sort by

8 publications mentioning mes-MIR171d

Open access articles that are associated with the species Manihot esculenta and mention the gene name MIR171d. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 21
In the current study, plant miRNAs from conserved and highly expressed families (e. g miR156, miR160, miR164, miR166, miR169 and miR171) were shown to have potential targets in the genomes of two begomoviruses. [score:5]
Both programs produced identical results for miR171 (a, b, d and f) and miR859, which targeted both AC2 and AC3, and for two miRs (miR472, miR4390) and miR1446a that targeted AC1 and AV1 respectively (Table S8–S9 in File S1). [score:5]
Interestingly, in this study the miR156, miR159, miR160, miR164, miR169, miR170, miR171, miR395 and miR395 were predicted and their expression was detected, which also were found in Jatropha, cassava, Ricinus communis and Hevea brasiliensis in response to abiotic stress, development, transcription factors and metabolism [82]– [87]. [score:4]
The miR171 family was present as 4 members (miR171a, b, d, and f) with differences in nucleotide composition, all targeting AC2 and AC3, and overlapping at positions 1364 or 1366. [score:3]
AC2 and AC3 were targeted by 4 sequences of conserved miR171 (a, b, d, f) family and non-conserved miR859. [score:3]
Furthermore, in cassava, infection by Xanthomonas axonopodis induces the miR160, miR170, miR171 and miR2911 [100]. [score:1]
[1 to 20 of 6 sentences]
2
[+] score: 18
3 could act upon PGP11, a target gene different from the targets of canonical miR171d. [score:5]
Figure 3MiRNA cleavage sites on target genes of miR395, miR394 and half-phased miR171d. [score:3]
In this case, target cleavage of miR171d. [score:3]
2, miR171d. [score:1]
3 specifically occurred in SC124 but not in cold-tolerant C4; that PGP11 was not cleaved by miR171d. [score:1]
Furthermore, 5′ RACE results confirmed that half-phased miRNA-like RNA miR171d. [score:1]
2, miR168.2, miR168.3, miR171d. [score:1]
1), half-phase miRNAs (miR171d. [score:1]
Type miRNA Sequence of RNA-seq Sequence by PCR cloning validation Novel ARF1 TTCTTGACCTTGTAAGACCTT TTCTTGACCTTGTAAGA ∽ Novel ARF2 TTCTTGACCTTGTAAGACCCC TTCTTGACCTTGTAAGACCCC √ Novel D8+ CCATACTTTGAATTGTGGAAG CCATACTTTGAATTGTGGAAG √ Known miR168.1 TCGCTTGGTGCAGGTCGGGAA × Half-phase miR168.2 TGCATCAACTGAATCGGAGAC TGCATCAACTGAATCGGAGAC √ Half-phase miR168.3 TGGATCCCGCCTTGCATCAAC TGGATCCCGCCTTGCATCAAC √ Half-phase miR171d. [score:1]
2 AGATATTGGTGCGGTTCAATC × Half-phase miR171d. [score:1]
[1 to 20 of 10 sentences]
3
[+] score: 15
It was possible to confirm predicted target downregulation for other induced conserved miRNA families, including miR394, miR165 and miR171 which target an F-box family protein, an ATHB transcription factor and a scarecrow-like transcription factor, respectively (Figure 3). [score:8]
In some of these cases (miR171, miRE, miR394, miR197b) target expression decreased at 4 days post-inoculation (dpi) and then increased at 8 dpi, but never reached higher expression values than those without inoculation. [score:7]
[1 to 20 of 2 sentences]
4
[+] score: 9
