sort by

200 publications mentioning mmu-mir-126b (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name mir-126b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 457
Other miRNAs from this paper: mmu-mir-126a, rno-mir-126a, rno-mir-126b
Compared with the adjacent normal tissues, the miR-126 expression in HCC tissues was downregulated while EGFL7 and ERK mRNA expressions were upregulated (all P < 0.05), indicating low miR-126 expression and high EGFL7 and ERK expressions might promote the risk of HCC. [score:14]
In the miR-126 inhibitors group, the miR-126 expression and Fas/FasL and Caspase3 mRNA expressions were evidently downregulated while EGFL7, ERK, and Bcl-2 mRNA expressions were markedly upregulated when compared with the blank group (all P < 0.05). [score:14]
Three transfected cell lines (HepG2, Bet-7402 and smmc-7721) were separately divided into the blank group (without transfection), the miR-126 mimics group (transfected with miR-126 mimics plasmid), the miR-126 inhibitors group (transfected with miR-126 inhibitors plasmid), the miR-126 inhibitors + si-EGFL7 group (transfected with miR-126 inhibitors + si-EGFL7 plasmid), the mimics control group (transfected with miR-126 mimics NC plasmid), and the inhibitors control group (transfected with miR-126 inhibitors NC plasmid). [score:13]
Rats injected with the same cell line were assigned into six groups (8 mice in each group): the blank group (injection of cells without transfected plasmids); the miR-126 mimics group (injection of cells being transfected with miR-126 mimics plasmid); the miR-126 inhibitors group (injection of cells being transfected with miR-126 inhibitors plasmid); the miR-126 inhibitors + siRNA EGFL7 group (injection of cells being transfected with miR-126 inhibitors + siRNA EGFL7 plasmids); the mimics control group (injection of cells being transfected with miR-126 mimics NC plasmid); and the inhibitors control group (injection of cells being transfected with miR-126 inhibitors NC plasmid). [score:13]
Compared with the blank group,, Fas/FasL and Caspase3 protein expressions were decreased, and EGFL7, ERK, P-ERK, Bcl-2 protein expressions were significantly increased in the miR-126 inhibitors group (all P < 0.05), suggesting that the low EGFL7 expression inhibited the activation of the ERK signaling pathway, promoting the expression of pro-apoptotic factors and HCC cell apoptosis [20]. [score:12]
the proliferation of smmc-7721 cells among the blank, miR-126 mimics, miR-126 inhibitors, miR-126 inhibitors + siRNA EGFL7, mimics control and inhibitors control groups after transfection; * P < 0.05 compared with the blank group; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7. After three HCC cell lines (smmc-7721, Bet-7402, and HepG2) were transfected with the recombinant plasmids, the apoptosis rate of HCC cells was significantly increased in the miR-126 mimics group and that of HCC cells was reduced in the miR-126 inhibitors group compared with the blank group, indicating that miR-126 overexpression could induce the apoptosis of HCC cells (Figure 7). [score:9]
, Hercules, CA, USA) was applied to analyze miR-126 expression and expressions of EGFL7 and ERK mRNAs in HCC tissues and adjacent normal tissues as well as the miR-126 expression and expressions of EGFL7, ERK, Fas/FasL, Bcl-2, and Caspase-3 mRNAs in the transfected cells. [score:9]
Therefore, the miR-126 overexpression and inhibition of EGFL7 expression might suppress the proliferation ability of tumor cells in vivo. [score:9]
These results indicated that miR-126 overexpression and inhibition of EGFL7 expression could suppress the proliferation of HCC cells. [score:9]
Our initial results revealed that miR-126 is significantly downregulated, while the mRNA and protein expression of EGFL7 and ERK are upregulated in HCC tissues. [score:9]
miR-126 overexpression inhibited expressions of EGFL7, ERK, P-ERK, angiogenesis -associated proteins VEGF, and CD31 in HCC cells in vivoThe EGFL7 expression was the highest in smmc-7721 cells in vivo, and lowest in HepG2 cells among three HCC cells lines which was transfected with recombinant plasmids (Figure 9). [score:9]
Compared with the blank group, no significant difference was observed in the miR-126 expression and expressions of EGFL7, ERK, Fas/FasL, Bcl-2 and Caspase3 mRNAs in the miR-126 inhibitors + si-EGFL7, mimics control and inhibitors control groups (all P > 0.05). [score:8]
In the miR-126 mimics group, the miR-126 expression and Fas/FasL and Caspase3 mRNA expressions were significantly increased and the EGFL7, ERK, and Bcl-2 mRNA expressions were notably decreased in comparison to the blank group (all P > 0.05). [score:7]
Comparison of cell proliferation among the blank, miR-126 mimics, miR-126 inhibitors, miR-126 inhibitors + siRNA EGFL7, mimics control, and inhibitors control groups after transfection. [score:7]
miR-126 overexpression inhibited expressions of EGFL7, ERK, P-ERK, angiogenesis -associated proteins VEGF, and CD31 in HCC cells in vivo. [score:7]
the proliferation of HepG2 cells among the blank, miR-126 mimics, miR-126 inhibitors, miR-126 inhibitors + siRNA EGFL7, mimics control and inhibitors control groups after transfection; (B). [score:7]
No significant difference was observed in EGFL7, ERK, P-ERK, VEGF, and CD31 protein expressions among the blank, miR-126 inhibitors + si-EGFL7, mimics control and inhibitors control groups (all P > 0.05). [score:7]
the proliferation of Bet-7402 cells among the blank, miR-126 mimics, miR-126 inhibitors, miR-126 inhibitors + siRNA EGFL7, mimics control and inhibitors control groups after transfection; (C). [score:7]
Comparisons of cell apoptosis among the blank, miR-126 mimics, miR-126 inhibitors, miR-126 inhibitors + siRNA EGFL7, mimics control and inhibitors control groups in smmc-7721, Bet-7402, and HepG2 cell lines after transfection (× 400). [score:7]
Tumor growth curves of nude mice transplanted with smmc-7721, Bet-7402 and HepG2 cell lines in the blank, miR-126 mimics, miR-126 inhibitors, miR-126 inhibitors + siRNA EGFL7, mimics control and inhibitors control groups. [score:7]
MiR-126 expression is downregulated in human cancers, reducing its ability to suppress the proliferative and invasive capacities of cancer cells, such as lung cancer, osteosarcoma, oral cancer and so on [11, 12, 21]. [score:7]
These results showed that miR-126 overexpression could reduce the expression of ERK, P-ERK and angiogenesis -associated proteins, inhibiting tumor angiogenesis and tumor growth. [score:7]
Compared with the blank group, no significant difference was observed in the expressions of EGFL7, ERK, P-ERK, Bcl-2 Fas/FasL and Caspase3 proteins in the miR-126 inhibitors + si-EGFL7, mimics control, and inhibitors control groups (all P > 0.05). [score:6]
To conclude, our study shows that miR-126 is downregulated in HCC tissues and that elevated miR-126 decreases proliferation and induces apoptosis in the HCC cells and inhibits angiogenesis. [score:6]
the proliferation of smmc-7721 cells among the blank, miR-126 mimics, miR-126 inhibitors, miR-126 inhibitors + siRNA EGFL7, mimics control and inhibitors control groups after transfection; * P < 0.05 compared with the blank group; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7. (A). [score:6]
Moreover, overexpression of miR-126 inhibits angiogenesis triggered by the HCC cells. [score:5]
miR-126 serves as a tumor suppressor, inhibiting cell proliferation and inducing cell apoptosis in HCC [14]. [score:5]
No significant difference was observed in the proliferation of HCC cells in the miR-126 inhibitors + si-EGFL7, mimics control and inhibitors control groups in comparison to the blank group (all P > 0.05). [score:5]
A mechanism of miR-126 targeting EGFL7 to inhibit cell proliferation has also been confirmed by Sun et al. in non-small cell lung cancer [25]. [score:5]
Therefore, the miR-126 overexpression could inhibit tumor angiogenesis. [score:5]
miR-126 overexpression suppressed the proliferation of HCC cells. [score:5]
comparisons of miR-126 expression and EGFL7, ERK, Fas/FasL, Bcl-2, and Caspase-3 mRNA expressions in HepG2 cells among the six groups; (C). [score:5]
And then these three cell lines were separately transfected with recombinant plasmids (pLEGFP-N1-miR-126 mimic, pLEGFP-N1-miR-126 inhibitor, pLEGFP-N1-miR-126 mimic NC, pLEGFP-N1-miR-126 inhibitor NC or pLEGFP-N1-si EGFL7) using Lipofectamine 2000 and then incubated in an incubator containing 5% CO [2] at 37°C for 6 h. Next, cells were cultured with fresh medium containing 10% fetal bovine serum (FBS) for 48 h. Subsequently, cells were collected and washed with phosphate buffered saline (PBS) 3 times. [score:5]
EGFL7, ERK, P-ERK, VEGF, and CD31 protein expressions were decreased in the miR-126 mimics group, but these were significantly elevated in the miR-126 inhibitors group relative to the blank group (all P < 0.05). [score:5]
HepG2, Bet-7402, and smmc-7721 cells were transfected with recombinant plasmids (pLEGFP-N1-miR-126 mimic, pLEGFP-N1-miR-126 inhibitor, pLEGFP-N1-miR-126 mimic NC, pLEGFP-N1-miR-126 inhibitor NC, or pLEGFP-N1-si EGFL7). [score:5]
The transfection efficiency of recombinant plasmids pLEGFP-N1-miR-126 mimic, pLEGFP-N1-miR-126 inhibitor, pLEGFP-N1-miR-126 mimic NC, pLEGFP-N1-miR-126 inhibitor NC and pLEGFP-N1-si EGFL7 determined by flow cytometry. [score:5]
comparison of miR-126 expression and EGFL7, ERK, Fas/FasL, Bcl-2, and Caspase-3 mRNA expressions in Bet-7402 cells among the six groups; (D). [score:5]
miR-126 expression and EGFL7, ERK, Fas/FasL, Bcl-2, and Caspase-3 mRNA expression in HCC tissues, adjacent normal tissues, and transfected HCC cell lines. [score:5]
The miR-126 mimics group exhibited markedly higher Fas/FasL and Caspase3 protein expressions and lower EGFL7, ERK, P-ERK, and Bcl-2 protein expressions than the blank group (all P > 0.05). [score:5]
Human mature miR-126 mimics, miR-126 inhibitors, miR-126 mimics control, and miR-126 inhibitors control were purchased from Biomics Biotechnologies Co. [score:5]
Therefore, the corresponding recombinant plasmids including pLEGFP-N1-miR-126 mimic, pLEGFP-N1-miR-126 inhibitor, pLEGFP-N1-miR-126 mimic negative control (NC), pLEGFP-N1-miR-126 inhibitor NC, and pLEGFP-N1-si EGFL7. [score:5]
Zhao et al. have also demonstrated that the high miR-126 expression can inhibit cell proliferation, arrest cell cycle progress, and induce apoptosis in HCC cells [14], which is consistent with our study. [score:5]
No significant difference in the number of new blood vessels was observed among the blank, miR-126 inhibitors + si-EGFL7, mimics control, and inhibitors control groups (all P > 0.05). [score:5]
The proliferation of HCC cells might be enhanced when miR-126 expression was suppressed. [score:5]
comparisons of miR-126 expression and EGFL7 and ERK mRNA expression between the HCC tissues and adjacent normal tissues; (B). [score:5]
comparisons of miR-126 expression and EGFL7, ERK, Fas/FasL, Bcl-2 and Caspase-3 mRNA expressions in smmc-7721 cells among the six groups; [#] P < 0.05 compared with adjacent normal tissues; * P < 0.05 compared with the blank group; HCC, hepatocellular carcinoma; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7; ERK, extracellular signal-regulated kinase; FASL, FAS ligand; Bcl-2, B cell leukemia/lymphoma-2. (A). [score:4]
EGFL7: the direct target gene of miR-126. [score:4]
Moreover, miR-126 could reduce cell proliferation and tumor angiogenesis of HCC via decreasing EGFL7 expression [26], which is similar to our results, but the negative regulation of miR-126 on ERK signaling pathway was not involved. [score:4]
comparisons of miR-126 expression and EGFL7, ERK, Fas/FasL, Bcl-2 and Caspase-3 mRNA expressions in smmc-7721 cells among the six groups; [#] P < 0.05 compared with adjacent normal tissues; * P < 0.05 compared with the blank group; HCC, hepatocellular carcinoma; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7; ERK, extracellular signal-regulated kinase; FASL, FAS ligand; Bcl-2, B cell leukemia/lymphoma-2. Figure 3(A). [score:4]
The effects of miR-126 on HCC cells may be achieved by targeting EGFL7 and down -regulating the ERK signaling pathway. [score:4]
miR-126 is dysregulated in many human cancers, modulating the proliferation, migration, and invasion of cancer cells in conjunction with various target genes [11– 13]. [score:4]
The results indicated that EGFL7 was the direct target gene of miR-126. [score:4]
Further experiments indicated that the function of miR-126 in HCC is achieved by targeting EGFL7 and subsequently regulating of the ERK signaling pathway. [score:4]
The mice were sacrificed after three weeks, and no significant difference was observed in tumor volume and weight of the miR-126 inhibitors + si-EGFL7, mimics control and inhibitors control groups compared with the blank group (all P > 0.05). [score:4]
comparisons of miR-126 expression and EGFL7, ERK, Fas/FasL, Bcl-2 and Caspase-3 mRNA expressions in smmc-7721 cells among the six groups; [#] P < 0.05 compared with adjacent normal tissues; * P < 0.05 compared with the blank group; HCC, hepatocellular carcinoma; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7; ERK, extracellular signal-regulated kinase; FASL, FAS ligand; Bcl-2, B cell leukemia/lymphoma-2. Figure 3(A). [score:4]
Our study also demonstrates that overexpressed miR-126 decreases cell proliferation and induces cell apoptosis in HCC cells. [score:3]
Additionally, De Giorgio et al. have reported the loss of miR-126 may enhance angiogenesis through target specific proangiogenic factors at the in situ to invasive tumor transition, which could further prove our results [35]. [score:3]
The tumor weight in the miR-126 mimics group was decreased and the tumor weight in the miR-126 inhibitors group was evidently increased than that in the blank group (Table 3). [score:3]
Wong et al. have found that miR-126 is significantly decreased in patients carrying hepatitis B and C virus, and lower miR-126 expression predicts poor survival and tumor recurrence for HCC patients after surgery [22]. [score:3]
miR-126 overexpression induced tumor angiogenesis of HCC cells in vivoThe number of new blood vessels was the highest in the nude mice transplanted with smmc-7721 cells, and that was lowest in the nude mice transplanted with HepG2 cells among the three HCC cell lines which were transfected with recombinant plasmids (Table 3). [score:3]
However, the full understanding of miR-126 with ERK signaling in HCC is still uncertain, and more researches are still required to identify and effective targeted treatment for HCC. [score:3]
In this study, we showed that miR-126 was significantly reduced in HCC tissues, and the elevation of miR-126 could decrease cell proliferation, induce cell apoptosis, and inhibit angiogenesis in HCC cells. [score:3]
miR-126 expression was negatively correlated with EGFL7 and ERK levels in HCC tissues and cell lines. [score:3]
The levels of ERK and Bcl-2 mRNA and protein were elevated in the miR-126 inhibitors group, while those of Fas/FasL and Caspase-3 were reduced. [score:3]
miR-126 overexpression reduced the proliferation of HCC cells in vivoThe subcutaneous tumor volume in nude mice was gradually increased three days after transplantation. [score:3]
miR-126 overexpression promoted the apoptosis of HCC cells. [score:3]
These results showed that miR-126 expression was negatively correlated with EGFL7 and ERK (Figures 2, 3). [score:3]
The proliferation ability of tumor cells might be enhanced by the inhibition of miR-126. [score:3]
Additionally, our study has indicated that EGFL7 is the target gene of miR-126. [score:3]
EGFL7, ERK, P-ERK, VEGF and CD31 protein expression in smmc-7721 cells in vivo; * P < 0.05 compared with the blank group; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7; ERK, extracellular signal-regulated kinase; P-ERK, phosphorylated ERK; VEGF, vascular endothelial growth factor. [score:3]
EGFL7, ERK, VEGF, and CD31 protein levels are reduced in the miR-126 mimics group, while EGFL7, ERK, P-ERK, VEGF, and CD31 protein are increased in the miR-126 inhibitors group. [score:3]
Among three HCC cell lines (HepG2, Bet-7402 and smmc-7721), the lowest miR-126 expression was observed in smmc-7721 cells, and the highest in HepG2 cells. [score:3]
MiR-126 overexpression using miR-126 mimics could significantly reduce the phosphorylation of ERK protein [24]. [score:3]
Saito et al. reported that miR-126 is situated within the gene for epidermal growth factor-like domain 7 (EGFL7), which is highly expressed in vascularized tissues and endothelial cells and acts as an important gene in angiogenesis [15]. [score:3]
The miR-126 mimics group had markedly less new blood vessels and that in the miR-126 inhibitors group exhibited significantly more new blood vessels than the blank group (both P < 0.05). [score:3]
The miR-126 inhibitors group exhibited the strongest tumor formation ability with faster tumor cell growth and the miR-126 mimics group had the weakest tumor formation ability with slower tumor cell growth among the six groups (Figure 8). [score:3]
miR-126 overexpression induced tumor angiogenesis of HCC cells in vivo. [score:3]
miR-126 overexpression reduced the proliferation of HCC cells in vivo. [score:3]
The targeting gene (EGFL7) of miR-126 was predicted using microRNA. [score:3]
Identification of miR-126 targeting EGFL7. [score:3]
r, correlated coefficient; r > 0, positive correlation; r < 0, negative correlation; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7; ERK, extracellular signal-regulated kinase; HCC, hepatocellular carcinoma. [score:2]
the luciferase activity at 48 h after the HepG2 cells were transfected with EGFL7-3′UTR-WT + NC, EGFL7-3′UTR-WT + miR-126, EGFL7-3′UTR-MUT + NC and EGFL7-3′UTR-MUT + miR-126; * P < 0.05 compared with cells transfected with EGFL7-3′UTR-WT + NC, EGFL7-3′UTR-MUT + NC or EGFL7-3′UTR-MUT + miR-126; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7; NC, negative control; 3′UTR, 3′ untranslated region; WT, wide type; MUT, mutant type. [score:2]
The target gene of miR-126 was identified with dual-luciferase reporter assay. [score:2]
Compared with the blank group, the proliferation of HCC cells in the miR-126 mimics group was decreased while that of HCC cells in the miR-126 inhibitors group was increased significantly (both P < 0.05). [score:2]
comparisons of the expressions of EGFL7, ERK, P-ERK, Fas/FasL, Bcl-2 and Caspase-3 proteins in smmc-7721 cells among the six group; [#] P < 0.05 compared with adjacent normal tissues; * P < 0.05 compared with the blank group; HCC, hepatocellular carcinoma; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7; ERK, extracellular signal-regulated kinase. [score:2]
Note: DAPI dye cell nucleus was blue; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7; DAPI, 4′-6-diamidino-2-phenylindole. [score:1]
A. transfection efficiency of recombinant plasmids in HepG2 cells; B. transfection efficiency of recombinant plasmids in Bet-7402 cells; C. transfection efficiency of recombinant plasmids in smmc-7721 cells; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7; NC, negative control. [score:1]
Meanwhile, cells co -transfected with EGFL7-3′UTR-WT and NC plasmids (EGFL7-3′UTR-WT + NC) and with EGFL7-3′UTR-MUT and miR-126 mimic plasmids (EGFL7-3′UTR-MUT + miR-126) as controls. [score:1]
the binding site of miR-126 and EGFL7 in the 3′UTR; (B). [score:1]
Figure 7 Note: DAPI dye cell nucleus was blue; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7; DAPI, 4′-6-diamidino-2-phenylindole. [score:1]
correlation analysis of miR-126, EGFL7, and ERK in HCC tissues and adjacent normal tissues. [score:1]
Figure 1 A. transfection efficiency of recombinant plasmids in HepG2 cells; B. transfection efficiency of recombinant plasmids in Bet-7402 cells; C. transfection efficiency of recombinant plasmids in smmc-7721 cells; miR-126, microRNA-126; EGFL7, epidermal growth factor-like domain 7; NC, negative control. [score:1]
miR-126 had no effect on cell cycle distribution of HCC cells. [score:1]
org predicted that miR-126 was located in the introns 6 and 7 in the 3′-UTR of EGFL7 and could bind to the 3′-UTR of EGFL7 mRNA. [score:1]
We found that ERK and Bcl-2 mRNA and protein levels are significantly reduced in the miR-126 mimics group, while those of Fas/FasL and Caspase-3 are increased. [score:1]
correlation analysis of miR-126 and ERK in adjacent normal tissues; (B), correlation analysis of miR-126 and EGFL7 in adjacent normal tissues; (C), correlation analysis of miR-126 and ERK in HCC tissues; (D), correlation analysis of miR-126 and EGFL7 in HCC tissues. [score:1]
HEPG2 cells in logarithmic phase were seeded into 96-well plates, and co -transfected with EGFL7-3′UTR-WT and miR-126 mimic plasmids (EGFL7-3′UTR-WT + miR-126) using Lipofectamine 2000 when the cell density was about 70%. [score:1]
Our study aims to explore the potential mechanism of miR-126 affecting cell proliferation, apoptosis, and angiogenesis in HCC via mediating EGFL7 and the ERK signaling pathway. [score:1]
MiR-126 is situated in an intron of EGFL7, and miR-126 could be generated by 3 different transcripts on EGFL7 [15]. [score:1]
The fragment of EGFL7 gene containing miR-126 binding sites in 3′-UTR region was inserted into dual-luciferase reporter vector to construct recombinant wild-type plasmid (EGFL7-3′UTR-WT) and mutant-type plasmid (EGFL7-3′UTR-MUT). [score:1]
HepG2 cells were co -transfected with EGFL7-3′UTR-WT and miR-126 mimic plasmids. [score:1]
[1 to 20 of 101 sentences]
2
[+] score: 332
Other miRNAs from this paper: mmu-mir-126a
MIR126 induces PDK down-regulation, which in conjunction with ACL inhibition paradoxically inhibits PDH, possibly due to the high level of NADH and citrate/pyruvate in mitochondrial matrix. [score:8]
In tumour cells, MIR126 alters a number of cellular functions via suppressing translation of different target genes [9]. [score:7]
Therefore, not autophagy, but direct HIF1α regulation, for example via hypoxia-inducible protein 2 (HIG2) which is a down-stream target of HIF1α implicated in LD biogenesis [35], is responsible for LD formation upon MIR126 expression. [score:7]
Figure 3 MIR126 induces GLUT-4 expression and inhibits glucose uptake MIR126 -transfected Met5A, H28 and IstMes2 cells and their empty plasmid -transfected counterparts were evaluated for GLUT-4 expression by WB A. and its cell surface expression by flow cytometry B, C. was evaluated over time by 2-NBDG (50 μM) in low-glucose DMEM without and with insulin stimulus, and expressed as mean fluorescent intensity (MFI). [score:7]
