miR162 √ √ √DICER-LIKE 1 (DCL1) [57] miR164 √ √ √NAC domain transcription factors[57] miR156/166 √ √ √HD-ZIP transcription factors[57] miR167 √ √ √Auxin response factors (ARF) [57] miR168 √ √ √ARGONAUTE 1 (AGO1) [57] miR169 √ √ √HAP2-like transcription factors[57] miR171 √ √ √Scarecrow-like transcription factors[57] miR172 √ √ √APETALA 2 transcription factors[58] miR390 √ √ √TAS3[59] miR393 √ √ √F-box transcription factors (TIR1) [60] miR394 √ √ √F-box transcription factors[60] miR396 √ √ √GRF, rhodenase[60] miR397 √ √ √laccase[60] miR398 √ √ √Copper superoxid dismutase, CytC oxidase[60] miR403 √ √ √ARGONAUTE 2 (AGO2)[20] miR408 √ √Peptide chain release factor, laccase[20] miR475 √PPR proteins[8] miR476 √PPR proteins[8] Figure 1 Differential expression of miRNAs in apple tissues. [score:5]
Conservation status miRNA family Arabidopsis Oryza(rice) Populus(poplar) Predicted target gene(s) miR156 √ √ √Squamosa promoter -binding proteins[57] miR159/319 √ √ √GAMYB transcription factors[57] miR160 √ √ √Auxin response factors (ARF) [57] miR162 √ √ √DICER-LIKE 1 (DCL1) [57] miR164 √ √ √NAC domain transcription factors[57] miR156/166 √ √ √HD-ZIP transcription factors[57] miR167 √ √ √Auxin response factors (ARF) [57] miR168 √ √ √ARGONAUTE 1 (AGO1) [57] miR169 √ √ √HAP2-like transcription factors[57] miR171 √ √ √Scarecrow-like transcription factors[57] miR172 √ √ √APETALA 2 transcription factors[58] miR390 √ √ √TAS3[59] miR393 √ √ √F-box transcription factors (TIR1) [60] miR394 √ √ √F-box transcription factors[60] miR396 √ √ √GRF, rhodenase[60] miR397 √ √ √laccase[60] miR398 √ √ √Copper superoxid dismutase, CytC oxidase[60] miR403 √ √ √ARGONAUTE 2 (AGO2)[20] miR408 √ √Peptide chain release factor, laccase[20] miR475 √PPR proteins[8] miR476 √PPR proteins[8] Figure 1 Differential expression of miRNAs in apple tissues. [score:5]
C, Stem-loop RT-PCR analyses using 10 ng total RNA of miR160, miR162, miR164, miR168, miR169, miR171, miR390, miR393, miR394, miR396, miR397, miR398, miR403, miR408, miR475, and miR476 expression. [score:3]
Using this approach miR156, miR159, miR160, miR162, miR167, miR169, miR396 and miR398 were clearly detectable; miR172, miR390 and miR393 produced a weak amplification signal; miR166 and miR397 amplification did not produce the expected product, but resulted in a smear not detected in the minus-RT control; miR164, miR168, miR171, miR394, miR403, miR408 and the miRNAs specific to poplar (miR475 and miR476) were not detected (Figure 4). [score:1]
[1 to 20 of 5 sentences]
4
[+] score: 5
Other miRNAs from this paper: mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR168a, mdm-MIR168b, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR319a, mdm-MIR319b, mdm-MIR390a, mdm-MIR390b, mdm-MIR390c, mdm-MIR390d, mdm-MIR390e, mdm-MIR390f, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR399a, mdm-MIR399b, mdm-MIR399c, mdm-MIR399d, mdm-MIR399e, mdm-MIR399f, mdm-MIR399g, mdm-MIR399h, mdm-MIR399i, mdm-MIR399j, mdm-MIR2111a, mdm-MIR2111b, mdm-MIR3627a, mdm-MIR3627b, mdm-MIR3627c, mdm-MIR535a, mdm-MIR535b, mdm-MIR535c, mdm-MIR535d, mdm-MIR828a, mdm-MIR828b, mdm-MIR159c, mdm-MIR319c, mdm-MIR858, mdm-MIR3627d, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR399k, mdm-MIR319d, mdm-MIR319e, mdm-MIR319f, mdm-MIR319g, mdm-MIR319h, mdm-MIR172p