Other miRNAs from this paper: rco-MIR156a, rco-MIR156b, rco-MIR156c, rco-MIR156d, rco-MIR156e, rco-MIR156f, rco-MIR156g, rco-MIR156h, rco-MIR159, rco-MIR160a, rco-MIR160b, rco-MIR162, rco-MIR164a, rco-MIR164b, rco-MIR164c, rco-MIR164d, rco-MIR166a, rco-MIR166b, rco-MIR166c, rco-MIR166d, rco-MIR166e, rco-MIR167a, rco-MIR167b, rco-MIR167c, rco-MIR168, rco-MIR169a, rco-MIR169b, rco-MIR169c, rco-MIR171a, rco-MIR171b, rco-MIR171c, rco-MIR171d, rco-MIR171e, rco-MIR171f, rco-MIR171g, rco-MIR172, rco-MIR319a, rco-MIR319b, rco-MIR319c, rco-MIR319d, rco-MIR390a, rco-MIR390b, rco-MIR393, rco-MIR395a, rco-MIR395b, rco-MIR395c, rco-MIR395d, rco-MIR395e, rco-MIR396, rco-MIR398a, rco-MIR398b, rco-MIR399a, rco-MIR399b, rco-MIR399c, rco-MIR399d, rco-MIR399e, rco-MIR399f, rco-MIR408, rco-MIR160c, mes-MIR159a, mes-MIR167a, mes-MIR168a, mes-MIR171a, mes-MIR172a, mes-MIR399a, mes-MIR408, mes-MIR156a, mes-MIR156b, mes-MIR156c, mes-MIR156d, mes-MIR156e, mes-MIR156f, mes-MIR156g, mes-MIR156h, mes-MIR156i, mes-MIR156j, mes-MIR156k, mes-MIR159b, mes-MIR159c, mes-MIR159d, mes-MIR160a, mes-MIR160b, mes-MIR160c, mes-MIR160d, mes-MIR160e, mes-MIR160f, mes-MIR160g, mes-MIR160h, mes-MIR162, mes-MIR164a, mes-MIR164b, mes-MIR164c, mes-MIR164d, mes-MIR166a, mes-MIR166b, mes-MIR166c, mes-MIR166d, mes-MIR166e, mes-MIR166f, mes-MIR166g, mes-MIR166h, mes-MIR166i, mes-MIR166j, mes-MIR167b, mes-MIR167c, mes-MIR167d, mes-MIR167e, mes-MIR167f, mes-MIR167g, mes-MIR167h, mes-MIR169a, mes-MIR169b, mes-MIR169c, mes-MIR169d, mes-MIR169e, mes-MIR169f, mes-MIR169g, mes-MIR169h, mes-MIR169i, mes-MIR169j, mes-MIR169k, mes-MIR169l, mes-MIR169m, mes-MIR169n, mes-MIR169o, mes-MIR169p, mes-MIR169q, mes-MIR169r, mes-MIR169s, mes-MIR169t, mes-MIR169u, mes-MIR169v, mes-MIR169w, mes-MIR169x, mes-MIR169y, mes-MIR169z, mes-MIR169aa, mes-MIR169ab, mes-MIR169ac, mes-MIR171b, mes-MIR171c, mes-MIR171e, mes-MIR171f, mes-MIR171g, mes-MIR171h, mes-MIR171i, mes-MIR171j, mes-MIR171k, mes-MIR172b, mes-MIR172c, mes-MIR172d, mes-MIR172e, mes-MIR172f, mes-MIR319a, mes-MIR319b, mes-MIR319c, mes-MIR319d, mes-MIR319e, mes-MIR319f, mes-MIR319g, mes-MIR319h, mes-MIR390, mes-MIR393a, mes-MIR393b, mes-MIR393c, mes-MIR393d, mes-MIR395a, mes-MIR395b, mes-MIR395c, mes-MIR395d, mes-MIR395e, mes-MIR396a, mes-MIR396b, mes-MIR396c, mes-MIR396d, mes-MIR396e, mes-MIR396f, mes-MIR399b, mes-MIR399c, mes-MIR399d, mes-MIR399e, mes-MIR399f, mes-MIR399g, mes-MIR477h, mes-MIR477i, mes-MIR477a, mes-MIR477b, mes-MIR477c, mes-MIR477d, mes-MIR477e, mes-MIR477f, mes-MIR477g, mes-MIR482, mes-MIR828a, mes-MIR828b, mes-MIR171l, mes-MIR398, mes-MIR399h, mes-MIR477j, mes-MIR477k, mes-MIR2118, mes-MIR3627, mes-MIR169ad
As expected, the three TAS3 loci and the targeting miRNA (i. e., miR390), 3 auxin response factors, and auxin signaling F-box genes were targeted by miR167 and miR393 and two GRAS family transcription factors were targets of miR171. [score:7]
Eight known miRNA families – miR156, miR160, miR166, miR171, miR319, miR390, miR395, and miR408 – were evolutionally conserved across the 9 species (Table  2). [score:1]
The miR156, miR171, miR166, and miR169 families constitute the largest miRNA families in Cassava (Table  2), with 11, 11, 11, and 29 members, respectively. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 5