Figure 9Proposed mo del of MIR126 in regulating autophagy and cell proliferation MIR126 targets the expression of IRS1 resulting in the insulin signaling pathway disruption. [score:6]
Collectively, these results indicate that MIR126 expression upregulates autophagic flux in MM cells but not in their non-malignant counterparts. [score:6]
Similarly, MIR126 was found to suppress tumours by directly targeting the insulin receptor substrate-1 (IRS1) [12– 14] and the disintegrin- and metalloproteinase domain-containing protein-9 (ADAM9) [15]. [score:6]
Inhibition of ACL by MIR126 contributes to citrate accumulation in cytosol, inducing HIF1α activation and stabilization, leading to GLUT-4 upregulation. [score:6]
Down-regulation of IRS1 by MIR126 or silencing of IRS1 reduced the LC3II/LC3I ratio as a result of high autophagic activity, which was reversed by IRS1 overexpression (cf Figure 2). [score:6]
MIR126 overexpression led to significant upregulation of SQSTM1 in MM cells, while BECN1 did not show significant changes (Figure 1C). [score:6]
Overexpression of IRS1 inhibited AV formation and induced LC3II accumulation in MIR126 transfected cells. [score:5]
Cells (2×10 [5]) were stably transfected with 1 μg of the pCMV-MiR and/or pRS (OriGene) empty plasmid or with plasmid carrying the MIR126 sequence 5′-UCG UAC CGU GAG UAA UAA UGC G-3′ (OriGene, Rockville, MD) and/or shRNA pRS plasmid, with the HIF1α -targeting sequence of 5′-ACA AGA ACC TAC TGC TAA TGC CAC CAC TA-3′, and with the acetyl-CoA citrate lyase (ACL) -targeting sequence of 5′-CCA TCA CTG AGG TCT TCA AGG AAG AGA TG-3′, using the TransIT-LT1 reagent (Mirus). [score:5]
MIR126, siRNA and transfectionsCells (2×10 [5]) were stably transfected with 1 μg of the pCMV-MiR and/or pRS (OriGene) empty plasmid or with plasmid carrying the MIR126 sequence 5′-UCG UAC CGU GAG UAA UAA UGC G-3′ (OriGene, Rockville, MD) and/or shRNA pRS plasmid, with the HIF1α -targeting sequence of 5′-ACA AGA ACC TAC TGC TAA TGC CAC CAC TA-3′, and with the acetyl-CoA citrate lyase (ACL) -targeting sequence of 5′-CCA TCA CTG AGG TCT TCA AGG AAG AGA TG-3′, using the TransIT-LT1 reagent (Mirus). [score:5]
MIR126 targets the expression of IRS1 resulting in the insulin signaling pathway disruption. [score:5]
MIR126 induces GLUT-4 expression and inhibits glucose uptake. [score:5]
Insulin receptor substrate-1 (IRS1), a target of MIR126, is involved in autophagic activityIRS1 is the functional downstream target of MIR126 via its 3′UTR [12– 14]. [score:5]
Gene array analysis revealed that one of the most profoundly downregulated genes in MIR126 -transfected H28 cells was pyruvate dehydrogenase kinase (PDK) (Supplementary Figure S5B). [score:4]
In summary, we show that MIR126 induces complex metabolic reprogramming of MM cells including activation of the autophagic pathway following disruption of IRS signaling, downregulation of PDK and ACL activity, accumulation of citrate, and formation of LDs in the cytoplasm in a HIF1α -dependent manner (Figure 9). [score:4]
MIR126 -transfected H28 cells also showed activated AMPK/ULK1 pathway, a sensor of intracellular energy homeostasis [26] (cf Figure 4), suggesting that the AMPK/ULK1 pathway takes precedence in autophagy regulation upon MIR126 expression in MM cells. [score:4]
Previously we have found that MIR126 upregulation in MM cells decreased ACL activity, inducing citrate accumulation in the cytoplasm and stabilization of HIF1α [12]. [score:4]
While the precise nature of this interesting phenomenon is not clear, it could be related to increased mitochondrial reducing activity and limited mitochondrial respiration previously reported in MIR126 MM cells [12], and reflect direct inhibition of PDH complex by increased level of mitochondrial NADH. [score:4]
As previously reported, MIR126 downregulates IRS1 [12], which is associated with increased AV formation and reduced level of LC3II/LC3I ratio as a result of increased autophagic activity. [score:4]
Paradoxically, downregulation of PDK by MIR126 resulted in reduction of PDH activity associated with an increase of its substrate, pyruvate, in malignant H28 cells (Figure 6A, 6B). [score:4]
To directly assess the effect of MIR126 on the autophagic flux, we transfected the MIR126 -expressing and mock cells with a mCHERRY-EGFP-LC3B fusion construct. [score:4]
Surprisingly, MIR126 induced ~50-fold downregulation of PDK in MM cells, yet decreased PDH activity, even though an increase of PDH activity would be expected in this situation. [score:4]
The accumulation of cytoplasmic lipids in LDs found in MIR126 -transfected MM cells could result from direct replenishment of LD linked to increased autophagy [34], or it could relate to the elevated HIF1α we previously identified in MIR126 -expressing MM cells [12]. [score:4]
The increased AMPK activity could be related to reduced glucose uptake observed for MIR126 H28 cells, which was independent of GLUT-4. Hence, the increased GLUT-4 in this scenario could result from compensatory upregulation driven by HIF1α that we previously found to be increased by MIR126 in MM cells [12]. [score:4]
Since these effects of MIR126 in H28 cells are consistent with its tumor suppressor properties, we tested its effect on tumor growth. [score:3]
Figure 8 MIR126 suppresses tumor formation A. Balb-c nu/nu mice were injected subcutaneously with 1×10 [6] H28 [pRS] or H28 [MiR126] cells and tumor growth was quantified by USI. [score:3]
In this study, we found that simultaneous inhibition of PDK and ACL by pharmacological and genetic means recapitulated the effects of MIR126 on tumorigenic potential and autophagy, while single treatment had little or no effect. [score:3]
Even though GLUT-4 was highly expressed in MIR126 -transfected H28 cells, glucose uptake was markedly reduced in these cells also after insulin stimulus. [score:3]
Insulin receptor substrate-1 (IRS1), a target of MIR126, is involved in autophagic activity. [score:3]
We also show that MIR126 overexpression was accompanied by accumulation of intracellular lipid droplets (LDs) in MM cells due to alteration of mitochondrial function in a hypoxia-inducible factor-1α (HIF1α) -dependent manner. [score:3]
MIR126 -transfected cells (Met5A, H28) and their empty-plasmid counterparts were transiently transfected with the pLENTI6.3 EOS-LC3 expression plasmid (a kind gift from Dr. [score:3]
Figure 5 MIR126 overexpression results in lipid accumulation A. H28 and IstMes2 cells transfected with empty plasmid and MIR126 were subjected to Oil Red O staining (left panel), and TEM (right panel). [score:3]
Ectopic overexpression of MIR126 increased autophagic activity by altering the insulin signaling pathway through IRS1, resulting in reduced glucose uptake. [score:3]
MIR126 may affect the insulin pathway signaling by targeting IRS1. [score:3]
Anti-proliferative effect of MIR126 was found in several tumour types including colon cancer, non-small cell lung cancer and malignant mesothelioma (MM) via targeting different members of the PI3K/AKT pathway [10– 12]. [score:3]
In our previous work, we reported that MIR126 increased cellular citrate by inhibiting the ACL activity [12]. [score:3]
The p-mTOR/mTOR ratio, which indicates activation of mTOR, increased in H28 cells overexpressing MIR126 (Figure 4A). [score:3]
Inhibition of autophagy by 3MA or CQ did not induce further LC3II accumulation in MIR126- and empty plasmid -transfected IstMes2 cells, supporting the premise that these cells lack autophagic activity (Figure S3C). [score:3]
MIR126 -transfected Met5A, H28 and IstMes2 cells and their empty plasmid -transfected counterparts were evaluated for GLUT-4 expression by WB A. and its cell surface expression by flow cytometry B, C. was evaluated over time by 2-NBDG (50 μM) in low-glucose DMEM without and with insulin stimulus, and expressed as mean fluorescent intensity (MFI). [score:3]
Overexpression of MIR126 induces autophagic flux. [score:3]
G418- and/or puromycin-resistant clones were analyzed for MIR126 and HIF1α expression. [score:3]
MIR126 suppresses tumor formation. [score:3]
IRS1 is the functional downstream target of MIR126 via its 3′UTR [12– 14]. [score:3]
MIR126 overexpression results in lipid accumulation. [score:3]
The AVs were perinuclear and overlayed with mitochondria suggesting a possible increase in autophagic/mitophagic flux in MIR126 -expressing cells. [score:3]
In contrast, in non-malignant mesothelial cells, increased expression of GLUT-4 by MIR126 was associated with higher glucose uptake, pointing to very distinct effects of MIR126 in MM and non-malignant cells. [score:3]
Collectively, these effects inhibit tumor progression when MIR126 is high, emphasizing the protective role of enhanced autophagic flux in the progression of MM. [score:3]
MIR126 transfected Met5A, H28 and IstMes2 cells and their empty plasmid -transfected counterparts were analyzed for PDH activity A. and pyruvate levels B. H28 cells were selected to stably express the empty vector (H28 [pRS]) or the ACL shRNA construct (H28 [ACL], insert), and PDH activity C. and pyruvate levels D. evaluated in the presence or absence of PDK inhibitor DCA (20 mM). [score:3]
An interesting finding of this study is that ACL inhibition (by MIR126 or by genetic intervention) can override the removal of PDK -mediated control and maintain an inactive PDH complex. [score:3]
Ectopic MIR126 increased mTOR expression in H28 cells but not in Met5A and IstMes2 cells. [score:3]
Conversely, IRS1 silencing induced AV formation and reduced LC3II level in both MIR126- and empty plasmid -transfected MM cells, thus resembling MIR126 overexpression (Supplementary Figure 2). [score:3]
As shown in Figure 3A, 3B, ectopic MIR126 increased GLUT-4 expression in Met5A cells and, to a larger extent, in malignant H28 cells. [score:3]
D. Overexpression of MIR126 induces autophagic flux. [score:3]
MIR126 induces autophagy by inhibiting PDK and ACLA global picture of modulation of signaling pathways by MIR126 was investigated by genome-wide gene expression analysis. [score:3]
The LD formation in MIR126 -transfected H28 cells was inhibited by anti-MIR transfection (Figure S1A lower panel). [score:3]
Among various MIRs, MIR126 has an important role in cancer biology, since it can inhibit progression of certain cancers via negative control of proliferation, migration, invasion and cell survival [7, 8]. [score:3]
MIR126 induces autophagy by inhibiting PDK and ACL. [score:3]
As shown in Figure 1B the ratio of red to green punctae was increased in MIR126 -expressing malignant H28 cells indicating accelerated lysosomal delivery of autophagosomes and increased autophagic flux, but it remained unaffected by MIR126 in non-malignant Met5A cells. [score:3]
Overexpression of MIR126 induced the AMPK phosphorylation, which in turn activated the ULK1 pathway. [score:3]
Empty plasmid- and MIR126 -transfected H28 cells, and their IRS1-silenced (IRS1-) or IRS1 -overexpressing (IRS1+) counterparts were analyzed for AV formation A. IRS1 levels and LC3 conversion B. Densitometric analysis of IRS1 and LC3 conversion related to actin (right panel). [score:3]
CQ treatment caused significant increase of LC3II protein in MIR126 -transfected MM cells, suggesting that the overexpression of MIR126 indeed induces the autophagic flux. [score:3]
Figure 6 MIR126 transfected Met5A, H28 and IstMes2 cells and their empty plasmid -transfected counterparts were analyzed for PDH activity A. and pyruvate levels B. H28 cells were selected to stably express the empty vector (H28 [pRS]) or the ACL shRNA construct (H28 [ACL], insert), and PDH activity C. and pyruvate levels D. evaluated in the presence or absence of PDK inhibitor DCA (20 mM). [score:3]
Figure 2IRS1 is involved in MIR126 -induced autophagyEmpty plasmid- and MIR126 -transfected H28 cells, and their IRS1-silenced (IRS1-) or IRS1 -overexpressing (IRS1+) counterparts were analyzed for AV formation A. IRS1 levels and LC3 conversion B. Densitometric analysis of IRS1 and LC3 conversion related to actin (right panel). [score:3]
MIR126 affects glucose uptake MIR126 may affect the insulin pathway signaling by targeting IRS1. [score:3]
In addition, mitochondria compromised by MIR126 in conjunction with higher autophagic flux instigate increased mitophagy observed in this study for MIR126 -expressing MM cells. [score:3]
Overexpression of MIR126 induces autophagic fluxTo explore the role of MIR126 in autophagy, MM cells (cell line H28) and non-malignant mesothelial cells (cell line Met5A) transfected with MIR126 and empty plasmid were stained with acridine orange (AO) or transfected with mCHERRY-EGFP-LC3B plasmid. [score:3]
MIR126 has been reported to suppress progression of MM by affecting cellular metabolism [12]. [score:3]
Using luciferase assay, it was found that MIR126 targets other factors, such as SOX2, SLC7A5, EGFL7 and VEGF [16– 20]. [score:2]
Although ectopic MIR126 inhibited PDK, PDH activity was reduced in MIR126 -transfected H28 cells compared to their empty-plasmid counterparts. [score:2]
Proposed mo del of MIR126 in regulating autophagy and cell proliferation. [score:2]
MIR126 regulates autophagy. [score:2]
MIR126 regulates autophagyLimited availability of intracellular glucose can trigger autophagy. [score:2]
We consider the second option more likely, as we show that HIF1α knock down did not affect autophagy in MIR126 MM cells, but eliminated LD formation. [score:2]
This means that PDK and ACL together are principal effectors of MIR126 response initiated at IRS1, which regulates ACL via AKT [12]. [score:2]
Ectopic MIR126 regulated a number of genes, affecting different signaling pathways. [score:2]
Anti- MIR126 transfection restored glucose uptake in these cells (Supplementary Figure S1B). [score:1]
A marked increase of LD accumulation was observed in parental cells with silenced HIF1α, while disappearance of LDs was found in their MIR126 -transfected counterparts (Figure S4, left panels). [score:1]
We discovered that ectopic MIR126 -induced massive AV formation and increased autophagic flux via autophagosome/lysosome fusion, as indicated by increased LC3II turnover and increased delivery of LC3 into lysosomes (cf Figure 1). [score:1]
Previous work demonstrated activation and stabilization of hypoxia-inducible factor-1α (HIF1α) in MIR126 -transfected MM cells [12]. [score:1]
MIR126 affects glucose uptake. [score:1]
A. H28 and IstMes2 cells transfected with empty plasmid and MIR126 were subjected to Oil Red O staining (left panel), and TEM (right panel). [score:1]
We therefore asked whether MIR126 alters glucose homeostasis in the context of altered autophagic response. [score:1]
MIR126 affects the mTOR/AMPK/ULK1 pathway. [score:1]
A global picture of modulation of signaling pathways by MIR126 was investigated by genome-wide gene expression analysis. [score:1]
IstMes2 MM cells lacking the MIR126 -binding site within the IRS1 3′UTR further confirmed the role of IRS1 (cf Supplementary Figure S3). [score:1]
Ectopic MIR126 induces autophagic flux. [score:1]
To assess whether MIR126 -induced LDs and autophagy/mitophagy could be attributed to HIF1α, the hypoxia factor was silenced in MIR126 -transfected H28 cells. [score:1]
Restoration of the autophagic pathway was observed by blocking the function of MIR126 using antisense MIR126 (anti- MIR) (Figure S1C), further confirming the involvement of MIR126. [score:1]
Ectopic MIR126 induces lipid accumulation in malignant cells. [score:1]
Similarly, phosphorylation of the p70 ribosomal protein S6 kinase-1 (p70S6K), a downstream substrate of mTOR, was also increased in MIR126 -transfected H28 cells. [score:1]
IRS1 is involved in MIR126 -induced autophagy. [score:1]
Mitochondria were isolated from H28 and IstMes2 MIR126 -transfected cells and their empty plasmid -transfected counterparts using a commercial kit (Sigma) according to the manufacturer's instructions. [score:1]
The symbol “*” indicates significant difference between mock and MIR126 cells. [score:1]
To explore the role of MIR126 in autophagy, MM cells (cell line H28) and non-malignant mesothelial cells (cell line Met5A) transfected with MIR126 and empty plasmid were stained with acridine orange (AO) or transfected with mCHERRY-EGFP-LC3B plasmid. [score:1]
As shown in Figure 5B, ectopic MIR126 induced PARK2 and SQSTM1accumulation in isolated mitochondria of H28 cells, indicating mitophagy. [score:1]
Figure 8 documents that while H28 [pRS] mock cells progressively formed tumors, H28 [MIR126] MIR126 -transfected cells formed small tumors that were resorbed by day 10, reflecting the anti-tumor efficacy of MIR126 in vivo. [score:1]
Therefore, to evaluate the role of PDK and ACL in the mediation of MIR126 effect, H28 cells were silenced for ACL activity, and PDK was inhibited by treatment with dichloroacetate (DCA). [score:1]
We observed vesicle-like particles in the cytoplasm of MIR126 -transfected H28 cells. [score:1]
Here, we found that MIR126 is a potent inducer of autophagy in MM cells. [score:1]
In cancer cells, MIR126 induced reduction of LC3II levels rather than its accumulation, consistent with increased lysosomal delivery of the autophagosome-incorporated LC3II indicated by the dual fluorescence construct described above. [score:1]
This suggests that MIR126 increases autophagic flux in MM cells. [score:1]
We utilized the pathway enrichment analysis to compare MIR126 -transfected cells with their empty vector -transfected counterparts (Figure S5). [score:1]
Total RNA from MIR126- and empty plasmid -transfected H28 cells was isolated using the RNeasy kit (Qiagen) following the manufacturer's protocols. [score:1]
Increased phosphorylation of ULK1 at Ser-555 (pro-autophagic) and decreased phosphorylation at Ser-757 (anti-autophagic) were found in MIR -transfected H28 cells, but not in non-malignant Met5A cells and MIR126-non-responsive IstMes2 cells (Figure 4B). [score:1]
Ectopic MIR126 induces lipid accumulation in malignant cellsWe observed vesicle-like particles in the cytoplasm of MIR126 -transfected H28 cells. [score:1]
MIR126 function was blocked with the anti-sense oligonucleotide 5′-GCA UUA UUA CUC ACG GUA CGA-3′ (IDT, Tema Ricerca). [score:1]
Formation of LDs and presence of damaged mitochondria/mitophagy were not observed in MIR126-non-responsive IstMes2 cells (Figure 5). [score:1]
No significant changes in glucose uptake were observed in MIR126-non-responsive IstMes2 cells (Figure 3C). [score:1]
Additionally, we used IstMes2 cells with truncated IRS1 lacking its MIR126 binding site (see the sequence in Figure S2) to address whether this finding also applies to unchanged IRS1 level. [score:1]
Contrary to our expectation, MIR126 induced activation of the mTOR pathway in MM cells. [score:1]
Conversely, increased GLUT-4 and PARK2 induced by MIR126 was reversed by HIF1α -silencing, pointing to a HIF -dependent mechanism (Supplementary Figure S4B). [score:1]
In contrast, no effect on AV formation was found upon MIR126 introduction into non-malignant Met5A cells. [score:1]
A. MIR126 -transfected H28 and Met5A cells and their empty plasmid -transfected counterparts were stained with AO and TMRM, and AVs (green) and mitochondria (red) visualized by fluorescent microscopy. [score:1]
MIR126, siRNA and transfections. [score:1]
B. Immunoblot of PARK2, SQSTM1, and cytochrome c (cyt c) in mitochondria isolated from MIR126 -transfected H28 and IstMes2 cells and their empty plasmid -transfected counterparts. [score:1]
To further determine whether MIR126 induces autophagy flux or blocks autophagy initiation (this could also reduce the LC3II levels), we investigated LC3 turnover in the presence of autophagy inhibitors. [score:1]
In these cells, pyruvate levels increased (Figure 6D), thus resembling MIR126 -transfected H28 cells with low PDH activity and high pyruvate level. [score:1]
On the other hand, decreased GLUT-4 levels were found in MIR126-non-responsive IstMes2 cells. [score:1]
Figure 1Ectopic MIR126 induces autophagic flux A. MIR126 -transfected H28 and Met5A cells and their empty plasmid -transfected counterparts were stained with AO and TMRM, and AVs (green) and mitochondria (red) visualized by fluorescent microscopy. [score:1]
C. EOS-LC3 co-localization with mitochondria stained with MitoTracker Far Red in empty- and MIR126 -transfected H28 cells. [score:1]
Here, we report that MIR126 acts as an inducer of autophagic flux in MM. [score:1]
B. MIR126 -transfected H28 and Met5A cells and their empty plasmid -transfected counterparts were transiently transfected with dual fluorescence mCHERRY-EGFP-LC3B vector, and the red (R, lysosomal autophagosomes), green (G, autophagosomes) were visualized. [score:1]
This MIR126 -induced autophagic process is mediated by IRS1. [score:1]
[1 to 20 of 126 sentences]
3
[+] score: 323
Other miRNAs from this paper: mmu-mir-126a
Human SMMC-7721, MHCC-97H, and HCCLM3 cells at the logarithmic growth phase were collected and assigned into 7 groups:: (1) blank group (no transfection with any sequence); (2) miR-126 mimics group (transfection with miR-126 mimics); (3) miR-126 mimic NC group (transfection with miR-126 mimics negative control plasmid); (4) miR-126 inhibitors group (transfection with miR-126 inhibitors); (5) miR-126 inhibitor NC group (transfection with miR-126 inhibitors negative control plasmid); (6) si-EGFL7 group (transfection with si-EGFL7); and (7) miR-126 inhibitors + si-EGFL7 group (transfection with miR-126 inhibitors and si-EGFL7). [score:13]
Jiao, et al. reported miR-126 down-regulation in pancreatic ductal adenocarcinoma, with elevations in KRAS and CRK, and confirmed that miR-126 directly inhibits KRAS translation via interaction with a KRAS 3′UTR “seedless” site [18]. [score:9]
Recent evidence showed that down-regulation of miR-126 plays a pivotal role in various cancers, and ectopic miR-126 expression could suppress cell proliferation and growth in lung, gastric and breast cancers [9, 10, 16]. [score:8]
Compared to the blank, miR-126 inhibitor NC and si-EGFL7 groups, the expression of miR-126 was remarkably reduced in the miRNA-126 inhibitors and miR-126 inhibitors + si-EGFL7 groups (all P < 0.05). [score:8]
MiR-126 up-regulation was verified in vitro to inhibit breast cancer cell proliferation and invasion, indicating that miR-126 can act as a suppressor in breast cancer [10]. [score:8]
