sort by

1 publications mentioning ipu-mir-7569

Open access articles that are associated with the species Ictalurus punctatus and mention the gene name mir-7569. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

[+] score: 4
Other miRNAs from this paper: dre-mir-181b-1, dre-mir-181b-2, dre-mir-181a-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-16b, dre-mir-16c, dre-mir-29a, dre-mir-101a, dre-mir-144, dre-mir-153b, dre-mir-181c, dre-mir-462, dre-mir-457b, dre-let-7j, dre-mir-181a-2, dre-mir-1388, dre-mir-7147, ipu-let-7a-7, ipu-let-7a-1, ipu-let-7a-3, ipu-let-7a-5, ipu-let-7a-6, ipu-let-7a-4, ipu-let-7a-2, ipu-let-7b-2, ipu-let-7b-1, ipu-let-7c-1, ipu-let-7c-2, ipu-let-7d-2, ipu-let-7d-1, ipu-let-7e-2, ipu-let-7e-1, ipu-let-7f, ipu-let-7g-1, ipu-let-7g-2, ipu-let-7h, ipu-let-7i, ipu-let-7j-1, ipu-let-7j-2, ipu-mir-101a, ipu-mir-1388, ipu-mir-144, ipu-mir-153b, ipu-mir-16b, ipu-mir-181a-1, ipu-mir-181a-2, ipu-mir-181a-3, ipu-mir-181a-4, ipu-mir-181a-5, ipu-mir-181b-2, ipu-mir-181b-1, ipu-mir-181c, ipu-mir-462, ipu-mir-9-4, ipu-mir-9-2, ipu-mir-9-6, ipu-mir-9-1, ipu-mir-9-3, ipu-mir-9-7, ipu-mir-9-5, ipu-mir-7147, ipu-mir-29a, ipu-mir-16c, ipu-mir-203c, ipu-mir-129b, ipu-mir-7553, ipu-mir-7556, ipu-mir-7562, ipu-mir-7568, ipu-mir-7570, ipu-mir-7571, ipu-mir-7572, ipu-mir-7573, ipu-mir-7574, ipu-mir-7575, ipu-mir-7576, ipu-mir-7577, ipu-mir-457b, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d
1|CV991851∶94.162:+ ipu- miR-7568 cugaccgaccaagugcugaau 4 gi|204080548|gb|FD371264.1|FD371264∶583.636: − ipu- miR-7569 uauaaucuugauguuucucca 26 gi|40572877|gb|CK412282.1|CK412282∶114.188:+ ipu- miR-7570 uucuuaugugcgccggcacucu 2 gi|118496311|gb|EE993615.2|EE993615∶401.459:+ ipu- miR-7571 caggcuacaugacaccacccuga 30 gi|18393650|gb|BM425126.1|BM425126∶50.110:+ ipu- miR-7572 gauugcagcuuuacaguguuucc 3 gi|200944081|gb|FD030799.1|FD030799∶333.394: − ipu- miR-7573 aggcugagccugauggcacugag 2 gi|204132990|gb|FD262187.1|FD262187∶225.297:+ ipu- miR-7574 uuuaucucuacucgcucgucu 9 gi|204025299|gb|FD323591.1|FD323591∶204.260: − ipu- miR-7575 gcauggucaugaucaugguc 2 gi|30224238|gb|CB938847.1|CB938847∶656.706:+ ipu- miR-7576 agaacauucaaccgccgcaca 2 gi|204187343|gb|FD336486.1|FD336486∶198.251:+ ipu- miR-7577 cucggacauuuuggacucgga 14 gi|204280683|gb|FD352971.1|FD352971∶10.55: − ipu- miR-457b uagcagcacaucaauauuggca 2288 gi|281572797|gb|FI880023.1|FI880023∶146.211: − Generally speaking, abundant miRNAs play fundamental and broad regulatory functions in maintaining biological processes. [score:2]
1|CV991851∶94.162:+ ipu- miR-7568 cugaccgaccaagugcugaau 4 gi|204080548|gb|FD371264.1|FD371264∶583.636: − ipu- miR-7569 uauaaucuugauguuucucca 26 gi|40572877|gb|CK412282.1|CK412282∶114.188:+ ipu- miR-7570 uucuuaugugcgccggcacucu 2 gi|118496311|gb|EE993615.2|EE993615∶401.459:+ ipu- miR-7571 caggcuacaugacaccacccuga 30 gi|18393650|gb|BM425126.1|BM425126∶50.110:+ ipu- miR-7572 gauugcagcuuuacaguguuucc 3 gi|200944081|gb|FD030799.1|FD030799∶333.394: − ipu- miR-7573 aggcugagccugauggcacugag 2 gi|204132990|gb|FD262187.1|FD262187∶225.297:+ ipu- miR-7574 uuuaucucuacucgcucgucu 9 gi|204025299|gb|FD323591.1|FD323591∶204.260: − ipu- miR-7575 gcauggucaugaucaugguc 2 gi|30224238|gb|CB938847.1|CB938847∶656.706:+ ipu- miR-7576 agaacauucaaccgccgcaca 2 gi|204187343|gb|FD336486.1|FD336486∶198.251:+ ipu- miR-7577 cucggacauuuuggacucgga 14 gi|204280683|gb|FD352971.1|FD352971∶10.55: − ipu- miR-457b uagcagcacaucaauauuggca 2288 gi|281572797|gb|FI880023.1|FI880023∶146.211: −Generally speaking, abundant miRNAs play fundamental and broad regulatory functions in maintaining biological processes. [score:2]
[1 to 20 of 2 sentences]