Other miRNAs from this paper: mes-MIR159a, mes-MIR167a, mes-MIR168a, mes-MIR171a, mes-MIR172a, mes-MIR394a, mes-MIR399a, mes-MIR156a, mes-MIR156b, mes-MIR156c, mes-MIR156d, mes-MIR156e, mes-MIR156f, mes-MIR156g, mes-MIR156h, mes-MIR156i, mes-MIR156j, mes-MIR156k, mes-MIR159b, mes-MIR159c, mes-MIR159d, mes-MIR160a, mes-MIR160b, mes-MIR160c, mes-MIR160d, mes-MIR160e, mes-MIR160f, mes-MIR160g, mes-MIR160h, mes-MIR162, mes-MIR164a, mes-MIR164b, mes-MIR164c, mes-MIR164d, mes-MIR166a, mes-MIR166b, mes-MIR166c, mes-MIR166d, mes-MIR166e, mes-MIR166f, mes-MIR166g, mes-MIR166h, mes-MIR166i, mes-MIR166j, mes-MIR167b, mes-MIR167c, mes-MIR167d, mes-MIR167e, mes-MIR167f, mes-MIR167g, mes-MIR167h, mes-MIR169a, mes-MIR169b, mes-MIR169c, mes-MIR169d, mes-MIR169e, mes-MIR169f, mes-MIR169g, mes-MIR169h, mes-MIR169i, mes-MIR169j, mes-MIR169k, mes-MIR169l, mes-MIR169m, mes-MIR169n, mes-MIR169o, mes-MIR169p, mes-MIR169q, mes-MIR169r, mes-MIR169s, mes-MIR169t, mes-MIR169u, mes-MIR169v, mes-MIR169w, mes-MIR169x, mes-MIR169y, mes-MIR169z, mes-MIR169aa, mes-MIR169ab, mes-MIR169ac, mes-MIR171b, mes-MIR171c, mes-MIR171e, mes-MIR171f, mes-MIR171g, mes-MIR171h, mes-MIR171i, mes-MIR171j, mes-MIR171k, mes-MIR172b, mes-MIR172c, mes-MIR172d, mes-MIR172e, mes-MIR172f, mes-MIR319a, mes-MIR319b, mes-MIR319c, mes-MIR319d, mes-MIR319e, mes-MIR319f, mes-MIR319g, mes-MIR319h, mes-MIR394b, mes-MIR394c, mes-MIR396a, mes-MIR396b, mes-MIR396c, mes-MIR396d, mes-MIR396e, mes-MIR396f, mes-MIR397, mes-MIR399b, mes-MIR399c, mes-MIR399d, mes-MIR399e, mes-MIR399f, mes-MIR399g, mes-MIR477h, mes-MIR477i, mes-MIR477a, mes-MIR477b, mes-MIR477c, mes-MIR477d, mes-MIR477e, mes-MIR477f, mes-MIR477g, mes-MIR535a, mes-MIR535b, mes-MIR2950, mes-MIR171l, mes-MIR398, mes-MIR399h, mes-MIR477j, mes-MIR477k, mes-MIR535c, mes-MIR535d, mes-MIR169ad
Many of these targets encode transcription factors; for example, they include the SPL (target of miR156 and miR535), MYB (miR159, miR319 and new-18), HAM3 (miR171), NAC (miR164), ARF (miR160, miR167 and miR169), TCP (miR319), GRF (miR396 and miR477) and SIGMA (new-11) genes. [score:5]
[1 to 20 of 1 sentences]
6
[+] score: 4
Other miRNAs from this paper: mes-MIR159a, mes-MIR167a, mes-MIR168a, mes-MIR171a, mes-MIR172a, mes-MIR399a, mes-MIR408, mes-MIR156a, mes-MIR156b, mes-MIR156c, mes-MIR156d, mes-MIR156e, mes-MIR156f, mes-MIR156g, mes-MIR156h, mes-MIR156i, mes-MIR156j, mes-MIR156k, mes-MIR159b, mes-MIR159c, mes-MIR159d, mes-MIR160a, mes-MIR160b, mes-MIR160c, mes-MIR160d, mes-MIR160e, mes-MIR160f, mes-MIR160g, mes-MIR160h, mes-MIR162, mes-MIR164a, mes-MIR164b, mes-MIR164c, mes-MIR164d, mes-MIR166a, mes-MIR166b, mes-MIR166c, mes-MIR166d, mes-MIR166e, mes-MIR166f, mes-MIR166g, mes-MIR166h, mes-MIR166i, mes-MIR166j, mes-MIR167b, mes-MIR167c, mes-MIR167d, mes-MIR167e, mes-MIR167f, mes-MIR167g, mes-MIR167h, mes-MIR169a, mes-MIR169b, mes-MIR169c, mes-MIR169d, mes-MIR169e, mes-MIR169f, mes-MIR169g, mes-MIR169h, mes-MIR169i, mes-MIR169j, mes-MIR169k, mes-MIR169l, mes-MIR169m, mes-MIR169n, mes-MIR169o, mes-MIR169p, mes-MIR169q, mes-MIR169r, mes-MIR169s, mes-MIR169t, mes-MIR169u, mes-MIR169v, mes-MIR169w, mes-MIR169x, mes-MIR169y, mes-MIR169z, mes-MIR169aa, mes-MIR169ab, mes-MIR169ac, mes