The expression of VEGF showed no difference in the blank, miR-126 mimic NC, miR-126 inhibitor NC, miR-126 inhibitors + si-EGFL7 groups in the same cell lines (all P > 0.05). [score:7]
Figure 2(A) The TargetScan database showed that EGFL7 was a potential miR-126 target gene; (B) Luciferase reporter assay indicated that miR-126 bound the EGFL7 3′UTR, directly inhibiting EGFL7 transcription. [score:7]
The results showed that when EGFL7 levels decreased, miR-126 expression increased, suggesting that higher miR-126 levels would inhibit cell proliferation and VEGF expression. [score:7]
The mRNA and protein expressions of EGFL7 were decreased in the miR-126 mimics and si-EGFL7 groups and increased in the miR-126 inhibitors group in comparison to the blank and miR-126 inhibitors + si-EGFL7 groups (all P < 0.05) (Figure 7). [score:7]
Sun, et al. showed that miR-126, through targeting EGFL7, may suppress A549 cell proliferation in vitro, and inhibit tumor growth in vivo [9]. [score:7]
At 24 h after transfection, compared with the blank, miR-126 inhibitor NC and miR-126 inhibitors + si-EGFL7 group, the proliferation of HCC cells was increased in the miR-126 inhibitors group and decreased in the miR-126 mimics and si-EGFL7 groups (all P < 0.05). [score:6]
Furthermore, miR-126 could inhibit tumor proliferation and angiogenesis of HCC by down -regulating EGFL7 expression. [score:6]
Thus, miR-126, through EGFL7, may indirectly reduce VEGF expression and blood vessel formation as an intracellular inhibitor of angiogenic signaling [22, 23]. [score:6]
Compared with the blank group, the mRNA and protein expressions of EGFL7 were unchanged in the miR-126 mimic NC, miR-126 inhibitor NC and miR-126 inhibitors + si-EGFL7 groups (P > 0.05). [score:6]
MiR-126 and target gene binding sites were predicted based on bioinformatics analyses of TargetScan for site-directed mutagenesis. [score:5]
At 24 h, 48 h and 72 h after transfection, the expression of VEGF was highest in the miR-126 inhibitors group and lowest in the miR-126 mimics and si-EGFL7 groups (P < 0.05) (Figure 5). [score:5]
We found that miR-126 indeed targets EGFL7 and inhibits the proliferation of HCC cells. [score:5]
There was no difference in miR-126 expression between the blank, miR-126 mimic NC and miR-126 inhibitor NC groups (P > 0.05). [score:5]
results indicated that the proliferation of HCC cells in the blank, miR-126 mimic NC, miR-126 inhibitor NC and miR-126 inhibitors + si-EGFL7 groups exhibited no differences (all P > 0.05). [score:5]
The TargetScan database showed that EGFL7 was a potential miR-126 target gene (Figure 2A). [score:5]
Figure 8(A) The blank group; (B) The miR-126 mimics group; (C) The miR-126 inhibitors group; (D) The si-EGFL7 group; (E) The miR-126 inhibitors + si-EGFL7 group. [score:5]
In the miR-126 inhibitors group, EGFL7 mRNA and protein expressions were increased (P < 0.05) (Figure 3). [score:5]
Potential miR-126 target genes were collected via TargetScan. [score:5]
HCC tissues had higher miR-126 expression and lower EGFL7 mRNA expression than adjacent normal tissues (both P < 0.05) (Figure 1A). [score:5]
As shown in Table 1, miR-126 expression was negatively correlated with tumor size, liver cirrhosis and VEGF expression of HCC patients (all P < 0.05). [score:5]
Figure 9(A) The blank group; (B) The miR-126 mimics group; (C) The miR-126 inhibitors group; (D) The si-EGFL7 group; (E) The miR-126 inhibitors + si-EGFL7; (F) Comparison of the number of CD31 -positive micro-vessels of transplanted tumors in nude mice among different groups. [score:5]
There were more VEGF -positive cells in the miR-126 inhibitors group than in the blank and miR-126 inhibitors + si-EGFL7 groups (both P < 0.05), and VEGF was only weakly positive in the miR-126 mimics and si-EGFL7 groups. [score:5]
All water, padding and fodder were sterilized at high temperatures and cages were sterilized every 3 d. After adaptive breeding for 12 d, 60 mice were divided into 5 groups (12 mice per group): the blank, miR-126 mimics, miR-126 inhibitor, si-EGFL7, miR-126 inhibitors + si-EGFL7 groups. [score:5]
These results implied that miR-126 bound the EGFL7 3′UTR, directly inhibiting EGFL7 transcription (Figure 2B). [score:4]
MiR-126 is abundant in endothelial cells and can modulate blood vessel development and production through regulation of locally-expressed genes [8]. [score:4]
Consistent with previous studies, our results indicated that down-regulation of miR-126 was detected in the HCC tissues and associated with tumor size and liver cirrhosis. [score:4]
Figure 4* P < 0.05 compared with the blank, miR-126 mimic NC, miR-126 inhibitor NC, or miR-126 inhibitor + si-EGFL7 groups. [score:4]
Figure 5* P < 0.05 compared with the blank, miR-126 mimic NC, miR-126 inhibitor NC, or miR-126 inhibitor + si-EGFL7 groups. [score:4]
We may assume that down-regulation of miR-126 may contribute to tumorigenesis and tumor progression. [score:4]
Our work employed the dual luciferase reporter gene assay, using the TargetScan database to identify likely miR-126 target genes. [score:4]
As shown in Table 5, the number of CD31 -positive micro-vessels was highest in the miR-126 inhibitors group and lowest in the miR-126 mimics and si-EGFL7 groups compared to the blank and miR-126 inhibitors + si-EGFL7 groups (all P < 0.05). [score:4]
We also validated in vivo that miR-126 down-regulation increased serum ALT and VEGF levels, and enhanced micro-vessel density in tumors. [score:4]
Compared with the blank and miR-126 inhibitors + si-EGFL7 groups, significant increases in tumor sizes were observed in the miR-126 inhibitors group at the first 10 days after transfection (both P < 0.05), while the tumor size was decreased in the miR-126 mimics and si-EGFL7 groups (all P < 0.05) (Figure 6A). [score:4]
Also, miR-126 has been negatively associated with tumor occurrence, development and metastasis and appears to act as a tumor suppressor [9]. [score:4]
Importantly, our study provided evidence that miR-126 can bind to the EGFL7 3′UTR and inhibit transcription, indicating that miR-126 regulates EGFL7. [score:4]
As shown in Table 4, ELISA results showed that serum ALT and VEGF levels were declined in the miR-126 mimics and si-EGFL7 groups and elevated in the miR-126 inhibitors group compared to the blank and miR-126 inhibitors + si-EGFL7 groups (all P < 0.05). [score:4]
Chen et al. revealed that decreased expression of miR-126 is associated with metastatic recurrence of HCC [19]. [score:3]
There was no difference in serum ALT and VEGF levels between the blank and miR-126 inhibitors + si-EGFL7 groups (both P > 0.05). [score:3]
Thus, miR-126 may suppress tumor angiogenesis and reduce MVD. [score:3]
There was also no difference in the expression of VEGF between the miR-126 mimics and si-EGFL7 groups (P > 0.05). [score:3]
Figure 1(A) The expressions of miR-126 and EGFL7 mRNA in HCC tissues and adjacent normal tissues detected by qRT-PCR. [score:3]
This indicated that miR-126 repressed recruitment of endothelial cells and metastatic angiogenesis by targeting the novel pro-angiogenic genes and metastasis biomarkers, MERTK, IGFBP2 and PITPNC1 [17]. [score:3]
The VEGF -positive rate in the miR-126 inhibitors group (66.7%) was higher than the blank (25.0%), miR-126 mimics (0%) and si-EGFL7 (8.3%) groups (all P < 0.05). [score:3]
The expression of miR-126 in HCC cells after transfection. [score:3]
As shown in Table 3, the mRNA and protein expressions of EGFL7 were significantly reduced in the miR-126 mimics and si-EGFL7 groups (all P < 0.05). [score:3]
Targeting relationship between miR-126 and EGFL7. [score:3]
Comparison of miR-126, EGFL7 mRNA and protein expressions between HCC tissues and adjacent normal tissues. [score:3]
Nevertheless, tumor weights of transplanted tumors in the miR-126 mimics and si-EGFL7 groups were lower than the blank and miR-126 inhibitors + si-EGFL7 groups (all P < 0.05) (Figure 6B). [score:3]
Influence of miR-126 on the expression of VEGF HCC cells after transfection. [score:3]
Correlations of miR-126 and EGFL7 mRNA expressions with clinicopathological features of hepatocellular carcinoma. [score:3]
Tumor weights of transplanted tumors in the miR-126 inhibitor group were heavier than other four groups (all P < 0.05). [score:3]
Correlations of miR-126 and EGFL7 mRNA expressions with clinicopathological features of HCC. [score:3]
The expression of miR-126 in SMMC-7721, MHCC-97H and HCCLM3 cells after transfection. [score:3]
The expressions of miR-126, EGFL7 mRNA and protein in HCC tissues and adjacent normal tissues. [score:3]
In a study performed by Hansen et al., he advocates that the assumption of low miR-126 and high EGFL7 expressions being linked to an increased metastatic potential [15]. [score:3]
However, miR-126 expression failed to be linked to age, gender, TNM stage, PVTT, capsular infiltration and HBsAg (all P > 0.05). [score:3]
In conclusion, our study clearly illustrated the targeting relationship between miR-126 and EGFL7 in HCC. [score:3]
Fish, et al. reported that miR-126 mediates EGFL7 expression in a negative feedback loop to control angiogenic signaling and vascular integrity [20]. [score:3]
Therefore, miR-126 and EGFL7 could serve as potential therapeutic targets for HCC. [score:3]
EGFL7 was subsequently found to be involved in cellular responses such as migration and angiogenesis, and was confirmed as a potential miR-126 target via bioinformatics analyses. [score:3]
Thus, in the present study, we studied the effects of miR-126 on tumor proliferation and angiogenesis of HCC by targeting EGFL7. [score:3]
There was no difference in the number of CD31 -positive micro-vessels between the blank and miR-126 inhibitors + si-EGFL7 groups (P > 0.05) (Figure 9). [score:3]
Confirming this, we found that miR-126 was negatively correlated with EGFL7 and VEGF expressions in HCC tissues. [score:3]
Our study found that low miR-126 expression was associated with tumor progression via VEGF and EGFL7 activation. [score:3]
miR-126 knockdown during zebrafish and mouse embryogenesis reportedly delayed angiogenic sprouting, collapsed blood vessels, and caused widespread hemorrhages and partial embryonic lethality [20]. [score:2]
However, the regulatory relationship between miR-126 and EGFL had not yet been explored with respect to tumor angiogenesis. [score:2]
The expression of miR-126 in the miRNA-126 mimics group was the highest compared with other groups (P < 0.05) (Table 2). [score:2]
There was no difference in the proliferation of HCC cells between the miR-126 mimics and si-EGFL7 groups (P > 0.05) (Figure 4). [score:1]
Consequently, we performed cell transfection experiments to investigate the targeting relationship between miR-126 and EGFL7 to understand its function in HCC. [score:1]
An ABI 7500 real-time fluorescence quantitative PCR instrument (Applied Biosystem, USA) was used with the following reaction (20 ul) conditions: 40 cycles at 95°C for 3 min, 95°C for 12 s and 62°C for 50 s. U6 was used as an internal reference for miR-126 mRNA, with β-actin for EGFL7 mRNA. [score:1]
Png, et al. reported that endogenous miR-126 non-cell-autonomously controls endothelial cell aggregation to metastatic breast cancer cells in vitro and in vivo. [score:1]
Influence of miR-126 on tumor growth of transplanted tumors in nude mice. [score:1]
miR-126 and miR negative control (miR-NC) were separately transfected into SMMC-7721 cells with Lipofectamine [TM]2000 (Life Technologies, USA). [score:1]
[1 to 20 of 78 sentences]
4
[+] score: 314
Other miRNAs from this paper: mmu-mir-126a
Next, we detected the expression level of VEGF-A by the method of in SGC-7901 cells (Fig. 5A), the results showed that VEGF-A (Fig. 5D) and its downstream protein p-Akt (Fig. 5E), p-mTOR (Fig. 5F) and p-ERK1/2 (Fig. 5G) expression all increased after inhibiting miR-126 and decreased after restoration of miR-126 expression. [score:9]
In normal vasculogenesis, up-regulated miR-126 in endothelial cells could enhance VEGF activity and promote vessel formation by repressing the expression of sprouty-related protein-1 (Spred-1), and knockdown of miR-126 leads to destruction of vascular integrity and hemorrhage during embryonic development [21, 22]. [score:8]
Bar graph showing that, compared with the control groups, VEGF-A (D) and its downstream proteins p-Akt (E), p-mTOR (F) and p-ERK1/2 (G) expression levels increased after inhibiting miR-126 expression, while the expression levels decreased after restoration of miR-126 in the above there gastric cancer cell lines. [score:8]
Figure 5Western blot analysis was performed to determine the expression of VEGF-A and its down stream proteins after restoration or inhibition of miR-126 expression by lenti-miR-126 or lenti-anti-miR-126 transfection in SGC-7901 (A), MKN-28 (B) and MKN-45 (C) cells. [score:7]
Furthermore, we found that miR-126 could interact with VEGF-A via the binding site in 3′UTR, and restoration of miR-126 expression in gastric cancer cell lines could not only reduce the VEGF-A expression in vitro, but also inhibit the tumor growth through decreasing the microvessel formation in vivo. [score:7]
analysis was performed to determine the expression of VEGF-A and its down stream proteins after restoration or inhibition of miR-126 expression by lenti-miR-126 or lenti-anti-miR-126 transfection in SGC-7901 (A), MKN-28 (B) and MKN-45 (C) cells. [score:7]
We identified the down-regulated expression of miR-126 in gastric cancer tissue compared to the normal gastric mucosa as well as an enhanced expression of VEGF-A and its downstream signaling molecules in several gastric cancer cell lines. [score:7]
miR-126 interacts with VEGF-A. Inhibition of the VEGF-A expression and its downstream molecules in various gastric cancer cell lines via restoration of miR-126 expression. [score:7]
In conclusion, reduction of miR-126 played an important role in angiogenesis of gastric cancer, and ectopic expression of miR-126 could significantly inhibit VEGF-A expression, thus counteract the proliferation and growth of gastric cancer cells both in vitro and in vivo. [score:7]
Semi-quantitative analysis revealed that the expression of VEGF-A increased after miR-126 interfered, while decreased after miR-126 up-regulated (C, n = 8, *, p < 0.01). [score:6]
To further clarify it, we detected the VEGF-A expression level in three gastric cancer cell lines, which transfected with lentivirus vectors to up- or down-regulate miR-126 level. [score:6]
To identify direct targets of miR-126, the two most-used public bioinformatic algorithms, TargetScan and miRanda, were used in combination. [score:6]
These results revealed that miR-126 might inhibit gastric cancer growth and angiogenesis by down -regulating VEGF-A expression. [score:6]
The results showed that the expression of miR-126 was decreased obviously in Lenti-miR-126 transfection cells while increased obviously in Lenti-anti-miR-126 transfection cells (Fig. 4F), but no obvious differences of miR-126 expression were observed among the three control group cells (Fig. 4F). [score:5]
The tumor MVD, which was quantified by CD34 expression, presented the same trend with VEGF-A after affecting miR-126 expression (D, n = 8, *, p < 0.05). [score:5]
Our further analysis in gastric cancer tissues revealed that the expression of miR-126 was reversely correlated with MVD and VEGF-A protein expression. [score:5]
These results suggested that miR-126 could inhibit VEGF-A expression in vitro. [score:5]
As a result (Fig. 6), ectopic expression of miR-126 inhibited tumorigenesis in vivo: the average tumor weight of mice inoculated with lenti-miR-126 transfected SGC-7901 cells at day 42 was 0.57 ± 0.21g, which was significantly lower (P < 0.05) than that of mice inoculated with lenti-anti-miR-126 transfected SGC-7901 cells (2.79 ± 0.31g) and lenti-miR-NC negative control group (1.73 ± 0.34g). [score:5]
Over -expression of miR-126 was found in acute myeloid leukemia [24] and miR-126 expression reduced in colorectal cancer [25, 26], prostate cancer [27], breast cancer [28], oral cancer [29], lung cancer [30] and gastric cancer [14]. [score:5]
Lentivirus transfection of miR-126 increases the expression of miR-126 and inhibits gastric cancer cell proliferation. [score:5]
The results shown in Fig. 4G suggested that exogenous expression of miR-126 could inhibit proliferation of SGC-7901 cells. [score:5]
As a result, the expression of VEGF-A and its downstream signaling molecules (p-Akt, p-mTOR and p-ERK) as well as cell proliferation reversely correlated with miR-126 expression. [score:5]
Noticeably, the reduction of miR-126 was related to the increase of capillary density in lung cancer tissue, and restoration of miR-126 in lung cancer obviously reduced the VEGF expression level and micro-vessel density (MVD), thus could inhibit the growth of lung cancer [30, 31]. [score:5]
The expression of VEGF-A was enhanced in gastric cancer tissue and reversely correlated with miR-126 expression level. [score:5]
In contrast, it has been found that down-regulated miR-126 increases VEGF-A activity in lung cancer, oral cancer and breast cancer [30, 35– 37], and restoration of miR-126 can decrease VEGF and tumor size in lung cancer [30, 31]. [score:4]
However, the regulation of miR-126 expression is totally unknown in gastric cancer. [score:4]
In order to further test whether miR-126 is capable of regulating VEGF-A protein expression via the binding site in VEGF-A 3′UTR, we cloned the predicted miR-126 binding site from cDNA library downstream the firefly luciferase coding region in pMIR-REPORTTM Luciferase vector (pLuc, Ambion). [score:4]
These results indicated that miR-126 could regulate VEGF-A protein expression via the binding site in VEGF-A 3′UTR. [score:4]
Thus, miR-126 may function as a tumor suppressor through regulation of VEGF-A in gastric cancer. [score:4]
In order to confirm the regulatory role of miR-126 on VEGF-A expression in gastric cancer in vitro, SGC-7901 cells were infected by recombinant lentivirus miR-126 (Lenti-miR-126), lentivirus anti-miR-126 (Lenti-anti-miR-126) along with lentivirus miR negative control (Lenti-miR-NC), lentivirus anti-miR negative control (Lenti-anti-miR-NC) or transfection reagents without lentivirus vector (Mock), respectively (Fig. 4A-E). [score:4]
Accordingly, the amount of MVD determined by CD34 immunostaining (Fig. 7B and D) was lower in the tumor derived from miR-126 restoration group (20.05 ± 3.39) than that from the control group (30.35 ± 3.34) and miR-126 down-regulated group (52.00 ± 4.47). [score:4]
In addition, our presented evidences indicated that miR-126 binded directly to the VEGF-A 3′UTR, thus reduced tumor growth and suppressed tumor vascularization in a xenograft human gastric cancer mo del. [score:4]
The average tumor weight of miR-126 restoration group was lower than that in control group, while the weight in miR-126 down-regulated group was higher than that in control group (B, n = 8, *, p < 0.01). [score:4]
As results, VEGF-A was found to be positively correlated with MVD index (Fig. 2C) and negatively correlated with miR-126 (Fig. 2D) in gastric cancer tissue, which suggested a possible negative regulatory role of miR-126 in VEGF-A expression. [score:4]
Recently, several novel targets of miR-126 have been confirmed including PI3KR2 [44], Crk [44], IκBα [45], IRS-1 [46], ADAM9 [47], CXCR4 [26], Spred-1 [48] and SOX2 [38]. [score:3]
Bar graph (F) showing quantitative real-time RT-PCR confirmed the expression of miR-126 was dramatically decreased after Lenti-anti-miR-126 transfection and restored after Lenti-miR-126 transfection. [score:3]
Effect of miR-126 expression on in vivo SGC-7901 tumorigenicity and angiogenesis. [score:3]
We found that miR-126 was down-regulated in gastric cancer samples compared with normal samples, as indicated by qRT-PCR analysis, consistent with the previous analysis [14]. [score:3]
It has been demonstrated that abnormal expression of miR-126 is correlated with human tumorigenesis. [score:3]
Figure 3 (A) Putative binding sites of miR-126 in the VEGF-A 3′UTR predicted by TargetScan. [score:3]
To further investigate whether VEGF-A is a target gene of miR-126, we searched for miR-126 target genes using bioinformatic analysis and found VEGF-A had a putative miR-126 binding site within its 3′UTR. [score:3]
As shown in Figure 3A, VEGF-A is theoretically a potential target gene of miR-126, and the predicted binding site between miR-126 and VEGF-A 3′-UTR is also illustrated. [score:3]
Notably, VEGF-A has also been reported to be a target gene of miR-126 in human breast cancer [36], non-small cell lung cancer [35], oral cancer [37], colorectal cancer [49] and hepatic stellate cells [50]. [score:3]
The results have shown the reduced expression of miR-126 associated with higher MVD and VEGF-A in gastric cancer. [score:3]
Here, we reported that VEGF-A was also a target gene of miR-126 in human gastric cancer. [score:3]
Further analyzes revealed that the VEGF-A immunoblotting density was positively correlated with gastric cancer MVD index (C) detected by CD34 immunostaining (r = 0.8348, p < 0.0001, n = 20), while a inverse correlation was found between VEGF-A and miR-126 expression (D, r = –0.9480, p < 0.0001, n = 20). [score:3]
miR-126 was identified as a tumor suppressor in one study [14], while the results from another study found miR-126 contributed to gastric carcinogenesis [38]. [score:3]
A showed that Lenti-miR-126 suppressed cell proliferation, whereas Lenti-anti-miR-126 increases cell proliferation, respectively at 24h, 48h and 72h after transfection (G). [score:3]
miR-126 expression level reversely correlated with VEGF-A protein in gastric cancer. [score:3]
Anyway, the controversial findings concerning miR-126 confirm its important role in tumourigenesis and progression, regardless of its precise tumourigenic or tumour suppressive nature. [score:3]
Figure 7Immunohistochemical staining showed the in situ expression of VEGF-A (A) and CD34 (B) in gastric cancer mouse xenograft formed by three nude mouse groups inoculated with SGC-7901 cells stably transfected with Lenti-miR-126, lenti-miR-NC or Lenti-anti-miR-126. [score:3]
In addition, the results from many studies have shown that miR-126 is either a tumor suppressor or an oncogene depending on the type of cancer. [score:3]
Immunohistochemical staining showed the in situ expression of VEGF-A (A) and CD34 (B) in gastric cancer mouse xenograft formed by three nude mouse groups inoculated with SGC-7901 cells stably transfected with Lenti-miR-126, lenti-miR-NC or Lenti-anti-miR-126. [score:3]