Although lower expression (between 1,500 and 4,000 RPM) was observed for the miR162, miR164, miR168, miR172 and miR399 families, their overall expression level was 3 to 20 times greater than any of the remaining 12 conserved miRNA families (Figure 1a; Table S3 in Additional file 1). [score:5]
[1 to 20 of 1 sentences]
5
[+] score: 2
Other miRNAs from this paper: mdm-MIR482a, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR319a, mdm-MIR319b, mdm-MIR390a, mdm-MIR390b, mdm-MIR390c, mdm-MIR390d, mdm-MIR390e, mdm-MIR390f, mdm-MIR393a, mdm-MIR393b, mdm-MIR393c, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR398a, mdm-MIR398b, mdm-MIR398c, mdm-MIR399a, mdm-MIR399b, mdm-MIR399c, mdm-MIR399d, mdm-MIR399e, mdm-MIR399f, mdm-MIR399g, mdm-MIR399h, mdm-MIR399i, mdm-MIR399j, mdm-MIR408a, mdm-MIR3627a, mdm-MIR3627b, mdm-MIR3627c, mdm-MIR477b, mdm-MIR477a, mdm-MIR482b, mdm-MIR482c, mdm-MIR535a, mdm-MIR535b, mdm-MIR535c, mdm-MIR535d, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR2118a, mdm-MIR2118b, mdm-MIR2118c, mdm-MIR482d, mdm-MIR5225c, mdm-MIR159c, mdm-MIR7124a, mdm-MIR7124b, mdm-MIR5225a, mdm-MIR5225b, mdm-MIR319c, mdm-MIR393d, mdm-MIR393e, mdm-MIR393f, mdm-MIR171o, mdm-MIR1511, mdm-MIR3627d, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR399k, mdm-MIR319d, mdm-MIR319e, mdm-MIR319f, mdm-MIR319g, mdm-MIR395j, mdm-MIR171p, mdm-MIR393g, mdm-MIR393h, mdm-MIR395k, mdm-MIR319h, mdm-MIR171q, mdm-MIR172p, mdm-MIR395l
Interestingly, the majority of DE-miRNAs identified in our study (miR162, miR167, miR390, miR393, miR396, miR398, miR408, miR535, miR1511, miR2118, miR3627, and miR7124) showed opposite expression patterns compared to the ones in the previous study on phase transition in apple trees (Xing et al., 2014). [score:2]
[1 to 20 of 1 sentences]
6
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, osa-MIR396e, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR159a, gma-MIR160a, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR172a, gma-MIR172b, gma-MIR156a, gma-MIR396a, gma-MIR396b, gma-MIR156b, gma-MIR169a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR169r, gma-MIR159b, gma-MIR159c, gma-MIR162a, gma-MIR164a, gma-MIR167c, gma-MIR169b, gma-MIR169c, gma-MIR171a, gma-MIR171b, gma-MIR482a, sly-MIR160a, sly-MIR166a, sly-MIR166b, sly-MIR167a, sly-MIR169a, sly-MIR169b, sly-MIR169c, sly-MIR169d, sly-MIR171a, sly-MIR171b, sly-MIR171c, sly-MIR171d, sly-MIR395a, sly-MIR395b, sly-MIR156a, sly-MIR156b, sly-MIR156c, sly-MIR159, sly-MIR162, sly-MIR172a, sly-MIR172b, osa-MIR396f, gma-MIR167d, gma-MIR396c, mdm-MIR482a, gma-MIR167e, gma-MIR167f, gma-MIR172c, gma-MIR172d, gma-MIR172e, osa-MIR396g, osa-MIR396h, osa-MIR396d, osa-MIR395x, osa-MIR395y, gma-MIR396d, gma-MIR482b, gma-MIR167g, gma-MIR156f, gma-MIR169d, gma-MIR172f, gma-MIR171c, gma-MIR169e, gma-MIR394b, gma-MIR156g, gma-MIR159d, gma-MIR394a, gma-MIR396e, gma-MIR156h, gma-MIR156i, gma-MIR160b, gma-MIR160c, gma-MIR160d, gma-MIR160e, gma-MIR162b, gma-MIR164b, gma-MIR164c, gma-MIR164d, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR169f, gma-MIR169g, gma-MIR171d, gma-MIR171e, gma-MIR171f, gma-MIR171g, gma-MIR394c, gma-MIR408d, gma-MIR482c, gma-MIR171h, gma-MIR171i, gma-MIR169h, gma-MIR167h, gma-MIR169i, gma-MIR396f, gma-MIR396g, gma-MIR167i, sly-MIR482e, sly-MIR482a, gma-MIR171j, gma-MIR395a, gma-MIR395b, gma-MIR395c, gma-MIR408a, gma-MIR408b, gma-MIR408c, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR159e, gma-MIR159f, gma-MIR162c, gma-MIR166i, gma-MIR166j, gma-MIR169j, gma-MIR169k, gma-MIR169l, gma-MIR169m, gma-MIR169n, gma-MIR171k, gma-MIR172g, gma-MIR172h, gma-MIR172i, gma-MIR172j, gma-MIR396h, gma-MIR396i, gma-MIR482d, gma-MIR167j, gma-MIR171l, gma-MIR156p, gma-MIR171m, gma-MIR172k, gma-MIR171n, gma-MIR156q, gma-MIR171o, gma-MIR172l, gma-MIR169o, gma-MIR171p, gma-MIR394d, gma-MIR169p, gma-MIR156r, gma-MIR396j, gma-MIR171q, gma-MIR156s, gma-MIR169r, gma-MIR169s, gma-MIR396k, gma-MIR166k, gma-MIR156t, gma-MIR482e, gma-MIR171r, gma-MIR394e, gma-MIR169t, gma-MIR171s, gma-MIR166l, gma-MIR171t, gma-MIR394f, gma-MIR171u, gma-MIR395d, gma-MIR395e, gma-MIR395f, gma-MIR395g, gma-MIR166m, gma-MIR169u, sly-MIR482b, sly-MIR482c, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR160f, gma-MIR164e, gma-MIR164f, gma-MIR164g, gma-MIR164h, gma-MIR164i, gma-MIR164j, gma-MIR164k, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR169v, gma-MIR394g, gma-MIR395h, gma-MIR395i, gma-MIR395j, gma-MIR395k, gma-MIR395l, gma-MIR395m, mdm-MIR156a, mdm-MIR156b, mdm-MIR156c, mdm-MIR156d, mdm-MIR156e, mdm-MIR156f, mdm-MIR156g, mdm-MIR156h, mdm-MIR156i, mdm-MIR156j, mdm-MIR156k, mdm-MIR156l, mdm-MIR156m, mdm-MIR156n, mdm-MIR156o, mdm-MIR156p, mdm-MIR156q, mdm-MIR156r, mdm-MIR156s, mdm-MIR156t, mdm-MIR156u, mdm-MIR156v, mdm-MIR156w, mdm-MIR156x, mdm-MIR156y, mdm-MIR156z, mdm-MIR156aa, mdm-MIR156ab, mdm-MIR156ac, mdm-MIR156ad, mdm-MIR156ae, mdm-MIR159a, mdm-MIR159b, mdm-MIR160a, mdm-MIR160b, mdm-MIR160c, mdm-MIR160d, mdm-MIR160e, mdm-MIR162b, mdm-MIR164a, mdm-MIR164b, mdm-MIR164c, mdm-MIR164d, mdm-MIR164e, mdm-MIR164f, mdm-MIR166a, mdm-MIR166b, mdm-MIR166c, mdm-MIR166d, mdm-MIR166e, mdm-MIR166f, mdm-MIR166g, mdm-MIR166h, mdm-MIR166i, mdm-MIR167a, mdm-MIR167b, mdm-MIR167c, mdm-MIR167d, mdm-MIR167e, mdm-MIR167f, mdm-MIR167g, mdm-MIR167h, mdm-MIR167i, mdm-MIR167j, mdm-MIR169a, mdm-MIR169b, mdm-MIR169c, mdm-MIR169d, mdm-MIR171a, mdm-MIR171b, mdm-MIR171c, mdm-MIR171d, mdm-MIR171e, mdm-MIR171f, mdm-MIR171g, mdm-MIR171h, mdm-MIR171i, mdm-MIR171j, mdm-MIR171k, mdm-MIR171l, mdm-MIR171m, mdm-MIR171n, mdm-MIR172a, mdm-MIR172b, mdm-MIR172c, mdm-MIR172d, mdm-MIR172e, mdm-MIR172f, mdm-MIR172g, mdm-MIR172h, mdm-MIR172i, mdm-MIR172j, mdm-MIR172k, mdm-MIR172l, mdm-MIR172m, mdm-MIR172n, mdm-MIR172o, mdm-MIR394a, mdm-MIR394b, mdm-MIR395a, mdm-MIR395b, mdm-MIR395c, mdm-MIR395d, mdm-MIR395e, mdm-MIR395f, mdm-MIR395g, mdm-MIR395h, mdm-MIR395i, mdm-MIR396a, mdm-MIR396b, mdm-MIR396c, mdm-MIR396d, mdm-MIR396e, mdm-MIR396f, mdm-MIR396g, mdm-MIR408a, mdm-MIR482b, mdm-MIR482c, mdm-MIR408b, mdm-MIR408c, mdm-MIR408d, mdm-MIR482d, mdm-MIR159c, mdm-MIR171o, mdm-MIR169e, mdm-MIR169f, sly-MIR164a, sly-MIR164b, sly-MIR394, sly-MIR166c, sly-MIR156d, sly-MIR156e, sly-MIR396a, sly-MIR167b, sly-MIR482d, sly-MIR169e, sly-MIR396b, sly-MIR171e, gma-MIR167k, gma-MIR167l, gma-MIR169w, sly-MIR172c, sly-MIR408, sly-MIR172d, sly-MIR169f, sly-MIR171f, mdm-MIR159d, mdm-MIR159e, mdm-MIR159f, mdm-MIR166j, mdm-MIR395j, mdm-MIR169g, mdm-MIR169h, mdm-MIR169i, mdm-MIR169j, mdm-MIR171p, mdm-MIR395k, mdm-MIR171q, mdm-MIR169k, mdm-MIR169l, mdm-MIR169m, mdm-MIR169n, mdm-MIR172p, mdm-MIR395l, mdm-MIR169o
Noticeably, miR162, miR394 and miR408, which showed low copy number in the other plant species, were not detected in date palm in our analysis. [score:1]
[1 to 20 of 1 sentences]