-MIR171b, mes-MIR171c, mes-MIR171e, mes-MIR171f, mes-MIR171g, mes-MIR171h, mes-MIR171i, mes-MIR171j, mes-MIR171k, mes-MIR172b, mes-MIR172c, mes-MIR172d, mes-MIR172e, mes-MIR172f, mes-MIR319a, mes-MIR319b, mes-MIR319c, mes-MIR319d, mes-MIR319e, mes-MIR319f, mes-MIR319g, mes-MIR319h, mes-MIR390, mes-MIR393a, mes-MIR393b, mes-MIR393c, mes-MIR393d, mes-MIR395a, mes-MIR395b, mes-MIR395c, mes-MIR395d, mes-MIR395e, mes-MIR396a, mes-MIR396b, mes-MIR396c, mes-MIR396d, mes-MIR396e, mes-MIR396f, mes-MIR397, mes-MIR399b, mes-MIR399c, mes-MIR399d, mes-MIR399e, mes-MIR399f, mes-MIR399g, mes-MIR482, mes-MIR535a, mes-MIR535b, mes-MIR827, mes-MIR2275, mes-MIR171l, mes-MIR398, mes-MIR399h, mes-MIR2118, mes-MIR535c, mes-MIR535d, mes-MIR169ad
Twenty-one miRNA families (miR156, miR159, miR160, miR162, miR164, miR166-169, miR171, miR172, miR319, miR390, miR393-399, and miR408) seem to be universally expressed among diverse plant species (Fig 8). [score:3]
Eight miRNA families (miR156, miR159/319, miR160, miR166, miR171, miR408, miR390/391, and miR395) have been identified in the common ancestor of all embryophytes. [score:1]
[1 to 20 of 2 sentences]
7
[+] score: 3
Similarly, the polycistronic precursor of miR171 was used to produce three amiRNAs that targeted conserved segments in the Wheat dwarf mastrevirus (WDV) genome (Kis et al., 2016). [score:3]
[1 to 20 of 1 sentences]
8
[+] score: 2
Other miRNAs from this paper: mes-MIR159a, mes-MIR167a, mes-MIR171a, mes-MIR156a, mes-MIR156b, mes-MIR156c, mes-MIR156d, mes-MIR156e, mes-MIR156f, mes-MIR156g, mes-MIR156h, mes-MIR156i, mes-MIR156j, mes-MIR156k, mes-MIR160a, mes-MIR160b, mes-MIR160c, mes-MIR160d, mes-MIR160e, mes-MIR160f, mes-MIR160g, mes-MIR160h, mes-MIR166a, mes-MIR166b, mes-MIR166c, mes-MIR166d, mes-MIR166e, mes-MIR166f, mes-MIR166g, mes-MIR166h, mes-MIR166i, mes-MIR166j, mes-MIR167b, mes-MIR167c, mes-MIR167d, mes-MIR167e, mes-MIR167f, mes-MIR167g, mes-MIR167h, mes-MIR169a, mes-MIR169b, mes-MIR169c, mes-MIR169d, mes-MIR169e, mes-MIR169f, mes-MIR169g, mes-MIR169h, mes-MIR169i, mes-MIR169j, mes-MIR169k, mes-MIR169l, mes-MIR169m, mes-MIR169n, mes-MIR169o, mes-MIR169p, mes-MIR169q, mes-MIR169r, mes-MIR169s, mes-MIR169t, mes-MIR169u, mes-MIR169v, mes-MIR169w, mes-MIR169x, mes-MIR169y, mes-MIR169z, mes-MIR169aa, mes-MIR169ab, mes-MIR169ac, mes-MIR171b, mes-MIR171c, mes-MIR171e, mes-MIR171f, mes-MIR171g, mes-MIR171h, mes-MIR171i, mes-MIR171j, mes-MIR171k, mes-MIR319f, mes-MIR390, mes-MIR393a, mes-MIR393b, mes-MIR393c, mes-MIR393d, mes-MIR395a, mes-MIR395b, mes-MIR395c, mes-MIR395d, mes-MIR395e, mes-MIR477h, mes-MIR477i, mes-MIR477a, mes-MIR477b, mes-MIR477c, mes-MIR477d, mes-MIR477e, mes-MIR477f, mes-MIR477g, mes-MIR482, mes-MIR530b, mes-MIR535a, mes-MIR535b, mes-MIR828a, mes-MIR828b, mes-MIR171l, mes-MIR390b, mes-MIR397b, mes-MIR398, mes-MIR399h, mes-MIR477j, mes-MIR477k, mes-MIR2118, mes-MIR482b, mes-MIR482d, mes-MIR535c, mes-MIR535d, mes-MIR1446b, mes-MIR6445, mes-MIR9386, mes-MIR169ad, mes-MIR11891, mes-MIR11892
Correspondingly, phasiRNAs produced by members of the mes-miR171 family directing cleavage of Scarecrow transcription factor-encoding PHAS loci (an example is chr4065:15455.. [score:2]
[1 to 20 of 1 sentences]