Effect of miR-126 expression on in vivo SGC-7901 tumorigenicity and angiogenesisAngiogenesis is very important for the tumor growth. [score:3]
Changes of miRNA-126 expression and its relationship with MVD in gastric cancer tissue. [score:3]
miR-126 restoration inhibited gastric cancer angiogenesis. [score:3]
These contradictory results suggest that miR-126 might be expressed in a tissue-specific pattern and have cell content -dependent functions. [score:3]
Next, we further tested whether changes of miR-126 expression could influence the growth of tumor in vivo. [score:3]
Despite that previous studies found the suppressing role of miR-126 on gastric cancer growth, the potential role of miR-126 in gastric cancer angiogenesis remains unknown. [score:3]
The expression of miR126-Precusor via pMIR/VEGF-A/mut transfection reduced the firefly luciferase activity significantly (Fig. 3C). [score:3]
revealed a similarly effects of miR-126 on the expression of VEGF-A, p-Akt, p-mTOR and p-ERK1/2 to its effects on SGC-7901. [score:3]
miR-126 expression affected VEGF-A and its downstream MAPK/ERK and Akt/m-TOR signaling pathway in gastric cancer cell lines. [score:3]
miR-126 expression affected tumorigenicity of gastric cancer cells. [score:3]
qRT–PCR was used to confirm the relative expression of miR-126 within these five cell groups. [score:3]
Understanding how miR-126 is involved with gastric cancer pathogenesis will be useful in developing potential therapeutic targets in the management of gastric cancer. [score:3]
Compared with the normal tissues, the expression level of miR-126 was markedly reduced in all the 20 gastric carcinoma tissues (Fig. 1C). [score:2]
We identified VEGF-A as an miR-126 target gene in gastric cancer cells based on the results of the luciferase reporter assay. [score:2]
Furthermore, the expression levels of miR-126 from 20 fresh gastric carcinoma tissues and matched normal tissues were detected by the method of quantitative real-time reverse transcriptase-PCR assay (qRT-PCR). [score:2]
The current findings suggest that miR-126 plays a vital role in regulating gastric cancer angiogenesis. [score:2]
As the important role of miR-126 we found on VEGF-A in gastric cancer, we further validated the in vitro data by using a xenograft mouse mo del, showing that tumor growth as well as VEGF-A and MVD was significantly suppressed in Lenti-miR-126 stablely transfected SGC-7901 xenografts as compared with control group. [score:2]
miR-126 interacting with VEGF-A 3′UTR. [score:1]
miRNA-126 (miR-126), which is identified in the endothelial cell of blood vessels, controls angiogenesis by binding to several transcripts [21– 23]. [score:1]
miR-126 was firstly found to be located in chromosome 9q34.3 within intron 7 for epidermal growth factor like-7 (EGFL-7) [32]. [score:1]
These data strongly indicated that miR-126 may be involved in the angiogenic process of stomach cancer. [score:1]
Lentiviral constructs containing miR-126 (Lenti-miR-126) and anti-miR-126 (Lenti-anti-miR-126) along with miR negative control (Lenti-miR-NC) and anti-miR negative control (Lenti-anti-miR-NC) were designed and provided by Genechem lnc. [score:1]
Three groups of nude mice were inoculated with SGC-7901 cells stably transfected with Lenti-miR-126, Lenti-miR-NC or Lenti-anti-miR-126. [score:1]
SGC-7901 cells stably transfected with lenti-miR-126, lenti-miR-NC or lenti-anti-miR-126 were subcutaneously xenografted into three groups of nude mice. [score:1]
Figure 4SGC-7901 gastric cancer cells were stably transfected with Lenti-miR-126 (A) Lenti-miR-NC (B) lenti-anti-miR-126 (C) Lenti-anti-miR-NC (D) or treated only with enhanced infection solution (ENI. [score:1]
To further clarify the role of miR-126 in the neovascularization of gastric cancer, we set out to determine whether miR-126 has relationship with angiogenic factors. [score:1]
The relationships of VEGF-A to MVD and miR-126 expression level were further evaluated in gastric cancer. [score:1]
SGC-7901 gastric cancer cells were stably transfected with Lenti-miR-126 (A) Lenti-miR-NC (B) lenti-anti-miR-126 (C) Lenti-anti-miR-NC (D) or treated only with enhanced infection solution (ENI. [score:1]
Now the results from our in vitro experiment also suggested that MAPK/ERK and Akt/m-TOR signaling pathway involed in miR-126/VEGF-A signaling pathway in gastric cancer. [score:1]
To confirm miR-126 function in vivo, 1 × 10 [7] SGC-7901 cells stably transfected with lenti-miR-126, lenti-miR-NC or lenti-anti-miR-126 were injected subcutaneously into the right armpit of three groups of 18–26g male BALB/c nude mice (8 mice/group). [score:1]
For gastric cancer, miR-126 was also found to associated with clinic pathological features, including tumor size, lymph node metastasis, local invasion and tumor-node-metastasis (TNM) stage. [score:1]
Therefore, the present data from our studies indicate that miR-126 is a brake for gastric cancer angiogenesis, and dysfunction of miR-126 leads to tumor growth. [score:1]
More importantly, the correlation line showed that the MVD was negatively correlated with miR-126 (Fig. 1D). [score:1]
Another plasmid pLV-miR-126 was designed to deliver miR-126 contained a 655 bp genomic insert under control of the CMV promoter. [score:1]
In vivo tumor xenograft mo delTo confirm miR-126 function in vivo, 1 × 10 [7] SGC-7901 cells stably transfected with lenti-miR-126, lenti-miR-NC or lenti-anti-miR-126 were injected subcutaneously into the right armpit of three groups of 18–26g male BALB/c nude mice (8 mice/group). [score:1]
Figure 6SGC-7901 cells stably transfected with lenti-miR-126, lenti-miR-NC or lenti-anti-miR-126 were subcutaneously xenografted into three groups of nude mice. [score:1]
As indicated in Figure 7A and C, the amount of VEGF-A antigen -positive cells was significantly lower in the tumor derived from lenti-miR-126 group than that in the control group and lenti-anti-miR-126 group. [score:1]
Cells were cultured and transfected with pMIR/VEGF-A or pMIR/VEGF-A/mut with or without pLV-miR126-Precursor and control-Precusor plasmids using Lipofectamine reagent (Invitrogen). [score:1]
Microvessel density (MVD) is higher in gastric carcinoma tissue and is inversely correlated with miR-126. [score:1]
However in gastric cancer, the effect of miR-126 on angiogenesis remains unclear. [score:1]
However, there were some controversies for miR-126 in gastric cancer. [score:1]
SGC-7901 cells were cultured and transfected with pMIR/VEGF-A or pMIR/VEGF-A/mut with or without pLV-miR126-Precursor and control-Precusor. [score:1]
[1 to 20 of 95 sentences]
5
[+] score: 305
By comprehensive analysis of miRanda, TargetScan, and PicTar algorithms, LRP6 was chosen as a candidate target of mir-126 (Figure  4A), which had been reported to have a suppressive role of metastasis in HCC and reported as a target in 293 T cells [21]. [score:9]
Like reported in other researches in 293 T cells [16, 17], we demonstrated that miR-126-3p was shown to directly bind to the 3′UTR of PIK3R2 by both up-regulation and inhibition of miR-126-3p in Hep-G2 and BEL-7402 cells (Figure  4B). [score:7]
Here, we, for the first time, illuminate down-regulation of miR-126-3p expression in HCC. [score:6]
We observed that the miR-126-3p expression levels in HCC tissues and cells were significantly down-regulated. [score:6]
In this study, we demonstrate that the down-regulation of miR-126-3p promotes metastasis and angiogenesis by targeting LRP6 and PIK3R2 in HCC. [score:6]
In 70 pairs of HCC tissues, the expression of miR-126-3p was significantly down-regulated in tumors tissues versus adjacent non-tumor liver tissues (Figure  1A). [score:6]
Here, we demonstrated that overexpression of miR-126-3p led to down-regulation of LRP6 and its downstream beta-catenin in vitro and in vivo studies. [score:6]
3) The effects of miR-126-3p overexpression on metastasis and angiogenesis could be phenocopied by suppression of LRP6 and PIK3R2. [score:5]
MiR-126-3p inhibits HCC metastasis by directly targeting LRP6. [score:5]
We then disclosed that miR-126-3p inhibited metastasis and angiogenesis by targeting LRP6 and PIK3R2, respectively. [score:5]
Next, we searched for a candidate target gene responsible for metastasis suppression of miR-126-3p in HCC cells. [score:5]
2) Overexpression of miR-126-3p decreased the luciferase reporter activity of wild-type 3′UTR but not mutant 3′UTR of LRP6 and PIK3R2 and inhibition of miR-126-3p possessed the opposite results. [score:5]
Through gain- and loss- of function studies, we showed that miR-126-3p dramatically inhibited HCC cells from migrating and invading extracellular matrix gel and suppressed capillary tube formation of endothelial cells in vitro. [score:5]
Further the inhibition of miR-126-3p enhanced the expression of PIK3R2 and P-AKT (Figure  4C). [score:5]
Among the predicted targets of miR-126-3p, we chose PIK3R2 as the potential target mediating angiogenesis of mir-126, which is well known to phosphorylate AKT and then promoted angiogenesis [22, 23]. [score:5]
We illuminated that overexpression of miR-126-3p significantly inhibited PIK3R2/P-AKT pathway in HCC cells and xenografts. [score:5]
Similarly, miR-126-3p was down-regulated in most cancer cell lines (Figure  1B). [score:4]
Figure 4 LRP6 and PIK3R2 are direct targets of miR-126-3p. [score:4]
We then illustrated that LRP6 and PIK3R2 were direct targets of miR-126-3p in mediating anti-metastasis and anti-angiogenesis. [score:4]
Further, western blot assay indicated that the expression level of miR-126-3p inversely correlated with LRP6 as well as its downstream target beta-catenin (Figure  4C). [score:4]
Our findings demonstrate the importance of deregulation of miR-126-3p in promoting HCC progression and indicate that miR-126-3p might serves as a therapeutic target for HCC. [score:4]
MiR-126-3p has been reported to act as a tumor suppressor by targeting CRK, SOX2, IRS-1 in several cancer types [13- 15]. [score:4]
In conclusion, our results show that miR-126-3p is down-regulated in HCC. [score:4]
As LRP6/beta-catenin pathway is frequently activated in HCC [21, 30], the down-regulation of miR-126-3p might account for this phenomenon. [score:4]
And miR-126-3p has been shown to inhibit angiogenesis in cancer development [18]. [score:4]
The dual-luciferase reporter assays in Hep-G2 cells and BEL-7402 cells revealed that co-transfection of miR-126-3p mimics significantly inhibited the activity of firefly luciferase reporter with wild-type 3′UTR of LRP6 but not mutant 3′UTR of LRP6, while the inhibition of miR-126-3p revealed an opposite result (Figure  4B). [score:4]
Similar to miR-126-3p overexpression, silencing of PIK3R2 impaired the formation of capillary-like structures of HUVECs (Additional file 4: Figure S3B). [score:3]
And tumor sizes of miR-126-3p overexpression group were much smaller, which might be attributed to less microvessels. [score:3]
These results provided strong evidence that LRP6 is a target of miR-126-3p in HCC and mediates the metastasis function of miR-126-3p in HCC. [score:3]
LRP6 and PIK3R2 were identified as targets of miR-126-3p. [score:3]
Dual- luciferase reporter assay was conducted to confirm the direct binding of miR-126-3p and target genes. [score:3]
The restoration of miR-126-3p expression may be a promising strategy for HCC therapy. [score:3]
The association between mir-126 expression and clinico-pathological variables was assessed by chi-square tests. [score:3]
High miR-126-3p expression in 35 patients was classified as values at or above the 50th percentile. [score:3]
Collectively, both gain- of function (GOF) and loss- of function (LOF) studies suggest the suppressive effects of miR-126-3p on HCC cells metastasis and angiogenesis in vitro. [score:3]
The HCC cell line we selected was BEL-7402, which expressed relatively high level of miR-126-3p. [score:3]
We found that the average tumor volume of Hep-G2 cells stably overexpressing miR-126-3p was significantly smaller than their control group (Figure  3A). [score:3]
And the evidence is listed as follows: 1) the protein levels of LRP6 and PIK3R2 were decreased after overexpression of miR-126-3p in vitro or in vivo. [score:3]
In this study, we examined the expression patterns of miR-126-3p in HCC comparing to normal tissue. [score:3]
While we enhanced the expression level of miR-126-3p in HCC cells, western blot displayed a decrease protein level of PIK3R2 and phosphorylation of AKT. [score:3]
A previous study indicated that miR-126-3p associates with the recurrence rate after liver transplantation and suppresses metastasis in HCC [19]. [score:3]
For analysis of correlation between miR-126-3p expressions and clinical features, chi-square tests were used. [score:3]
Hep-G2 cells (1 × 10 [7]), which were stably expressing mir-126 or NC, were suspended in 100 μl PBS and then injected subcutaneously into the posterior flank of female BALB/c athymic nude mice. [score:3]
Both gain and loss of function indicated miR-126-3p suppressed metastasis and angiogenesis in HCC cells. [score:3]
Low expression of miR-126-3p in 35 patients was classified as values below the 50th percentile. [score:3]
Then we carried out loss-of function study by using miR-126-3p inhibitor, which dramatically decreased the endogenous level of miR-126-3p to further verify the function of miR-126-3p in HCC (Additional file 2: Figure S1C). [score:3]
The expression levels of miR-126-3p in HCC tissues and cells were detected by RT-PCR. [score:3]
Obviously, the MVD level was inversely correlated with miR-126-3p expression (Figure  3C). [score:3]
Hep-G2 and BEL-7402 cells were seeded in a 24-well plate until 50-70% confluence and then were co -transfected with miR-126-3p or NC and 100 ng of firefly luciferase reporter plasmid that contained either the wild-type or mutant 3′UTR of the target gene. [score:3]
MiR-126-3p repressed HCC angiogenesis by negatively regulating PIK3R2/P-AKT expression. [score:3]
Anti-miR-126-3p inhibitor was purchased from Invitrogen. [score:3]
As a result, si-LRP6 suppression attenuated the pro-metastasis effects of anti-mir-126 (Figure  5A,B). [score:3]
Additional file 2: Figure S1 RNA oligoribonucleotide and lentiviral transduction effects on miR-126-3p expression in HCC cells. [score:3]
The expression of miR-126-3p was analyzed by RT-PCR and normalized to an endogenous control (U6 RNA). [score:3]
These data suggests that miR-126-3p suppresses angiogenesis in HCC through PIK3R2/P-AKT pathway. [score:3]
Expression levels of miR-126-3p were determined by qRT-PCR and normalized to an endogenous control (U6 RNA). [score:3]
Therefore, the new miR-126-3p /PIK3R2/P-AKT pathway might serve as a promising therapeutic target, at least in terms of angiogenesis. [score:3]
Figure 1 The expression levels of miR-126-3p in HCC tissues and HCC cell lines. [score:3]
Our results showed that miR-126-3p expression was not significantly associated with any single clinicopathological features (Table  1). [score:3]
In addition, in these 70 HCC cases, miR-126-3p level was inversely correlated with LRP6 expression (Figure  3D). [score:3]
The results above indicate that miR-126-3p suppresses tumor proliferation and angiogenesis in vivo. [score:3]
MiR-126-3p is significantly down-regulated in liver cancer tissues and liver cancer cells. [score:3]
Additionally, PIK3R2, which has been reported to be a target of miR-126-3p [16, 31], was verified to be inversely correlated with miR-126-3p. [score:3]
Moreover, in the same 70 HCC tissues, the expressions of miR-126-3p and CD34 also revealed an inverse correlation. [score:3]
As expected, suppression of miR-126-3p in BEL-7402 promoted the ability of metastasis and angiogenesis (Additional file 3: Figure S2A,B). [score:3]
Furthermore, overexpression of miR-126-3p significantly reduced the volume of tumor and microvessel density in vivo. [score:3]
So restoration of miR-126-3p might be a candidate therapeutic target for HCC patients. [score:3]
Lentivirus -mediated overexpression of miR-126-3p was verified by qRT-PCR. [score:3]
TCM from HepG2 or SMMC-7721 cells transfected with miR-126-3p mimics inhibited HUVECs to form capillary-like structures compared with TCM from cells transfected with NC (Figure  2C). [score:2]
Moreover, IHC of xenografts from the miR-126-3p group showed dramatically lower expression of LRP6 compared to the NC group (Figure  4D). [score:2]
To explore the potential role of miR-126-3p in HCC metastasis, we transfected HCC cells with miR-126-3p mimics (Additional file 2: Figure S1C) and performed in vitro transwell assays in HepG2 and SMMC-7721 cells, which displayed lowest expressions of miR-126-3p. [score:2]
To further validate the role of miR-126-3p in HCC, we performed in vivo assays by subcutaneously injecting Hep-G2 cells stably expressing miR-126-3p or control vector (Additional file 2: Figure S1B). [score:2]
Figure 3 Mir-126-3p suppresses tumor growth and angiogenesis in vivo. [score:2]
MiR-126-3p inhibits tumor proliferation and angiogenesis in vivo. [score:2]
As shown in Figure  3B, the group of miR-126-3p overexpression displayed dramatically lower level of CD34, compared to the group of NC. [score:2]
Our results demonstrates that deregulation of miR-126-3p contributes to metastasis and angiogenesis in HCC. [score:2]
We then investigate the underlying mechanism and find that miR-126-3p possesses the effects by direct targeting LRP6 and PIK3R2. [score:2]
As both in vitro and in vitro assays showed that miR-126-3p inhibited angiogenesis, we then explored the molecular mechanism underlying the effects. [score:2]
Both gain- of function and loss- of function assays indicate that miR-126-3p suppresses metastasis and angiogenesis in HCC cells. [score:2]
MiR-126-3p inhibits tumor metastasis and angiogenesis in vitro. [score:2]
Tumors of lenvi-miR-126 displayed lower microvessel density. [score:1]
So, restoration of miR-126-3p may represent a promising strategy for anti-HCC therapy. [score:1]
Silencing LRP6 and PIK3R2 had similar effects of miR-126-3p restoration on metastasis and angiogenesis individually in HCC cells. [score:1]
However the underlying mechanism of miR-126-3p in HCC remains unclear. [score:1]
To investigate the clinical relevance of miR-126-3p in HCC, the median of all 70 cases was chosen as the cutoff point for separating low-miR-126-3p (n = 35) from high-miR-126-3p expressing tumors (n = 35). [score:1]
Moreover in vivo study verified the anti-angiogenesis function of miR-126-3p. [score:1]
We further performed “rescue” study in Hep-G2 cells, namely, TCM from co-transfection of miR-126-3p mimics and PIK3R2-ORF partially attenuated the anti-angiogenesis effects of TCM from miR-126-3p mimics (Figure  5C). [score:1]
Then we also measured miR-126-3p expression in a panel of human HCC cell lines as wells as normal liver cell line L02. [score:1]
The data above suggests that miR-126-3p decreases in both liver cancer tissues and cells. [score:1]
PIK3R2/P-AKT pathway, which is closely related to angiogenesis [22, 23], mediates the effects of miR-126-3p anti-angiogenesis. [score:1]
The potential role of miR-126-3p in HCC angiogenesis remains unclear. [score:1]
4) miR-126-3p level was inversely correlated with LRP6 and PIK3R2 in HCC tissues. [score:1]
The mutant miR-126-3p binding site was generated in the complementary site for the seed region of miR-126-3p. [score:1]
In a previous study, miR-126-3p has been reported to be associated with poor survival after liver transplantation by promoting metastasis in HCC [19]. [score:1]
In addition, the rescue experiments indicated that the metastasis and angiogenesis functions of miR-126-3p were mediated by LRP6 and PIK3R2. [score:1]
For lentiviral vector construction, the oligonucleotide of mature miR-126-3p (5′-ucguaccgugaguaauaaugcg -3′) was chemosynthesized, amplified and cloned into GV209-Puro Vectors by Genechem Co. [score:1]
Among these 70 cases, 62 cases revealed a relative lower level in HCC, which suggested that reduction of miR-126-3p was a frequent event in human HCC. [score:1]
Figure 5 The effects of LRP6 and PIK3R2 alterations on miR-126-3p functions in Hep-G2 cells. [score:1]
To verify the vital role of LRP6 in mediating miR-126-3p’s effects on metastasis, BEL-7402 cells were co -transfected with anti-miR-126-3p and si-LRP6. [score:1]
The median of all 70 cases was chosen as the cutoff point for separating low miR-126-3p group (n = 35) from high miR-126-3p group (n = 35) in (C). [score:1]
And co -transfected of si-LRP6 or restoration of PIK3R2 partly abrogated the effects induced by anti-miR-126-3p or miR-126-3p mimics, respectively. [score:1]
Besides, 70 HCC tissues and subcutaneous tumors from mice also indicated an inverse correlation of miR-126-3p and PIK3R2 (Figures  3C, 4D). [score:1]
Then, we further analyzed the association between miR-126-3p level and angiogenesis in the same 70 human HCC tissues. [score:1]
Furthermore, the miR-126-3p level was inversely correlated with LRP6 and PIK3R2 in HCC tissues. [score:1]
[1 to 20 of 104 sentences]
6
[+] score: 295
Furthermore, the overexpression and inhibition of miR-126 in esophageal cancer cells could downregulate or upregulate the expression of VEGF-A both at the mRNA and protein levels (Fig.   2b–d). [score:13]
Crawford discovered that miR-126 can suppress lung cancer invasion by directly targeting CRK [18], and Liu reported that miR-126 suppresses the expression of VEGF-A, inhibiting cancer cell growth [19]. [score:12]
It has been demonstrated that downregulated miR-126 increases VEGF-A activity in oral cancer, lung cancer and breast cancer [16, 19, 27] and that miR-126 may act as a tumor suppressor by regulating VEGF-A expression in esophageal cancer. [score:9]
Based on luciferase activity assays, we found that VEGF-A is a direct target of miR-126and confirmed that miR-126 negatively regulates VEGF-A expression in overexpressed miR-126 esophageal cancer cells from the lines JH-EsoAd1, OE19 and OE33. [score:8]
In conclusion, miR-126 was naturally complementary to the VEGF-A 3’-UTR and could downregulate overexpression of VEGF-A in esophageal cancer cells, thus inhibiting the esophageal cancer growth. [score:8]
These results revealed that miR-126 could inhibit esophageal cancer growth by downregulating VEGF-A expression. [score:8]
In addition, miR-126 was identified as a tumor suppressor in gastric cancer and as an inhibitor of V-crk avian sarcoma virus CT10 oncogene homolog-like (CRKL)thanks to its targeting of the 3’ UTR region of CRKL mRNA [9] or VEGF-A mRNA [10]. [score:7]
These results demonstrate that overexpression of miR-126 could inhibit VEGF-A expression. [score:7]
Inhibition of VEGF-A expression in esophageal cancer cells with miR-126 overexpression. [score:7]
These results suggest that miR-126 could inhibit VEGF-A expression and then inhibit esophageal cancer cell proliferation in vitro. [score:7]
Liu et al. discovered that microRNA126-3p (miR-126) was significantly downregulated in esophageal squamous cell carcinoma (ESCC), and its downregulation correlated with poor ESCC prognosis. [score:7]
Furthermore, Chen et al. also suggested that the downregulation of miR-126 inhibited gastric tumor growth and tumor angiogenesis through activation ofAkt, mTORand Erk1/2 of VEGF-A signaling downstream genes [9, 30]. [score:6]
Our result was consistent with a previous study, which demonstrated that downregulation of miR-126 was reverse correlated with VEGF-A expression in gastric cancer. [score:6]
For the mechanism of its repression of colon cancer proliferation and invasion, Li reported that miR-126 negatively regulates the expression of CXCR4 and inhibits the RhoA/ROCK (Rho -associated proteinkinase) signalling pathway [15]. [score:6]
Compared to the lentivirus miR negative control (LV-miR-NC) and the vector without lentivirus (Mock), the expression of miR-126 in cells infected with recombinant lentivirus miR-126 was significantly increased, whereas with the treatment with anti-miR-126 inhibitor (LV-anti-miR-126), the miR-126 expression decreased significantly (Fig.   2b). [score:6]
In oral cancer, Sasahira has reported that low miR-126 expression is associated with tumour progression due to upregulation of the VEGF-A signal [16]. [score:6]
Furthermore, in ourqRT-PCR and western blot assays, we discovered that the VEGF-A expression levels were upregulated in human esophageal cancer cells and negatively correlated with miR-126. [score:5]
To understand the molecular mechanisms of miR-126 suppressing esophageal cancer cells, we searched for putative miR-126 targets. [score:5]
In vivo study showed that tumor growth was significantly suppressed by miR-126 overexpression. [score:5]
In this study, we showed that miR-126 was bound to VEGF-A 3’-UTR, which resulted in reduced expression of VEGF-A in esophageal cancer cells, which inhibited esophageal cancer growth. [score:5]
More importantly, ectopic expression of miR-126 in nude mouse inhibited tumorigenesis. [score:5]
The results revealed that exogenous expression of miR-126 could inhibit the proliferation of JH-EsoAd1, OE19 and OE33 cells (Fig.   3). [score:5]
We found that miR-126 has significantly lower expression in esophageal cancer tissues and esophageal cancer cell lines than in healthy tissues, while the expression of VEGF-A is high. [score:5]
Li found that miR-126 expression was downregulated in gastric carcinoma tissues compared with matched non-cancer tissues when assessed with qRT-PCR [8]. [score:5]
These results showed that the ectopic expression of miR-126 inhibited tumorigenesis in vivo. [score:5]
Zhu suggests that enhanced expression of miR-126 elevates the sensitivity of non-small cell lung cancer cells to anticancer therapy via negative regulation of the VEGF/PI3K/Akt/MRP1 signalling pathway [20]. [score:4]
Furthermore, they found downregulation of miR-126 was due to promoter hypermethylation of its host gene, Egfl7 [23]. [score:4]
These results suggest that VEGF-A was the direct target of miR-126. [score:4]
Vascular endothelial growth factor A (VEGF-A), which is regarded as a tumorgenesis activator, could directly target miR-126 in several tumors. [score:4]
Akt Protein kinase B CRKL V-crk avian sarcoma virus CT10 oncogene homolog-like CXCR4 c-x-c chemokine receptor type 4 EGFL7 Epidermal growth factor-like domain 7 Erk1/2 Extracellular regulated protein kinases 1/2 ESCC Esophageal squamous cell carcinoma GAPDH Glyceraldehyde-3-phosphate dehydrogenase GFP Green fluorescent protein HRP Horse reddish peroxidase LV-miR-126 Lentiviral vector-miR-126 LV-miR-NC Lentiviral vector-miR- negative control miR-126 microRNA 126 miRNA microRNA MRP1 Multi-drug resistant associate protein mTOR Mechanistic Target of Rapamycin MTT 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide OD Absorbance value PI3K Phosphatidylinositol 3 kinase RhoA Ras homolog gene family member A ROCK Rho -associated protein kinase VEGF-A Vascular endothelial growth factor A We would like to thank Dr. [score:4]
These results suggest that miR-126 as a possible negative regulatory role in VEGF-A expression. [score:4]
It has also been determined that miR-126 expression is deregulated in colorectal cancer [11– 14]. [score:4]
Furthermore, the proliferation of esophageal cancer cells with miR-126 overexpression and miR-126 knockdown was monitored using the. [score:4]
Fig. 2The expression of VEGF-A is regulated by miR-126. [score:4]
Downregulation of miR-126 increases VEGF-A activity in lung cancer [5] and breast cancer [6]. [score:4]
Effect of miR-126 expression on the progression of esophageal cancer in vivo. [score:3]
a qRT-PCR analysis of miR-126 expression in 13 esophageal cancer tissues and paired adjacent normal tissues. [score:3]
The expression levels of miR-126 in 13 esophageal cancer tissue samples and paired adjacent normal tissue samples were determined using quantitative RT-PCR. [score:3]
b qRT-PCR analysis of miR-126 expression in three esophageal carcinoma cell lines and a control cell line. [score:3]
In lung carcinoma, miR-126 expression was found to be reduced [17]. [score:3]
a Relative firefly luciferase units in 293 cells transfected with WT VEGF-A or Mut VEGF-A. b Expression of miR-126 and VEGF-A in 293 cells treated with different vectors. [score:3]
Fig. 1Expression of miR-126 and VEGF-A in esophageal cancer tissues and esophageal carcinoma cell lines. [score:3]
The results showed that the expression level of miR-126 was approximately 7 times lowerin all 13 esophageal cancer tissue samples than that in the normal tissues (Fig.   1a). [score:3]
VEGF-A is a target gene of miR-126. [score:3]
This has led to the hypothesis that VEGF-A is atarget for miR-126. [score:3]
In this study, the expression of miR-126 and VEGF-A were assessed in esophageal cancer tissues and esophageal cancer cell lines. [score:3]
The results showed that miR-126 could inhibit esophageal cancer cell proliferation in vitro. [score:3]
Expression of miR-126 and VEGF-A in esophageal cancer tissue samples and cells. [score:3]
miR-126 inhibits cell proliferation in esophageal cancer. [score:3]
miRNA-126 (miR-126), an endothelial cell-restricted miRNA, was found to regulate developmental angiogenesis [2]. [score:3]
We confirmed that VEGF-A is a target for miR-126. [score:3]
These studies suggest that miR-126 is a potential tumor suppressor gene. [score:3]
To further clarify this, the was carried out, and the results showed that miR-126 could inhibit esophageal cancer cells proliferation in vitro. [score:3]
Compared with the control cell lines, the expression levels of miR-126 in the esophageal carcinoma cell lines were also significantly lower (Fig.   1b). [score:2]
Therefore, this study focused on the regulatory functions of miRNA-126 in the progression of esophageal cancer. [score:2]
miR-126 is a key regulator of oncogenic processes. [score:2]
We found miR-126 had lower expression in esophageal cancer samples compared to adjacent normal samples around the cancer, which is consistent with earlier results [25]. [score:2]
To find direct targets of miR-126, luciferase activity was measured by the co-transfection of the VEGF-A wild-type 3’-UTR with miR-126. [score:2]
miR-126 Esophageal cancer VEGF-A Tumorgenesis Cell proliferation Lentivirus package Xenograft mo del Over the past few decades, esophageal cancer incidence and mortality increased worldwide. [score:1]
Based on these reports, we postulate that miR-126 plays a critical but as-yet-unknown role in human esophageal cancer. [score:1]
However, in some cases, miR-126 supports cancer progression via promotion of blood vessel formation [3]. [score:1]
The effect of miR-126 was also detected in BALB/c nude mice with transplanted esophageal cancer cells. [score:1]
Fig. 4The effects of miR-126 on tumor growth in nude mice inoculated with esophageal cancer cells. [score:1]
Hu discovered that miRNA-126 failed to show a relationship to the outcome of patients with esophageal adenocarcinoma [26]. [score:1]
Lentiviral constructs contained miR-126 (LV-miR-126) and anti-miR-126 (LV-anti-miR-126) along with the miR negative control (LV-miR-NC). [score:1]
This indicts that miR-126 might play a negative role in esophageal carcinogenesis. [score:1]
c Effects of LV-miR-126 on OE33. [score:1]
The lentiviral vector pCDH-CMV (pLV, System Biosciences, SBI) was used to construct the pLV-mir-126 plasmid. [score:1]
However, the effect of miR-126 in esophageal cancer remains unclear. [score:1]
The relative levels of miR-126 transcripts were normalized to the control U6 mRNA. [score:1]
The average tumor weight of mice inoculated with lenti-miR-126 -transfected OE33 cells was significantly lower on day 42 (p < 0.01) than that for mice inoculated with anti-miR-126 transfected OE33 cells and the miR-NC negative control group. [score:1]
The template was the human genome DNA of miR-126 (Accession number: NCBI Reference Sequence: NR_029695.1). [score:1]
suggested similar effects of miR-126 on cell proliferation. [score:1]
The dataset of human genome DNA of miR-126 supporting the conclusions of this article is available in the Genbank (NCBI) repository (Assession number: NR_029695.1, Gene ID: 262205369, http://www. [score:1]
miR-126 is located within intron 7 of epidermal growth factor-like domain 7 (EGFL7). [score:1]
b Effects of LV-miR-126 on OE19. [score:1]
1 × 10 [7] cells stably transfected with LV-miR-126, LV-anti-miR-126 and lenti-miR-NC were injected subcutaneously into the right foreleg armpit of three groups of 18–26 g male BALB/c nude mice (8 mice/group) to establish a cancer mo del. [score:1]
a Effects of LV-miR-126 on the cell line JH-EsoAd1. [score:1]
We believe that restoring miR-126 levels may be a promising therapeutic approach in cases of esophageal cancer. [score:1]
However, there were some controversies for miR-126 in esophageal cancer. [score:1]
The miRNA decreased luciferase activity, whereas this effect was completely ablated by deletion of the miR-126 -binding site in the VEGF-A 3’-UTR (Fig.   2a). [score:1]
[1 to 20 of 81 sentences]
7
[+] score: 281
Then, the direct effect of miR-126 mimics on the expression of p85β in Tregs was detected and similar result was found that miR-126 mimics could obviously inhibit p85 expression in Tregs (data not shown). [score:8]
On day five, we further isolated CD25 [+] T cells in iTregs differentiation condition, which highly expressed Foxp3 and could potently inhibit the proliferation of CD4 [+]CD25 [−]T cells (data not shown), and found that CD25 [+] T cells also expressed higher level of miR-126 compared with CD25 [+] T cells in Th0 differentiation condition (Fig. 1D, P < 0.05), indicating miR-126 also was highly expressed on iTregs. [score:8]
And this finding also was confirmed by the use of Akt inhibitor, combining these data suggested that miR-126 regulated the induction and function of Tregs through targeting p85β and subsequently altering PI3K-Akt pathway activity. [score:6]
The expression of miR-126 on both Tregs and Tconv also were up-regulated upon 12 hrs of activation (Fig. 1B, P < 0.05). [score:6]
Consistently, our data showed that silencing of miR-126 could enhance the activation of PI3K-Akt pathway in Tregs through up-regulation expression of p85β. [score:6]
These data strongly suggested that silencing of miR-126 reduced the expression of Foxp3 through up -regulating PI3K/Akt pathway, which ultimately altered the induction and suppressive function of Tregs. [score:6]
These data demonstrated a previously unknown role of miR-126 in Tregs induction and function sustainment through regulating the transduction of PI3K-Akt pathway and provided a novel insight into the development of therapeutic strategy for promoting T-cell immunity by regulating Tregs through targeting specific miRNAs. [score:6]
Figure S3 p85beta RNAi downregulated the expression of p85beta in miR-126 ASO transfected Tregs. [score:6]
Similarly, recent evidence showed that miR-126 could regulate the function of CD4 [+]Th2 cells and successively alter the development of allergic airways disease [21]. [score:5]
These data demonstrated that miR-126 silencing could impair the expression of Foxp3 in Tregs and subsequently alter its functional molecules expression. [score:5]
Recently, one group reported that overexpression of miR-126 could cause T-cell hyperactivity through targeting to DNA methyltransferase 1 (DNMT1) [20]. [score:5]
As shown in Figure 3C, the expression level of Foxp3 on Tregs also decreased significantly in miR-126 ASO -transfected group, accompanied by reduced expression level of CTLA-4 and GITR, as well as IL-10 and TGF-β (Fig. 3C and D, P < 0.05). [score:5]
To identify the inhibition efficiency of miR-126 ASO, we also detected and found the expression of miR-126 in miR-126 ASO -transfected group decreased about 70% (Fig. 2D, P < 0.05). [score:5]
To further confirm whether this enhanced activation of PI3K-Akt pathway was responsible for reduced expression of Foxp3 in Tregs, we further cotransfected p85β RNAi into Tregs and found that p85β RNAi could abrogate the effect of miR-126 ASO on the expression of Foxp3 in Tregs (Fig. 5B, P < 0.05). [score:5]
Overexpression of miR-126 could block PI3K-Akt activation, and trigger ischaemic angiogenesis, suppress tumour growth [17– 19]. [score:5]
As shown in Figure 1C, the expression of miR-126 increased during the induction of Tregs, accompanied by elevated proportion of CD4 [+]Foxp3 [+] T cells in vitro experimental system wherein the activation of CD4 [+] CD25 [−] cells in the presence of TGF-β and IL-2 induces de novo expression of Foxp3 (P < 0.05). [score:5]
Next, we further investigated whether miR-126 silencing could enhance the expression of p85β and successively regulate the transduction of TCR -mediated PI3K/Akt pathway which ultimately influenced the expression of Foxp3 in Tregs. [score:4]
Moreover, we also found that the expression of miR-126 in miR-126 ASO -expressing cells (GFP [+] infected cells) decreased significantly compared with GFP [−] uninfected cells (Fig. 2G, P < 0.05). [score:4]
And other research works reported miR-126 could target to p85β and regulate the transduction of PI3K/Akt pathway [17, 18]. [score:4]
Previous study showed that miR-126 could repress the expression of p85β and subsequently reduce the activation of PI3K-Akt pathway, regulating ischaemic angiogenesis and tumour growth [17, 18]. [score:4]
Further evidence showed that miR-126 regulated the transduction of PI3K-Akt pathway, which ultimately influenced the induction and sustained suppressive function of Tregs. [score:4]
Together with highly expressed miR-126 in Tregs, our data provided evidence that miR-126 acted as an important regulator for adaptive immune response through impacting on the induction and function of Tregs. [score:4]
As shown in Figure 3A, the expression level of Foxp3 on Tregs in miR-126 ASO -transfected group decreased obviously compared with that in the control group, accompanied by about 70% decrease in miR-126 expression (data not shown). [score:4]
These data provided a novel insight on the functional role of miR-126 in Tregs and might help for the development of new therapeutic strategy based on Tregs for promoting T-cell immunity–related disease. [score:4]
As shown in Figure 5A, the expression of p85β in miR-126 ASO -transfected group increased about 2.5 times (P < 0.05). [score:3]
In line with our above findings, miR-126 ASO transfection significantly reduced the expression of miR-126 (data not shown), but did not alter the total cell number in each group (Fig. 2J, P > 0.05). [score:3]
In this study, we first found that silencing miR-126 could alter both the induction and suppressive function of murine and human Tregs. [score:3]
Fig. 3Silencing of miR-126 altered the expression of Foxp3 and functional molecules on Tregs. [score:3]
Silencing of miR-126 altered the expression of Foxp3 in Tregs. [score:3]
To analyse the kinetics of miR-126 expression upon activation, a time course experiment was performed. [score:3]
Then, to further confirm these findings, we constructed retrovirus expression miR-126 ASO (termed as miR-126 ASO LV) and encoded a GFP marker which allowed the discrimination between infected and non-infected cells in the same cultures. [score:3]
These findings demonstrated that silencing of miR-126 could impair suppressive activity of Tregs. [score:3]
MiR-126 is one of the miRNA most abundantly expressed in endothelial cells, and heart, lung and other highly vascularized murine tissue [14– 16]. [score:3]
CD4 [+] CD25 [−] T cells infected with retrovirus encoding either empty vector control (Ctrl-LV) or miR-126 ASO (miR-126 ASO LV) were stimulated with anti-CD3/CD28 antibody in the presence of TGF-β and IL-2. After 4 days, the expression level of Foxp3 was analysed by FACS (E) and the percentages of cells positive for Foxp3 are shown (F). [score:3]
Silencing of miR-126 impaired suppressive activity of Tregs. [score:3]
CD4 [+] CD25 [+] T cells (Tregs) purified from splenocytes of normal Balb/c mice by MACS were transiently transfected with miR-126 ASO (10 ng) or Scramble control (10 ng), and then cultured in the presence of anti-CD3/CD28 plus IL-2 (50 IU/ml) for 48 h. The expression of p85β, Akt and mTOR or phosphorylation level of Akt and mTOR were analysed by Western blot (A). [score:3]
In this study, we reported that miR-126 was expressed on murine and human Tregs. [score:3]
To confirm this finding, we also detected the expression of Foxp3 on Tregs in miR-126 ASO LV infected group. [score:3]
Our data showed that p85β RNAi could significantly reduce the expression of p85β in miR-126 ASO -transfected Tregs (Supporting Information Figure S3A and B, P < 0.05). [score:3]
Fig. 4Silencing of miR-126 impaired suppressive activity of Tregs. [score:3]
Furthermore, p85β RNAi could reverse the effect of miR-126 silencing on Tregs induction and suppressive function. [score:3]
Our data showed that fresh Tregs and fresh Tconv expressed similar level of miR-126 (Fig. 1A). [score:3]
Recent evidence further showed that miR-126 was also functional expressed in T cells [20]. [score:3]
Consistently, we also found that miR-126 ASO significantly enhance the expression of p85β, as well as phosphorylated Akt and phosphorylated mTOR, in the induction of Tregs (Supporting Information Figure S2, P < 0.05). [score:3]
All these data suggested that Tregs expressed miR-126 which might be involved in the induction and function of Tregs. [score:3]
Fig. 1The expression of miR-126 on Tregs. [score:3]
Importantly, silencing of miR-126 could reduce the induction of Foxp3 in CD4 [+]T cells and impair suppressive function of Tregs. [score:3]
The expression of miR-126 on Tregs. [score:3]
As shown in Figure 2E and F, the effect of miR-126 ASO was specific and intrinsic for induction of Tregs, which was demonstrated by the impaired induction in miR-126 ASO -expressing cells (GFP [+] infected cells), but not GFP [−] uninfected cells. [score:3]
Figure S2 Silencing of miR-126 enhanced the expression of p85beta, pAkt and pmTOR in the induction of Tregs. [score:3]
After 48 hrs of activation, the expression level of miR-126 in Tregs was higher than that in Tconv (Fig. 1A, P < 0.05). [score:3]
CD4 [+] CD25 [+] T cells (Tregs) purified from splenocytes of normal Balb/c mice by MACS were transiently transfected with miR-126 ASO (10 ng) or Scramble control (10 ng), and then cultured in the presence of anti-CD3/CD28 plus IL-2 (50 IU/ml) for 48 h. The expression of Foxp3, GITR and CTLA-4 were analysed by FACS (A). [score:3]
293FT cells (Invitrogen) were transfected with retroviral expression plasmids (MSCV IRES-GFP), either empty or encoding the miR-126 ASO and the packaging construct pcl-ECO using TransIT-293 (Mirus, Temple Avenue, London, UK) as previously described [13], according to the manufacturer's instructions. [score:3]
MiR-126 regulated Foxp3 expression through PI3K-Akt pathway. [score:3]
We further confirmed these findings in human Tregs and found that miR-126 ASO also impaired the suppressive activity of human Tregs in vitro (Fig. 4E–G, P < 0.05). [score:3]
Next, we further detected the expression of miR-126 on inducible Tregs (iTregs). [score:3]
However, p85β RNAi did not alter the expression of p85α in miR-126 ASO -transfected Tregs (Supporting Information Figure S3B, P > 0.05). [score:3]
This finding suggested that miR-126 might be a novel potential target in Tregs -based therapeutic strategy for immunotherapy against tumour. [score:3]
Here, we further showed that silencing of miR-126 could significantly impair the suppressive effect of Tregs and finally endow effective antitumour effects of CD8 [+] T cells in vivo. [score:3]
These data suggested that miR-126 silencing could reduce the expression of Foxp3 in Tregs. [score:3]
Finally, human CD25 [+] T cells (iTregs) also expressed high level of miR-126 (Fig. 1G, P < 0.05). [score:3]
As shown in Figure 4A–C, we found that silencing of miR-126 significantly impaired the inhibitory capacity of Tregs on the proliferation of CD4 [+]CD25 [−]T cells in vitro (P < 0.05). [score:3]
The expression of miR-126 was detected using at 48 h or indicated time-point. [score:3]
The expression of miR-126 was detected by assay at indicated time-point. [score:2]
Furthermore, we found that the expression of Granzyme B and the proliferation of CD8 [+]T cells in miR-126 ASO -transfected Tregs cotransferred group also significantly increased compared with those in control group (Fig. 6C and D, P < 0.05). [score:2]
Given that silencing of miR-126 could impair the suppressive activity of Tregs, we next explored the possible application of miR-126 ASO on the function of Tregs in vivo using an adoptive cell transfer assay in a murine mammary cancer mo del. [score:2]
After 5 days, CD25 [+] cells in each differentiation condition were isolated by MACS, respectively, and the expression of miR-126 was determined by assay. [score:2]
Silencing of miR-126 in Tregs endowed effective antitumour effect of CD8 [+] T cells in a murine mammary cancer mo delGiven that silencing of miR-126 could impair the suppressive activity of Tregs, we next explored the possible application of miR-126 ASO on the function of Tregs in vivo using an adoptive cell transfer assay in a murine mammary cancer mo del. [score:2]
Altogether, our present study showed that miR-126 played an important role in the induction and function sustainment of Tregs through regulating PI3K/Akt pathway. [score:2]
We further demonstrated that silencing of miR-126 on Tregs could endow an effective antitumour effect of CD8 [+] T cells in vivo. [score:1]
However, the possible functional role of miR-126 in Tregs remains to be elucidated. [score:1]
As shown in Figure 6A and B, IFN-γ production in CD8 [+]T cells in control ASO -transfected Tregs cotransferred group was 4.72%, while it increased dramatically to 12.06% in miR-126 ASO -transfected Tregs cotransferred group (P < 0.05). [score:1]
Quantification of data was analysed using the LightCycler analysis software version 4.5. miR-126 ASO, p85β RNAi and the corresponding control oligonucleotides were purchased. [score:1]
As shown in Figure 2A, the cell number in miR-126 ASO -transfected group was equal to those in control groups in the end of culture (P > 0.05), suggesting that miR-126 ASO did not influence the proliferation of cells. [score:1]
The suppressive activity of Tregs transfected with miR-126 ASO also were determined by [[3]H]-incorporation assay (E) and CFSE labelling assay (F and G) as described above. [score:1]
To investigate the efficiency and specificity of p85β RNAi on Tregs in miR-126 ASO -transfected group, we further detected the expression of total p85, p85α and p85β on Tregs in miR-126 ASO -transfected group. [score:1]
CD4 [+] CD25 [−] T cells were isolated from splenocytes of normal Balb/c mice and stimulated with anti-CD3/CD28 antibody in the presence of TGF-β and IL-2 for 24 h, and then were transiently transfected with miR-126 ASO (10 ng) or scramble control (10 ng). [score:1]
2′-OMe -modified antisense oligonucleotides of miR-126 (termed as miR-126 ASO: GCAUUAUUACUCACGGUACGA) and corresponding scramble control (Integrated DNA Technologies, Commercial Park Coralville, IA, USA), miR-126 mimics and corresponding scramble controls were purchased from Ambion. [score:1]
Fig. 2Silencing of miR-126 reduced the induction of Tregs. [score:1]
Thus, it seemed that other potent target molecules of miR-126, which were not screened and investigated in this study, might have also contributed to the effect of miR-126 on the induction and function sustainment of Tregs, which still remains to be explored in successive study. [score:1]
Combining these data strongly suggested that silencing of miR-126 could significantly reduce the induction of Tregs. [score:1]
CD4 [+]CD25 [−] T cells were purified from from healthy donors (n = 6) by FACS sorting and cultured in the condition of induction of Tregs for 24 h and then were transiently transfected with miR-126 ASO (10 ng) or scramble control (10 ng). [score:1]
Moreover, the level of phosphorylation of Akt and phosphorylation of mTOR increased significantly in miR-126 ASO -transfected group compared with those in control group (Fig. 5A), indicating that miR-126 could regulate the activation of PI3K/Akt pathway in Tregs. [score:1]
Silencing of miR-126 in Tregs endowed effective antitumour effect of CD8 [+] T cells in a murine mammary cancer mo del. [score:1]
Silencing of miR-126 reduced the induction of Tregs. [score:1]
We next investigated whether miR-126 silencing could influence the suppressive activity of Tregs. [score:1]
Then, 1 × 10 [6] CFSE -labelled cells were injected into 4T1-bearing nude mice through tail vein with or without CD4 [+] CD25 [+] T cells transfected with miR-126 ASO or Scramble control at a ratio of 2:1. Twenty-four hours later, the 4T1-bearing mice were treated with 2 mg BrdU i. p. every other day up to a cumulative dose of 8 mg BrdU. [score:1]
To investigate the possible role of miR-126 on CD4 [+]Foxp3 [+] regulatory T cells (Tregs), we first detected the expression level of miR-126 in Tregs by assay. [score:1]
And silencing of miR-126 could abrogate the function of CD4 [+]Th2 cells [21]. [score:1]
CD4 [+] CD25 [high] CD127 [−] T cells (Tregs) purified from of healthy donors (n = 6) by FACS sorting were transiently transfected with miR-126 ASO (10 ng) or Scramble control (10 ng). [score:1]
Fig. 6Silencing of miR-126 in Tregs endowed effective antitumour effect of CD8 [+] T cells in vivo. [score:1]
Furthermore, p85β RNAi also could reverse the effect of miR-126 ASO on Tregs induction (Fig. 5C, P < 0.05). [score:1]
Next, we further investigate the expression of function -associated molecules on Tregs in miR-126 ASO -transfected group. [score:1]
Given that miR-126 silencing significantly reduced the induction of Tregs, we next sought to investigate the possible effect of miR-126 silencing on the expression of Foxp3 in Tregs. [score:1]
In Tconv cells, the miR-126 level peaked after 12 hrs and rapidly decreased after 24 hrs, then reached a plateau even after 72 hrs of activation. [score:1]
All these data demonstrated that silencing of miR-126 in Tregs could endow effective antitumour effect of CD8 [+] T cells in vivo. [score:1]
Then CD8 [+] T cells were sorted from splenocytes and re-stimulated with inactivated 4T1 tumour cells for 24 h in vitro and then transferred with or without miR-126 ASO -transfected Tregs at a ratio of 2:1 into syngeneic 4T1-bearing nude mice (n = 8). [score:1]
[1 to 20 of 97 sentences]
8
[+] score: 268
Although a study identified that Ets-1 and Ets-2 can regulate the expression of microRNA-126 by targeting an Ets binding element in genomic regions upstream of the microRNA-126 and EGFL7 gene in endothelial cells [39], further studies are necessary to determine whether the above mechanism involves in the down-regulation of microRNA-126 in NSCLC. [score:9]
High expression levels of microRNA-126 expression is identified on endothelial cells, which has an important role in regulating angiogenesis and blood vessel integrity by inhibiting the VEGF pathway. [score:8]
Patients were divided into two groups based on their microRNA-126 expression levels: those with less than median of microRNA-126 expression levels and those with more than or equal to median of microRNA-126 expression levels (median: 0.654). [score:7]
In colon cancer, microRNA-126 suppresses the growth of tumor cells by targeting phosphatidylinositol 3-kinase regulatory subunit beta (p85β) [19]. [score:6]
In this study, we explore the role of microRNA-126 in NSCLC and demonstrate that it is a tumor suppressor gene and its expression level correlates with poor survival in NSCLC patients. [score:5]
Consistent with these past findings [22], our results also showed that expression levels of microRNA-126 expression correlate with poor survival in non-small cell lung cancer patients. [score:5]
Based on bioinformatics analysis for prediction targets of microRNA-126, the PIK3R2 gene was selected for the potential targets of microRNA-126. [score:5]
In summary, our data indicate that microRNA-126 is a tumor-suppressor gene in NSCLC and low microRNA-126 expression is a significantly unfavorable prognostic factor in NSCLC patients. [score:5]
To explore the molecular mechanism of microRNA-126 anti-proliferative effect on NSCLC, we used two open access programs (TargetScan and miRBase) to predict targets of microRNA-126. [score:5]
Compared with the corresponding adjacent lung tissues, microRNA-126 expression was markedly down-regulated in tumor tissues (P<0.0001). [score:5]
The expression levels of PIK3R2 and Akt phosphorylation in tumor tissues inversely correlated with the microRNA-126 expression levels (PIK3R2, Spearman r = −0.276, P<0.0001, Akt, Spearman r = −0.164, P = 0.0013, Figure 2D&E and Table 1). [score:5]
The patients with low microRNA-126 expression had significantly poorer survival time than those with high microRNA-126 expression (means for survival time (month): 24.392±1.055 vs. [score:5]
Our data indicate that microRNA-126 is a tumor-suppressor gene in NSCLC and low microRNA-126 expression is a unfavorable prognostic factor in NSCLC patients. [score:5]
And microRNA-126 repressed the activity of PI3K-Akt pathway by targeting binding sites in the 3′-untranslated region of PI3KR2 mRNA. [score:5]
In gastric cancer, over -expression of microRNA-126 significantly enhanced the anchorage -dependent and anchorage-independent cell growth by targeting SOX2 [16]. [score:5]
Some studies also show that microRNA-126 can inhibit invasion and proliferation by regulating Crk, VEGF, and EGFL7 in NSCLC [15], [21], [22]. [score:4]
However, Kaplan–Meier survival analysis revealed that the patients with low microRNA-126 expression level had significantly poor survival times compared with those with high microRNA-126 expression level (means for survival time (month):24.392±1.055 vs. [score:4]
In this study, we found that PIK3R2 gene was a direct target of microRNA-126. [score:4]
Our data aslo showed that over -expression of microRNA-126 impaired NSCLC cell proliferation and tumor growth in A549 xenografts mo del of nude mice though regulation of PI3K-Akt signaling pathway. [score:4]
These data suggested that the loss of microRNA-126 expression may involve the development and progression of NSCLC. [score:4]
The patients with low microRNA-126 expression had significantly poor survival time compared with those with high microRNA-126 expression (means for survival time (month):24.392±1.055 vs. [score:4]
MicroRNA-126 is highly expressed in lung and heart tissues but also expressed at lower levels in the brain, liver, and kidney [9]. [score:4]
f. Immunohistochemical staining of p-Akt (Ser473) in NSCLC tissue with high microRNA-126 expression levels. [score:3]
The expression level of microRNA-126 was decreased in NSCLC lines and tumor tissues. [score:3]
Therefore, further research is needed to explore the tumor suppressive functions of microRNA-126 in NSCLC. [score:3]
Expression of microRNA-126 was examined by quantitative real-time PCR in NL20 cell lines and NSCLC cell lines. [score:3]
The cell proliferation was dramatically decreased after cells were treated with microRNA-126 over -expression for 72 hours. [score:3]
Currently, microRNA-126 expression level markedly decreases in various tumor tissues, including NSCLC, colon cancers, breast cancer and gastric cancer [16]– [22], [31]. [score:3]
Genetic variant within microRNA-126 is not associated with the survival times and microRNA-126 expression levels in NSCLC patients. [score:3]
c. Immunohistochemical staining of PIK3R2 in NSCLC tissue with low microRNA-126 expression levels. [score:3]
Over -expression of microRNA-126 in NSCLC cell lines decreased cell proliferation in vitro and tumor growth in the nude mouse xenograft mo del. [score:3]
Expression of microRNA-126 was determined by quantitative real-time PCR in tumor tissues and patient-matched adjacent lung tissues. [score:3]
Our data showed that over -expression of microRNA-126 impaired NSCLC cell proliferation and tumor growth in the xenografts mo del of nude mice. [score:3]
Multivariate Cox proportional hazard regression analysis also showed that low microRNA-126 expression levels were a significantly unfavorable prognostic factor (hazard ratio, 0.782; 95% CI, 0.647 0.945) (Table 3). [score:3]
0042978.g001 Figure 1(A) Overe-xpression of microRNA-126 inhibits the cell invasion in A549 and SK-MES-1 cells. [score:3]
It is controversial whether microRNA-126 is a tumor suppressive or oncogenic miRNA. [score:3]
Expression levels of microRNA-126 in NSCLC tissues of three genotypes are similar. [score:3]
The expression levels of microRNA-126 in Non-small cell lung cancers. [score:3]
e. Immunohistochemical staining of PIK3R2 in NSCLC tissue with high microRNA-126 expression levels. [score:3]
We analyzed the associations of the microRNA-126 expression between genetic variants within microRNA-126 and clinical information including smoking status, sex, age, and histological type and the tumor stage. [score:3]
Knockdown of microRNA-126 resulted in loss of vascular integrity and hemorrhage during embryonic development of zebrafish [10]– [13]. [score:3]
Recent study demonstrates that rs4636297GG genotype significantly blocks the processing of pri-miRNA to pre-miRNA, resulting in the significantly reduced mature microRNA-126 expression [38]. [score:3]
As depicted in Table 2, it was found that the expression levels of microRNA-126 did not correlate with sex, age, histological type, or the stage of tumor in the cohort of 442 NSCLC cases. [score:3]
Low expression levels of microRNA-126 correlate with poor survival of NSCLC patients. [score:3]
Cell proliferation was decreased by 47.91% (P = 0.0006) and 36.36% (P = 0.0018), when respectively A549 and SK-MES-1 cells were respectively treated with microRNA-126 over -expression for 72 hours (Figure 1B). [score:3]
And microRNA-126 expression had no significant difference among the three genotype groups (P = 0.972). [score:3]
On the contrary, other studies showed that microRNA-126 is often referred to tumor suppressor gene in various cancers [15]– [21]. [score:3]
0042978.g003 Figure 3(A) The expression levels of microRNA-126 are decreased in NSCLC cell lines. [score:3]
0042978.g002 Figure 2(A) Putative microRNA-126 targeting site in the 3′UTR of PIK3R2. [score:3]
The expression level of microRNA-126 was also examined in a cohort consisting of 168 pairs of NSCLC tumor tissues and matched adjacent noncancerous tissues (Figure 3B). [score:3]
Moreover, some studies revealed that microRNA-126 repressed apoptosis of acute myeloid leukemia cells and enhanced the colony-forming ability of mouse bone marrow progenitor cells through targeting Polo-like kinase 2 (PLK2) [14]. [score:3]
d. Immunohistochemical staining of p-Akt (Ser473) in NSCLC tissue with low microRNA-126 expression levels. [score:3]
Levels of microRNA-126 Expression Correlate with Poor Survival in Non-small Cell Lung Cancer Patients. [score:3]
Compared with the control group, over -expression of microRNA-126 impaired cell invasion, which is consisted with previous reports (Figure 1A). [score:2]
In addition, the regulatory mechanism of microRNA-126 remains to be elucidated in different normal and malignant tissues. [score:2]
MicroRNA-126 Inhibits Tumor Cell Proliferation though PI3K-Akt Pathway in NSCLC. [score:2]
Therefore, microRNA-126 is considered as tumor suppressor genes. [score:2]
MicroRNA-126 inhibits the tumor cell proliferation though PI3K-AKT pathway in NSCLC. [score:2]
Compared with the control group, over -expression of microRNA-126 impaires cell invasion. [score:2]
Furthermore, microRNA-126 expression in both NSCLC cell lines and tumor tissues markedly decreased compared with noncancerous cells and tissues. [score:2]
Moreover, compared to the patients not responding to the first line treatment with capecitabine and oxaliplatin, microRNA-126 expression level was significantly higher in patients responding to treatment with capecitabine and oxaliplatin [23]. [score:2]
However, the regulatory mechanism of microRNA-126 remains to be elucidated in different normal and malignant tissues. [score:2]
The results shown in Figure 2F demonstrated that treatment with recovering Akt activity resulted in the statistically significant inhibition of proliferation in A549 cells and SK-MES-1 cells by transfection with pE-Mir126 vector (P<0.0001). [score:2]
And the regulatory mechanism of microRNA-126 remains to be elucidated in different normal and malignant tissues [25]. [score:2]
Compared with the immortalized bronchial epithelial NL20, microRNA-126 expression levels were obviously decreased in NSCLC cell lines, such as A549, H358, H1703, H460 and SK-MES-1 (Figure 3A). [score:2]
MicroRNA-126 inhibits cell invasion and tumor growth. [score:2]
In addition, western blot analysis revealed that the expression of PIK3R2 was impaired by treatment with pE-Mir126 vector in A549 (0.97±0.14 vs. [score:2]
Furthermore, transfection of pE-Mir126 vector rather than pE-CMV vector significantly repressed Akt phosphorylation without changing the expression levels of total Akt protein (A549 cells, 0.89±0.10 vs. [score:2]
MicroRNA-126 Inhibits and Tumor Growth. [score:2]
Mutation was generated in the 3′UTR of PIK3R2 sequence in the complementary site for the seed region of microRNA-126 as indicated. [score:2]
MicroRNA-126 expression was determined by quantitative real-time PCR. [score:2]
However, microRNA-126 level had no significant difference among the three genotype groups in our cohort of 442 NSCLC cases. [score:1]
0042978.g004 Figure 4(A) Genetic variant within microRNA-126 is not associated with survival times. [score:1]
Using pMIR- PIK3R2-REPORT WT plasmid as a template, pMIR- PIK3R2-REPORT MT plasmid, which carried the mutated PIK3R2 3′-UTR sequence in the complementary site for the seed region of microRNA-126, was generated by a KOD -Plus-Mutagenesis Kit (Toyobo, Japan) according to the manufacturer’s protocol. [score:1]
of Patients microRNA-126 P Value Age (y) 0.961 <60 209 0.66±0.32 ≥60 233 0.65±0.31 Gender 0.789 Male 341 0.66±0.31 Female 101 0.67±0.35 Smoking status Nonsmokers 125 0.69±0.32 0.387 smokers 317 0.66±0.32 Histology 0.664 Squamous cell carcinoma 212 0.68±0.33 Adenocarcinoma 208 0.65±0.32 Other 22 0.65±0.27 TNM staging 0.297 I 136 0.67±0.32 II 146 0.68±0.30 III 117 0.62±0.33 IV 43 0.70±0.31 10. [score:1]
We sequenced the genomic DNA segments including the pre-miR-126 and its respective flanking regions (±200 bp) in 442 NSCLC patients and 543 matched controls. [score:1]
All tumors growth in the mice treated with pE-Mir126 vector were significantly suppressed compared to those in PBS -treated and pE-Mir126 vector treated mice. [score:1]
However, the genetic variants of microRNA-126 are not associated with NSCLC risk and prognosis. [score:1]
of Patients microRNA-126 P Value Age (y) 0.961 <60 209 0.66±0.32 ≥60 233 0.65±0.31 Gender 0.789 Male 341 0.66±0.31 Female 101 0.67±0.35 Smoking status Nonsmokers 125 0.69±0.32 0.387 smokers 317 0.66±0.32 Histology 0.664 Squamous cell carcinoma 212 0.68±0.33 Adenocarcinoma 208 0.65±0.32 Other 22 0.65±0.27 TNM staging 0.297 I 136 0.67±0.32 II 146 0.68±0.30 III 117 0.62±0.33 IV 43 0.70±0.31 10. [score:1]
So we performed the genetic association analysis to study potential association of SNPs within microRNA-126 with survival and susceptibility of NSCLC. [score:1]
In the present study, we found that the genotype and allele frequencies of the microRNA-126 (G>A, rs4636297) SNPs were not associated with the risk and overall survival of NSCLC. [score:1]
Currently, more experiments are needed to determine whether microRNA-126 is associated with non-small cell lung cancer risk and prognosis. [score:1]
To further evaluate the relationship between microRNA-126 and PIK3R2 in NSCLC, we detected the expression levels of microRNA-126, PIK3R2 and Akt phosphorylation in 381 clinical samples by quantitative real time PCR (qRT-PCR) and immunocytochemistry (IHC) respectively. [score:1]
Over -expression of microRNA-126 was performed to evaluate the cell invasion and tumor growth in non-small cell lung cancer (NSCLC) cell lines and nude mouse xenograft mo del. [score:1]
Thus, current evidences seem to support a close relationship between microRNA-126 and tumor growth. [score:1]
The results indicate that gremlins variants in the microRNA-126 have no impact on the microRNA level of tumor tissues in NSCLC patients. [score:1]
The relative expression was calculated using the equation: copies (miR-126)/copies (U6). [score:1]
A549 cells were cultured in 96-well plates and cotransfected with pMIR- PIK3R2-REPORT WT plasmid (or pMIR- PIK3R2-REPORT MT plasmid) and pE-Mir126 vector (GeneSil Biotechnology Co. [score:1]
However, no polymorphisms were found in the predicted binding sites in the 3′UTR of PIK3R2 for microRNA-126. [score:1]
In addition, the ratio of microRNA-126/microRNA-152 enabled the detection of urothelial bladder cancer (BCa) from urine at a specificity of 82% and a sensitivity of 72% [24]. [score:1]
Based on the above reports, microRNA-126 might have possible predictive and diagnostic value for cancers. [score:1]
However, there was no significant difference in the genotype and allele frequencies of the microRNA-126 variant (G>A, rs4636297) between cases and controls (P = 0.366). [score:1]
Genotype of microRNA-126 polymorphisms and their associations with NSCLC risk. [score:1]
To further explore the effect of microRNA-126 on tumor growth, we investigated the ability of microRNA-126 to suppress tumor growth in vivo by intratumoral injection of pE-Mir126 vector into A549 and SK-MES-1 xenografts mo dels of nude mice. [score:1]
We also evaluated whether the rs4636297 polymorphism was associated with microRNA-126 expression in NSCLC and the results showed that there was no significant difference among the three genotype groups (P = 0.972) (Figure 4B). [score:1]
More experiments are needed to determine whether microRNA-126 is associated with non-small cell lung cancer risk and prognosis. [score:1]
The predicted binding sites in the 3′UTR of PIK3R2 for microRNA-126 are shown in Figure 2A. [score:1]
[1 to 20 of 97 sentences]
9
[+] score: 224
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-6340
Based on our in vitro data and reduced transcript levels of both target genes in the DRG after SNI, we conclude that downregulation of miR-126 levels resulting from MeCP2 binding can contribute to the upregulation of Dnmt1 and Vegfa after nerve injury. [score:9]
Downregulation of miR-126 resulted in the upregulation of its two target genes Dnmt1 and Vegfa. [score:9]
Downregulation of miR-126 resulted in the upregulation of its two target genes Dnmt1 and Vegfa in Neuro 2A cells and in SNI mo del compared to control. [score:8]
Significance determined using unpaired Student’s t test, p value *<0.05 Expression of miR-126 and target genes Dnmt1 and Vegfa in DRG from To further confirm the regulatory role of MeCP2 on miR-126 expression, we obtained DRG from. [score:8]
Overexpression of miR-126 in vivo did not alter pain threshold but decreased target gene expression. [score:7]
Significance determined using unpaired Student’s t test, p value *<0.05, **<0.01 n = 3 for Mecp2 -null (− /y) and wild-type littermate mice (+ /y) We observed regulation of Dnmt1 and Vegfa by miR-126 in Neuro 2a cells, and an inverse correlation in expression of miR-126 and its target genes in the DRG after nerve injury. [score:6]
Repression of miR-126 and upregulation of its target genes in the SNI mo del. [score:6]
The location of miR-126 is within the Egfl7 gene, and the expression levels of miR-126 correlate with expression of Egfl7 [30]. [score:5]
a Relative expression of miR-126 in the DRG showed comparable expression in Mecp2 -null and wild-type littermates. [score:5]
We hypothesized that reduced levels of miR-126 would result in increased expression of miR-126 target genes in the DRG. [score:5]
Since we did not observe a significant binding of MeCP2 to Dnmt1 and Vegfa, one of the indirect mechanisms contributing to their upregulation after SNI could be the repression of miR-126 by MeCP2. [score:5]
Fig.  6Expression of miR-126 and its target genes Dnmt1 and Vegfa in the DRG after nerve injury. [score:5]
Expression of miR-126 and target genes Dnmt1 and Vegfa in DRG from Mecp2 -null mice. [score:5]
Fig.  7Expression of miR-126 and its target genes Dnmt1 and Vegfa in the DRG from Mecp2 -null mouse. [score:5]
Lower miR-126 leads to increased expression of its two target genes Vegfa and Dnmt1. [score:5]
miR-126 regulates expression of Dnmt1 and Vegfa in Neuro 2a cells. [score:4]
This finding along with our observation from the SNI mo del indicates that MeCP2 does not regulate expression of miR-126 under naïve conditions. [score:4]
The Neuro 2a mouse neuroblastoma cell line was used to investigate regulation of target gene expression by miR-126. [score:4]
Nerve injury induced upregulation of MeCP2 and a decrease in miR-126 in mice after SNI. [score:4]
Vegfa is a secreted protein; therefore, protein expression in the DRG may not reflect miR-126 -mediated regulation of Vegfa. [score:4]
miR-126 regulation of these targets is further supported by our molecular studies. [score:4]
Previous studies have demonstrated direct binding of miR-126 to the 3′ untranslated region (UTR) of vascular endothelial growth factor (Vegfa) [31] and DNA methyltransferase 1 (Dnmt1) [32]. [score:4]
Based on the decrease in both transcript and protein levels, we conclude that miR-126 regulates expression of both Dnmt1 and Vegfa through degradation of mRNA. [score:4]
Significance determined using unpaired Student’s t test, p value *<0.05 To further confirm the regulatory role of MeCP2 on miR-126 expression, we obtained DRG from. [score:4]
Additionally, delivery of miR-126 robustly downregulated Dnmt1 and Vegfa mRNA in the DRG (Fig.   8c). [score:4]
a Relative expression of endogenous Dnmt1 and Vegfa mRNA in Neuro 2a cells transfected with miR-126 Gapdh was used as a normalizer. [score:3]
Intrathecal delivery of miR-126 decreased Dnmt1 and Vegfa expression in the DRG, but was not sufficient to reverse nerve injury -induced mechanical and thermal hypersensitivity. [score:3]
Neuro 2a cells were transfected with miR-126 precursor plasmid, or scrambled miRNA control, expressing GFP. [score:3]
Fig.  8Administration of exogenous miR-126 decreased Dnmt1 and Vegfa expression in vivo but did not alter pain sensitivity. [score:3]
For monitoring changes in endogenous Dnmt1 and Vegfa expression, cells were transfected with precursor miR-126 plasmid (GeneCopoeia) using X-tremeGENE HP DNA transfection reagent (Roche) for 72 h. RNA was purified from the following samples: Neuro 2a cells, DRG collected from SNI mo del, sham control, Mecp2 -null and wild-type littermate mice using the mirVana RNA isolation kit (Life technologies). [score:3]
miR-126 is encoded within the intron of Egfl7 and highly expressed in brain [43]. [score:3]
Intrathecal delivery of miR-126 was not sufficient to reverse nerve injury -induced mechanical and thermal hypersensitivity, but decreased Dnmt1 and Vegfa expression in the DRG. [score:3]
b Representative of Dnmt1 and Vegfa using lysate of Neuro 2a cells transfected with miR-126 precursor plasmid for 72 h. Overexpression of miR-126 decreased mRNA and protein levels of Dnmt1 and Vegfa; beta tubulin was used as the control. [score:3]
Dnmt1 and Vegfa are two validated target genes of miR-126 [31, 32]. [score:3]
c Relative expression of Dnmt1 and Vegfa mRNA in the DRG of miR-126 and control injected mice. [score:3]
Enriched MeCP2 binding to miR-126 locus after nerve injury repressed miR-126 expression, and this was not mediated by alterations in methylation pattern at the miR-126 locus. [score:3]
These results indicate that though the delivery of miR-126 decreased Dnmt1 and Vegfa expression in the DRG, this was not sufficient to reverse nerve injury -induced mechanical and thermal hypersensitivity. [score:3]
We did not observe a change in mechanical (Fig.   8a) or thermal (data not shown) hypersensitivity in these mice, after overexpressing miR-126. [score:3]
a Relative expression of miR-126 determined by qPCR shows a reduction in miR-126 in SNI mo del compared to DRG from sham control. [score:2]
Since miR-126 is a negative regulator of Dnmt1 and Vegfa, we wanted to investigate whether MeCP2 can also affect expression of these genes. [score:2]
To investigate whether upregulation of miR-126 can alter pain threshold in the SNI mo del mice, we intrathecally administered exogenous miR-126. [score:2]
We also show that miR-126 -transfected cells have decreased Dnmt1 expression compared to untransfected cells (Fig.   5c). [score:2]
Increased miR-126 decreased the expression of endogenous Dnmt1 and Vegfa compared to miR-control injected mice. [score:2]
Hsa-miR-126 was downregulating in whole blood from patients with complex regional pain syndrome compared to healthy donors [46] and in exosomes from CRPS patients compared to that of control [47]. [score:2]
c Immunohistochemistry indicating transfection with miR-126 plasmid co -expressing GFP in Neuro 2a cells decreased Dnmt1 levels compared to untransfected cells 72 h post-transfection. [score:2]
Our analysis showed that miR-126 and miR-6340 had the largest fold enrichment for SNI and sham, respectively (Additional file 3: Fig. S1a and S1b). [score:1]
Arrows indicate daily intrathecal injections with 2 nmol miR-126 or control miRNA via catheter (n = 5 for miR-126 and miR-control injected mice, n = 3 for PBS injected mice). [score:1]
a MeCP2 peak profile from ChIP-seq at miR-126a/miR-126b shows enrichment of MeCP2 binding to miR-126 locus in the SNI mo del, and virtually no binding in the sham control. [score:1]
As was reported for the studies in a spinal cord injury mo del [44], the role of miR-126 in reversing inflammation and functional deficits could not be captured in the evoked pain behavioral assessments we employed. [score:1]
SNI induced enriched binding of MeCP2 to miR-126 locus resulting in repression of miR-126. [score:1]
This indicates that nerve injury induced an increase in MeCP2 binding to miR-126 locus, and hence, we further explored the functional consequences of this binding in the context of nerve injury -induced pain. [score:1]
Significance determined using unpaired Student’s t test, p value, **<0.01, ***<0.001 (n = 5 for miR-126 and miR-control injected mice, n = 3 for PBS injected mice). [score:1]
However, there was increased MeCP2 binding to miR-126 upon nerve injury, resulting in miR-126 repression. [score:1]
10.1186/s13072-016-0073-5 A larger 20,000 BP window centered around mir-126 and miR-6340 shown. [score:1]
Methylation of miR-126 locus. [score:1]
Likely, nerve injury changes the chromatin architecture, allowing increased access for MeCP2 to bind miR-126 locus. [score:1]
There was a significant decrease of miR-126 in the DRG after SNI (Fig.   6a). [score:1]
With the lack of efficacy in pain behavior studies, we wanted to confirm miR-126 delivery to the DRG and investigate changes in Vegfa and Dnmt1 expression. [score:1]
Since miR-126a and miR-126b had the largest fold enrichment in the SNI mo del, we confirmed MeCP2 binding to miR-126 locus by ChIP-PCR (Additional file 4: Fig. S2). [score:1]
An intrathecal catheter was implanted 4 weeks after SNI surgery, to allow for repeated administration of 2 nmol miR-126 or control miRNA. [score:1]
To analyze the methylation status of CpG dinucleotides in the miR-126 locus, L4, L5 and L6 DRG were collected from three SNI or three sham control mice 4 weeks after surgery. [score:1]
We have previously observed a decrease in miR-126 in L4 and L5 DRG in rats 4 weeks after spinal nerve ligation [45]. [score:1]
miR-126 decrease promoted angiogenesis and inflammation in the spinal cord after a weight induced contusion and administration of miR-126 reduced locomotor deficit and tissue damage [44]. [score:1]
Since there was an increase in MeCP2 bound to premiR-126 after nerve injury, we postulate that MeCP2 redistribution throughout the genome and the specific enrichment at miR-126 could be induced by alterations in the availability of the genome for MeCP2 binding, after nerve injury. [score:1]
The peak profile for miR-126 locus from ChIP-seq shows enrichment for MeCP2 binding over input control and sham samples (Fig.   4a). [score:1]
Furthermore, and their wild-type littermates have similar levels of miR-126. [score:1]
This indicates that nerve injury induces the enriched binding of MeCP2 to miR-126 locus, resulting in miR-126 repression. [score:1]
b CpG methylation of miR-126 locus was identical in SNI and sham control mice. [score:1]
A custom miRCURY (Exiqon) miR-126 mimic containing a 5′ cholesterol tag and 3′ fluorescein label was injected at 2 nmol concentration with 4 µl iFECT transfection reagent (Neuromics). [score:1]
A recent study demonstrated a role for miR-126 in reducing inflammation and improving the functional deficit after spinal cord injury. [score:1]
Significance determined using unpaired Student’s t test, p value *<0.05, ***<0.001 (n = 3 for all samples) We next sought to determine the consequence of increased MeCP2 binding to miR-126 locus in the DRG after nerve injury. [score:1]
We observed an enrichment of MeCP2 binding to miR-126 locus after nerve injury, with virtually no binding in the sham sample. [score:1]
10.1186/s13072-016-0073-5 MeCP2 ChIP-PCR of the miR-126 locus indicates specific binding of MeCP2. [score:1]
Administration of miR-126 did not alter the pain threshold in mice after SNI, and this could be due to the severity of nerve injury used to generate chronic neuropathic pain in the SNI mo del. [score:1]
b Confirmation of miR-126 delivery to DRG. [score:1]
To determine how differential binding of MeCP2 can affect gene expression in the DRG, we investigated mmu-miR-126, a microRNA locus that had enriched MeCP2 binding in the SNI mo del. [score:1]
Bisulfite sequencing and analysis of CpG sites in miR-126 locus and putative promoter. [score:1]
This indicates that increased binding of MeCP2 represses transcription of miR-126. [score:1]
Bisulfite sequencing at the putative promoter of miR-126 showed that there were no changes in CpG methylation (data not shown). [score:1]
There was no MeCP2 binding at the miR-126 locus in sham control mice. [score:1]
For identification of MeCP2 binding to miR-126, PCR was performed using DNA isolated from DRG. [score:1]
We observed a decrease in mRNA (Fig.   5a) and protein levels (Fig.   5b) of Dnmt1 and Vegfa 72 h after miR-126 transfection. [score:1]
miR-126 locus has enriched MeCP2 binding in SNI. [score:1]
[1 to 20 of 83 sentences]
10
[+] score: 220
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-155, mmu-mir-221, mmu-mir-196b
In the absence of 14-3-3ζ, the Raf/Mek/Erk/Ets2 pathway, along with other signaling pathways, is inhibited and miR-126 expression is attenuated, resulting in defects in lung vascular integrity that leads to neonatal lethality (right) Previously, we reported that 14-3-3ζ regulates transcription of miR-221 via the Erk target c-fos and the Jnk target c-Jun [62]. [score:10]
Notably, 14-3-3ζ binds to many target proteins and regulates a wide variety of biological processes, thus miR-126 down-regulation in 14-3-3ζ−/− mice is likely one of the mechanisms underlying the developmental defects. [score:8]
In our 14-3-3ζ−/− mouse mo del, loss of 14-3-3ζ in endothelial cells clearly inhibited angiogenesis during development in vivo and miR-126 downregulation contributes to this phenotype. [score:7]
Inhibition of Erk activity in mouse endothelial cells using a MEK1/2 inhibitor (AZD6244) also attenuated miR-126 expression (Fig.   5d, e) and reduced Ets2 binding to the miR-126 promoter (Fig.   5f) while Ets1 binding was unaffected (Fig.   5g). [score:7]
Loss of 14-3-3ζ expression led to a significant downregulation of miR-126 (Fig.   3d) and inhibited the angiogenic functionality of the endothelial cells as determined by both migration and tube formation assays (Fig.   4a, b). [score:7]
d qRT-PCR analysis of miR-126 expression normalized to PECAM1 in mouse endothelial cells expressing either a scrambled shRNA or shRNA targeting 14-3-3ζ. [score:7]
Notably, miR-126 expression in the lungs of wild-type C57Bl/6J mice is significantly lower than that in the lungs of FVB/NJ and CD-1 mice of the same age (Fig.   3b), suggesting that further attenuating miR-126 expression in the already lower miR-126 expressing C57Bl/6J lungs may account for the lethality phenotype observed on that background. [score:7]
Our findings that loss of 14-3-3ζ led to reduced Ets2 binding to the miR-126 promoter resulting in miR-126 downregulation and inhibited angiogenesis in 14-3-3ζ−/− mouse mo del clearly established 14-3-3ζ as an upstream regulator of the Erk/Ets2/miR126/angiogenesis axis (Fig.   6). [score:7]
We found that targeted deletion of 14-3-3ζ on a C57Bl/6J genetic background led to neonatal lethality due to respiratory distress, which resulted from miR-126 downregulation -induced defects in lung vasculature. [score:6]
± SD (n = 3) To determine the contribution of miR-126 downregulation in 14-3-3ζ-loss induced vascular defects, mouse endothelial cells were stably transfected with two distinct shRNAs targeting 14-3-3ζ and a scrambled shRNA was used as a control (Fig.   3c). [score:6]
± SD (n = 3) To determine the contribution of miR-126 downregulation in 14-3-3ζ-loss induced vascular defects, mouse endothelial cells were stably transfected with two distinct shRNAs targeting 14-3-3ζ and a scrambled shRNA was used as a control (Fig.   3c). [score:6]
The expression of miR-126, an endothelial-specific miRNA known to regulate lung vascular integrity was down-regulated in the lungs of the 14-3-3ζ−/− embryos in the C57Bl/6J background as compared to their wild-type counterparts. [score:6]
a qRT-PCR analysis of miR-126 expression normalized to PECAM1 in the lungs from 14-3-3ζ wild type (+/+) and knockout (−/−) embryo lungs, ± SD (n = 3) *p < 0.05. b qRT-PCR analysis of miR-126 expression normalized to PECAM1 in the lungs from 14-3-3ζ wild type (+/+) mice (6 weeks) from the indicated genetic backgrounds. [score:6]
The lungs of our 14-3-3ζ−/− mice had a significant miR-126 down-regulation, consistent with the defective lung development phenotype. [score:5]
Interestingly, we have observed that miR-126 expression in the lungs of C57Bl/6J mice is significantly lower as compared to that in the FVB/NJ and CD-1 mice, suggesting that downregulation of miR-126 from 14-3-3ζ-loss may lead to more severe biological consequences on the C57Bl/6J mice than in the FVB/NJ and CD-1 mice. [score:5]
Together, these data indicate that miR-126 down-regulation plays a critical role in the defective lung vasculature -mediated respiratory failure and neonatal lethality in 14-3-3ζ knockout mice, which may also have relevance for clinical syndromes of neonatal respiratory distress [57]. [score:5]
Several miR-126 targets have been identified that potentially account for the importance of miR-126 expression in endothelial cells. [score:5]
b, c ChIP analysis of Ets2 and Ets1 binding to the miR-126 promoter in mouse endothelial cells expressing either a scrambled shRNA or shRNA targeting 14-3-3ζ, ± SD (n = 3). [score:5]
Our data demonstrates that miR-126 is an important angiogenesis regulator that functions downstream of 14-3-3ζ and downregulation of miR-126 plays a critical role in 14-3-3ζ-loss induced defects in lung vasculature in the C57Bl/6J genetic background. [score:5]
MiR-126 was also found to suppress the expression of the endothelial adhesion molecule vascular cell adhesion molecule 1 (VCAM1) and thereby plays a role in regulating vascular inflammation [54]. [score:5]
These results demonstrated that downregulation of the angiogenesis regulator miR-126 plays a critical role in 14-3-3ζ-loss induced lung vasculature defects on the C57Bl/6J background. [score:5]
Additionally, zebrafish studies have suggested a role of miR-126 in facilitating the lung vasculature integrity by reducing the expression of negative regulators of the VEGF pathway, such as SPRED-1 (Sprouty related protein 1) and the PI3K regulatory subunit 2 [52]. [score:5]
14-3-3ζ hypomorphic lungs had dysregulated angiogenesis mediated by inhibition of Erk-Ets2-miR-126 signaling pathway. [score:4]
a of mouse endothelial cells with 14-3-3ζ knockdown and rescue by overexpression of exogenous miR-126. [score:4]
Expression of a miR-126 mimetic (pre-miR-126) (Fig.   4c) in 14-3-3ζ knockdown mouse endothelial cells rescued their migration and tube formation capabilities (Fig.   4a, b lower panels). [score:4]
b with exogenously expressed miR-126 in the 14-3-3ζ knockdown mouse endothelial cells. [score:4]
Loss of 14-3-3ζ impedes angiogenesis via downregulation of miR-126. [score:4]
MiR-126 has also been shown to enhance endothelial cell proliferation by targeting the 3′UTR of the Notch1 inhibitor delta-like 1 homolog (Dlk1) [53]. [score:4]
Erk downstream targets, Ets1 and Ets2 [60], are important regulators of miR-126 transcription [35]. [score:4]
Other miR-126 targets that play a role in angiogenesis include VEGF [55], epidermal growth factor like domain 7 (EGFL7) [56], etc. [score:3]
MiR-126 is an endothelial cell-specific microRNA, and miR-126 loss resulted in neonatal lethality and lung deflation due to vascular disintegration and inhibition of angiogenesis [34]. [score:3]
c Mouse endothelial cells stably transfected with either scrambled shRNA or shRNA targeting 14-3-3ζ were transfected with pre-miR-126. [score:3]
Indeed, loss of 14-3-3ζ in mouse endothelial cells resulted in reduced Erk activity, attenuated binding of Ets2 to the miR-126 promoter, and ultimately repressed miR-126 expression (Fig.   5). [score:3]
Mechanistically, loss of 14-3-3ζ led to reduced Erk1/2 phosphorylation resulting in attenuated binding of the transcription factor Ets2 on the miR-126 promoter which ultimately reduced expression of miR-126. [score:3]
Loss of 14-3-3ζ in endothelial cells inhibited the angiogenic capability of the endothelial cells as determined by both trans-well migration assays and tube formation assays and these defects could be rescued by re -expressing miR-126. [score:3]
org/) revealed that targeted deletion of the endothelial specific miR-126 was reported to result in a lethal phenotype [34] similar to the 14-3-3ζ−/− mice on a C57Bl/6J genetic background. [score:3]
e qRT-PCR analysis of miR-126 expression relative to PECAM1 in mouse endothelial cells treated with either DMSO or AZD6244, ± SD (n = 3). [score:3]
Cells stably expressing scramble or 14-3-3ζ shRNA were transfected with control or pre-miR-126. [score:3]
Three independent transwell experiments were performed and three random fields from the tube formation assay were analyzed for statistical analysis The Raf/Mek/Erk regulated transcription factors Ets1 and Ets2 are important transcriptional regulators of miR-126 [35]. [score:2]
14-3-3ζ miR-126 Lung development Angiogenesis The mammalian 14-3-3 protein family consists of seven isoforms (β, τ, ε, ζ, η, γ and σ). [score:2]
The precipitated DNA fractions were analyzed by Quantitative-PCR for the presence of the miR-126 proximal regulatory region encompassing the EBS1 and EBS2 (region − 150 to + 100 bp). [score:2]
MiR-126 expression was analyzed by qRT-PCR and normalized to PECAM1, ± SD (n = 3). [score:2]
Fig.  414-3-3ζ and miR-126 regulate endothelial migration and tube formation. [score:2]
Quantitative RT-PCR analysis showed that miR-126 expression in the lungs of the 14-3-3ζ−/− embryos in the C57Bl/6J background was significantly reduced compared to their wild-type counterparts (Fig.   3a). [score:2]
Furthermore, reintroducing miR-126 to 14-3-3ζ knockdown endothelial cells rescued endothelial cell functions. [score:2]
In this study, we found that 14-3-3ζ regulates miR-126 via the Erk/Ets2 pathway. [score:2]
Three independent transwell experiments were performed and three random fields from the tube formation assay were analyzed for statistical analysis The Raf/Mek/Erk regulated transcription factors Ets1 and Ets2 are important transcriptional regulators of miR-126 [35]. [score:2]
Mice lacking both Ets1 and Ets2 have been reported to be embryonic lethal due to vascular defects and enhanced endothelial cell apoptosis [61], indicating an important role for Ets1 and Ets2, the miR-126 regulators, in maintenance of vascular integrity. [score:2]
Mechanistic insights came from our finding that loss of 14-3-3ζ on the C57Bl/6J background phenocopies miR-126 knockout mice. [score:2]
These results suggest that loss of 14-3-3ζ attenuates miR-126 transcription by decreased binding of Ets2 to the miR-126 promoter. [score:1]
On C57Bl/6J background, 14-3-3ζ is critical for the activation of multiple signaling pathways including the Raf/Mek/Erk pathway, facilitating the Ets2 mediated transcription of the pro-angiogenic miR-126, which promotes lung vascular integrity (left). [score:1]
As 14-3-3ζ plays an important role in Raf-1 activation [36, 37], loss of 14-3-3ζ may result in attenuated activation of the Raf/Mek/Erk pathway leading to decreased Ets1 and Ets2 mediated transcription of miR-126. [score:1]
Fig.  514-3-3ζ mediates miR-126 transcription by modulating Ets2 activity. [score:1]
g ChIP analysis of Ets1 binding to the miR-126 promoter in mouse endothelial cells treated with either DMSO or AZD6244. [score:1]
Control pre-microRNA and pre-miR126 were ordered from Exiqon. [score:1]
f ChIP analysis of Ets2 binding to the miR-126 promoter in mouse endothelial cells treated with either DMSO or AZD6244. [score:1]
Indeed, loss of 14-3-3ζ in mouse endothelial cells reduced Erk phosphorylation (Fig.   5a), and attenuated binding of Ets2 to the miR-126 promoter (Fig.   5b) while Ets1 binding was not significantly altered (Fig.   5c). [score:1]
[1 to 20 of 57 sentences]
11
[+] score: 211
Overexpression of miR-126 in HMECs inhibited both mRNA and protein expression of VEGF-A, KDR and SPRED-1. Transfection of miR-126 in HMECs (Figure 4) resulted in decreased expression of VEGF-A and KDR mRNA (n = 4, p < 0.01) (Figure 5A,B), and SPRED-1 mRNA expression was also downregulated (n = 4, p < 0.01) (Figure 5C). [score:14]
To further explore the effects of miR-126 in vivo, the expression of miR-126 was altered in the CNV mice to determine if restoration of miRNA expression would result in modulation in the expression of predicted mRNA and protein targets. [score:9]
Our study showed that miR-126 overexpression can inhibit CNV to some extent by regulating VEGF-A, and PlGF might be a potential target of miR-126 in AMD. [score:8]
The decreased expression of KDR after miR-126 transfection suggested that KDR may be an indirect target of miR-126 in the eye; alternatively, the miR-126 mediated change in VEGF-A level may cause downstream changes in KDR expression (Figure 2 and Figure 3). [score:8]
Our experiment shows that the low expression of miR-126 in CNV mice correlates with the increased mRNA and protein expression of VEGF-A, KDR and SPRED-1 and that restoration of miR-126 can inhibit these increases (Figure 2 and Figure 3). [score:7]
Zhu N. Zhang D. Xie H. Zhou Z. Chen H. Hu T. Endothelial-specific intron-derived miR-126 is down-regulated in human breast cancer and targets both VEGFA and PIK3R2 Mol. [score:6]
HMECs transfected with miR-126 mimic also showed an inhibition in mRNA and proteins levels of VEGF-A, KDR and SPRED-1. Upregulation of miR-126 reduced endothelial cell tube formation and VEGF -induced migration. [score:6]
The significantly reduced tube formation and VEGF -induced migration were observed in miR-126 transfected HMECs, further reinforces the notion that the increase in miR-126 expression could inhibit and possibly reverse pathological angiogenesis in AMD (Figure 6 and Figure 7). [score:5]
Ye P. Liu J. He F. Xu W. Yao K. Hypoxia -induced deregulation of miR-126 and its regulative effect on VEGF and MMP-9 expression Int. [score:5]
The decreased miR-126 expression is associated with the increased mRNA and protein levels of VEGF-A, KDR and SPRED-1. Restoration of miR-126 can reverse these increases in the CNV mouse mo del and inhibit CNV formation. [score:5]
The expression of miR-126 target genes protein was analyzed by two tailed Student’s t-test with p < 0.05 declared significant. [score:5]
In one study, miR-126 was found to regulate angiogenic signaling and vascular integrity by targeting Sprouty-related EVH1 doain-containing protein 1 (SPRED-1) and phosphoinositol-3 kinase regulatory subunit 2 (PIK3R2) [19]. [score:5]
In our study, the alteration of miR-126 expression by miR-126 mimc injection in the eye may target also RPE. [score:5]
Restoration of miR-126 Levels Reversed High mRNA and Protein Expression of Target Genes in Human Microvascular Endothelial Cell (HMEC). [score:5]
The changes in the target mRNA and protein levels suggest that miR-126 not only represses translation of these mRNAs, but also causes the degradation of mRNA [8, 29]. [score:5]
A clear functional impact of miR-126 regulated targets on CNV severity in vivo has been demonstrated. [score:4]
This may also restrict the influence of local factors and downstream effects of miRNA and explain the different expression of miR-126 in ocular diseases compared to other systemic disorders. [score:4]
miR-126 and its target genes mRNA expression, CNV lesion area, HMECs tube formation and migration were determined by ANOVA, a p-value of <0.05 was considered as significant. [score:4]
In this study, we found that miR-126 was downregulated in the laser -induced CNV mice eyes. [score:4]
Some studies indicated that miR-126 regulates tumor angiogenesis by targeting VEGF-A [24]. [score:4]
The endothelial-specific microRNA miR-126 has been shown to play a role in regulating vascular integrity and angiogenesis as well as multiple disease processes [22, 23]. [score:4]
Bai Y. Bai X. Wang Z. Zhang X. Ruan C. Miao J. MicroRNA-126 inhibits ischemia -induced retinal neovascularization via regulating angiogenic growth factors Exp. [score:3]
The downstream effect of reduced expression of miR-126 was assessed by qPCR and Western blot analysis. [score:3]
Based on the above findings, we postulate that restoring the miR-126 levels could inhibit the progression of CNV in the eye and then confirmed this hypothesis in the following experiments. [score:3]
Studies conducted by Fish et al. and Wang et al. showed that miR-126 normally promotes vessel formation and stability by “repressing the repressors” of VEGF signaling and that loss of miR-126 inhibited vascular growth in the embryonic stem cells and embryos of mice and zebrafish [19, 31]. [score:3]
CNV lesion size and severity were determined to confirm the effect of the overexpression of miR-126 on the CNV mice. [score:3]
In our study, we found that miR-126 expression was substantially decreased in laser -induced CNV mo del—the well-established mo del mimicking the pathogenesis of neovascular AMD (Figure 1). [score:3]
Although it has been suggested that miR-126 targets PIK3R2 as well [45], the concentration of PIK3R2 mRNA and proteins in our samples were below the detection limit. [score:3]
miR-126 was significantly downregulated (p < 0.05) in the CNV eyes compared with the untreated eyes (Figure 1). [score:3]
However the CNV was not fully inhibited by miR-126 transfection, indicating that there are other pathways involved in ocular neovascularization. [score:3]
However, more recently, it has been found that miR-126 levels were decreased in ocular neovascularization diseases such as diabetic retinopathy or retinopathy of prematurity [32, 33]. [score:3]
Expression of miR-126 in Laser-Induced Choroidal Neovascularization (CNV) Mouse Mo del. [score:3]
Fish et al. and Wang et al. proved that miR-126 enhanced angiogenesis [19, 30], while the decreased expression has been found in ischemia -induced retina [29, 30]. [score:3]
Changes of miR-126 Target Genes in the Eyes of CNV Mice. [score:3]
In this study, we found that expression of miR-126 was decreased in laser induced CNV mice; restoration of miR-126 mimic decreased VEGF-A levels and consequently influenced its downstream pathway and reduced CNV severity. [score:3]
It highlights that miR-126 can inhibit the formation of capillary tubes. [score:3]
In cultured HMECs, we found that the decreased expression of VEGF-A, KDR and SPRED-1 after miR-126 transfection (Figure 5) were consistent with in vivo results. [score:3]
The potential of miR-126 as a therapeutic target is promising and should be further explored for the treatment of AMD. [score:3]
CNV mice with overexpressed miR-126 exhibited a significant decrease in mRNA and protein expression of VEGF-A, KDR and SPRED-1 (n = 12, p < 0.05), measured by qPCR and Western blot, respectively (Figure 2 and Figure 3). [score:3]
Effect of miR-126 Overexpression on VEGF-Induced Migration of HMEC. [score:3]
Fish J. E. Santoro M. M. Morton S. U. Yu S. Yeh R. F. Wythe J. D. Ivey K. N. Bruneau B. G. Stainier D. Y. R. Srivastava D. miR-126 regulates angiogenic signaling and vascular integrity Dev. [score:2]
Even if it is not a large amount, may act as an antagonist for VEGF-A, it may play a role in preventing AMD development conjunction with miR-126 during this situation. [score:2]
Successful miR-126 transfection was confirmed using PCR analysis (n = 12, p < 0.01) after injection with miR-126 mimic (Figure 1). [score:1]
The results based on this study confirm the established knowledge of miR-126 involvement in angiogenesis and reveal a critical role for miR-126 in CNV. [score:1]
However, there have been contradicting reports on the roles of miR-126. [score:1]
We performed tube formation after HMECs received scramble control miR or miR-126 mimic treatment. [score:1]
The findings of this study demonstrated that miR-126 successfully reduced angiogenesis in the mice eyes. [score:1]
Scrambled mirVana™ miRNA Mimic, Negative Control #1(Ambion, Foster City, CA, USA) or miR-126 mimic (5′-UCGUACCGUGAGUAAUAAUGCG-3′, Ambion) at a concentration of 5 µM was complexed with Invivofectamine 2.0 Transfection Reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s instructions. [score:1]
In Figure 9, CNV mice transfection with the negative control miR showed no changes in CNV lesion area, but the mice treated with miR-126 mimic had significantly smaller CNV lesion areas. [score:1]
Among these miRNAs, miR-126 is a likely candidate for involvement in pathogenic neovascularization. [score:1]
Each group received either no treatment or an intravitreal injection of 5 µL of either the scramble control miR or miR-126 mimic treatment on Day 0 (immediately after laser treatment) and readministered on Day 7. For the intravitreal injection, a hole was first made by inserting a 30-gauge needle posterior to the limbus of the mice eye. [score:1]
Our results were also consistent with findings from other studies, suggesting that miR-126 can influence VEGF signaling to a certain extent, through SPRED-1 and PIK3R2 [39, 43, 44], or VEGF-A [31, 32]. [score:1]
miR-126 seems to be a beneficial alternative to conventional anti-VEGF antibody for the treatment of wet AMD. [score:1]
The sequences of the primes used are list as following: miR-126: mature sequence, 5′-UCGUACCGUGAGUAAUAAUGCG-3′. [score:1]
In Vitro Transfection of HMECsA 10 nM mimicking miR-126 (Pre-miR miRNA Precursor Molecule, Ambion) or nonspecific control miRNA (Pre-miR Negative Control #1, Ambion) was transfected into the HMEC cell lines using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions. [score:1]
Wang S. Aurora A. B. Johnson B. A. Qi X. McAnally J. Hill J. A. Richardson J. A. Bassel-Duby R. Olson E. N. The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis Dev. [score:1]
Transfection of miR-126 Decreased Tube Formation in HMECs. [score:1]
Fourteen days post transfection, the expression of miR-126 in mice eyes was measured by qPCR (RPE/choroid mix n = 12). [score:1]
miR-126 mimic was administered via a transfection reagent by intravitreal injection into the laser induced CNV eyes. [score:1]
From those studies, it would appear that miR-126 enhanced angiogenesis. [score:1]
Zampetaki A. Kiechl S. Drozdov I. Willeit P. Mayr U. Prokopi M. Mayr A. Weger S. Oberhollenzer F. Bonora E. Plasma microRNA profiling reveals loss of endothelial miR-126 and other microRNAs in type 2 diabetes Circ. [score:1]
Reference photographs were taken using a phase contrast microscope (Olympus IX71) and the photographed in the same areas at t = 0 h and 9 h. Endothelial cell migration was quantified as the difference in size between the denuded area immediately after the scratch and at t = 9 h. A 10 nM mimicking miR-126 (Pre-miR miRNA Precursor Molecule, Ambion) or nonspecific control miRNA (Pre-miR Negative Control #1, Ambion) was transfected into the HMEC cell lines using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions. [score:1]
Restoration of miR-126 in Laser-Induced CNV Lesions in Mice Eyes. [score:1]
The different expression pattern of miR-126 in ocular neovascularization may be partly due to the anatomical characteristics of the eye. [score:1]
In order to better clarify the role of miR-126 for HMEC migration, we used VEGF (50 ng/mL) as a stimulus. [score:1]
miR-126 is an EC-specific miRNA encoded in the intron of EGF-like domain 7 and has been shown to be involved in tumor neovascularization [22, 23]. [score:1]
We demonstrated that the miR-126 remains effective even after 14 days of in vivo transfection. [score:1]
CNV mice were transfected using a transfection agent coupled with either a miR-126 mimic or a negative control oligonucleotide (miR-control). [score:1]
However, the role of miR-126 in AMD still remains unknown at present. [score:1]
Reported miR-126 levels in vascular pathogenesis were variable in the literature. [score:1]
[1 to 20 of 70 sentences]
12
[+] score: 196
Other miRNAs from this paper: mmu-mir-126a, hsa-mir-222, hsa-mir-126, mmu-mir-222
Upregulation of miR-126 (transfection with pre-miR-126) increased RGS16 (1 versus 3.23 ± 1.48), SDC-4 (1 versus 6.39 ± 0.64), and CXCR4 expression (1 versus 6.39 ± 0.91) and decreased SDF-1/CXCL12 (1 versus 0.19 ± 0.03) and VCAM-1 expression (1 versus 0.65 ± 0.14) in HUVECs. [score:8]
Our results show that the increase in miR-126 after 24 h of LSS was concomitant with downregulation of its well-known target VCAM-1 at the protein level compared to 10 min LSS and miR-126 overexpression experiments resulted also in a decrease of VCAM-1 mRNA. [score:7]
Upregulation or Downregulation of miR-126 Does Not Affect HUVEC Proliferation or Apoptosis. [score:7]
We recently studied the expression of several miRNAs, including miR-126, in large vessels during various stages of chronic kidney disease (CKD) and atherosclerosis [16] and showed that miR-126 is increased in the aorta in murine mo dels of these diseases. [score:7]
miR-126 is known to regulate many targets either directly (SDF-1/CXCL12, CXCR-4, VCAM-1 and RGS16) and/or indirectly (SDF-1/CXCL12, CXCR-4) [12, 13, 17, 36]. [score:6]
In comparison, Hergenreider et al. used on HUVECs a higher shear at 20 dyne/cm [2] for a longer time (3 days) and found no effect on miR-126 expression level and no significant regulation of miR-126 by KLF-2 overexpression [30]. [score:6]
In this study we explored the effect of upregulation of miR-126 on SDF-1/CXCL12, CXCR4, and SDC-4 expression and their impact on actin cytoskeleton remo deling. [score:6]
On the other hand, Zernecke et al. [17] showed that the atheroprotective effects of human endothelial cell apoptotic bodies are mediated by miR-126, which inhibits the negative regulator RGS16, thereby enabling CXCR4 to stimulate enhanced expression of SDF-1/CXCL12 via ERK1/2. [score:6]
Knowing that miR-126 decreases SDF-1/CXCL12 and VCAM-1 expression, we can hypothesize that overexpression of miR-126 is atheroprotective and may lead to a decrease of leukocyte homing from the blood circulation through the endothelium in vivo [29, 37]. [score:5]
In the same way, Harris et al. [12] observed that overexpression of miR-126 decreases VCAM-1 protein expression and consequently reduces leukocyte adhesion to endothelial cells. [score:5]
After a brief exposure to LSS (10 min), a slight decrease of miR-126 expression was observed concomitant with an increase of KLF-2 mRNA and, after a long exposure time to LSS (24 h), a marked increase of miR-126 expression was observed. [score:5]
In summary, our data demonstrate that LSS has an important impact on miR-126 expression in HUVECs (Figure 6), and its protein targets SDF-1/CXCL12. [score:5]
This increase could possibly be induced by the increased KLF-2 expression observed after 10 min of exposure, as KLF-2 has been shown to increase miR-126 expression in zebrafish [31]. [score:5]
As expected, overexpression of miR-126 under our experimental conditions provided results comparable to those published by van Solingen et al. [14], that is, a decrease of SDF-1/CXCL12 and VCAM-1, which are described targets of miR-126 [12]. [score:5]
These changes were reflected by significant upregulation of miR-126 during long-term exposure to flow. [score:4]
A marked decrease of miR-126 expression was observed after anti-miR-126 transfection (1 versus 0.23 ± 0.034) and a marked increase of miR-126 expression was observed after pre-miR-126 transfection (1 versus 7000 ± 1168), compared to controls (Figure 4(a)). [score:4]
This result is discordant with those of a study in colon cancer cells, which demonstrated that miR-126 is a negative regulator of CXCR4 expression [40]. [score:4]
Interestingly, a new finding of our study is that miR-126 is a positive regulator of SDC-4, as miR-126 overexpression increased the level of SDC-4 mRNA. [score:4]
In addition, miR-126 knockdown (transfection with anti-miR-126) decreased RGS16 (1 versus 0.74 ± 0.20), SDC-4 (1 versus 0.48 ± 0.08),  and CXCR4 expressions (1 versus 0.56 ± 0.23). [score:4]
Under these conditions, miR-126 and SDC-4 expression were also correlated in vivo, as miR-126 expression was increased in the aorta of Apo-E KO/CKD mice (1 versus 3.77 ± 1.29), compared to WT SHAM mice (Figure 5). [score:4]
Taken together, our in vivo findings therefore mirror our in vitro results, suggesting that miR-126 and SDC-4 levels are concomitantly upregulated in vivo in ApoE/CKD mice aortas and in vitro in endothelial cells [16]. [score:4]
This miRNA is of special interest in the study of the endothelial phenotype, as it has been recently described that miR-126 directly targets both SDF-1/CXCL12 [14] and vascular cell adhesion molecule 1 (VCAM-1) [12]. [score:4]
This study also highlights the potential role of miR-126 on regulation of syndecan-4 expression. [score:4]
In contrast, Zernecke et al. showed that the increase in miR-126 expression was concomitant with enhancement of SDF-1/CXCL12 in an indirect pathway mediated by apoptosis [17]. [score:4]
miR-126 overexpression was a positive regulator of CXCR4 in our mo del. [score:4]
We did not find any evidence that SDC-4 is a direct target of miR-126 by looking at all known dedicated databases. [score:4]
On the other hand, Schober et al., 2014, showed that shear stress on HUVECs induces KLF-2 -dependent expression of pri-miR-126 but not miR-126-3p [35]. [score:3]
We show here that, in mice expressing a high level of miR-126 in their aortas (Apo-E KO/CKD mice), the SDC-4 was also significantly increased. [score:3]
No significant difference was observed for SDC-1 expression after anti-miR-126 transfection (Figure 4(c)). [score:3]
On the other hand, miR-126 modulation (under- or overexpression) did not change in our hands cell proliferation or apoptosis. [score:3]
As expected, we confirm here that miR-126 expression is significantly increased in aorta from Apo-E KO mice with CKD as previously described [16]. [score:3]
To confirm our findings in an in vivo mo del, we decided to analyze SDC-4 expression in vessels from a rodent mo del where miR-126 was shown to be increased [16]. [score:3]
3.6. miR-126 Is a Negative Regulator for VCAM-1 and SDF-1/CXCL12 and a Positive Regulator for RGS16, CXCR4, and SDC-4 in HUVECs. [score:3]
Apo-E KO/CKD mice present higher calcification and atherosclerosis levels than WT CKD mice; this could explain why we did not find an increase in WT CKD mice for miR-126 expression. [score:3]
miR-126 is a strongly expressed microRNA specific to endothelial cells which fine-tunes their phenotype [12]. [score:3]
miR-126 expression is also affected in the course of several physiological and pathological processes, such as angiogenesis, atherosclerosis, and the proinflammatory process [13, 14]. [score:3]
3.7. miR-126 and SDC-4 Expression Increased in Apo-E KO/CKD Mice. [score:3]
PCR reactions were performed with TaqMan Universal Master Mix (Applied Biosystems) and the following target probes (Applied Biosystems): hsa-miR-126 (UCGUACCGUGAGUAAUAAUGCG). [score:3]
However, no significant difference was observed for SDC-1 expression (1 versus 1.43 ± 0.61) after pre-miR-126 transfection (1 versus 0.87 ± 0.79) (Figure 4(c)). [score:3]
A significant increase of miR-126 expression was also observed after 24 h of LSS, compared to 10 min of LSS (0.58 ± 0.13 versus 1.88 ± 0.29). [score:2]
We show that morphologic and genetic changes due to LSS induce the production of endogenous miR-126, which in turn affects the regulation of chemokines and proteoglycans. [score:2]
A significant decrease of miR-126 expression in HUVECs was demonstrated after 10 min of LSS, compared to control static conditions (1 versus 0.58 ± 0.13). [score:2]
Regulation of miR-126 Levels in Endothelial Cells under Static and LSS Conditions. [score:2]
miR-126 was diversely regulated when exposed to LSS. [score:2]
We measured miR-126 expression, as it is the most abundant miRNA found during endothelial cell (EC) differentiation and in adult ECs [12] and it is deregulated in various cardiovascular disorders [14]. [score:2]
The results of our in vitro mo del confirm the previously described impacts of miR-126 on normal and inflammatory events. [score:1]
HUVECs were transfected with anti-miR-126 or pre-miR-126 or control scramble for 48 h, as previously described. [score:1]
But Harris et al. [34] found a potential binding site for KLF-2 in the Egfl7/miR-126 5′ flanking region. [score:1]
We therefore decided to investigate the link between the SDF-1/CXCL12/SDC-4 complex and miR-126, as SDF-1/CXCL12, another target of miR-126, is known to form a stable complex by binding SDC-4, which in turn binds CXCR4 [14, 17, 39]. [score:1]
2.5. miR-126 Transfection. [score:1]
We suggest that our mo del comprises a more complex system because transfection of miR-126 significantly decreased the SDF-1/CXCL12 level and increased its receptor CXCR4. [score:1]
In order to assess the specificity of miR-126 response to LSS, we studied another miR from endothelial cells, miR-222 (data not shown) and found that it was unaffected by a 24 h flow. [score:1]
The aim of the present study was (1) to observe the impact of laminar flow on human endothelial cell morphology and cytoskeleton distribution, (2) to analyze its effect on miR-126, adhesion molecule (VCAM-1), and syndecans (SDC-1, SDC-4), and (3) to study the miR-126 and SDC-4 levels in mice mo del of atherosclerosis with CKD. [score:1]
HUVECs were detached, quantified, and transfected in suspension with anti-miR-126 or pre-miR-126 or control scramble in the presence of siPort NeoFX Transfection agent according to the manufacturer's instruction (Ambion). [score:1]
Van Solingen et al. showed in a mouse hindlimb ischemia mo del that modulating miR-126 does not affect shear-stress -induced arteriogenesis [38]. [score:1]
Cells (5 × 10 [3]/well) were transfected with anti-miR-126 or pre-miR-126 or control scramble for 48 h, as previously described [18]. [score:1]
Deletion of miR-126 causes loss of vascular integrity and produces defects in endothelial cell proliferation, migration, and angiogenesis [15]. [score:1]
We decided to study whether our in vitro findings were mirrored in an in vivo mo del where miR-126 is increased. [score:1]
To assess miR-126 changes after LSS treatment, miRNAs were quantified by qRT-PCR (Figure 3(b)). [score:1]
[1 to 20 of 59 sentences]
13
[+] score: 141
Other miRNAs from this paper: mmu-mir-126a, hsa-mir-126
High glucose upregulates ADAM9 expression while MiR-126 mimic inhibits its expression in RAW 264.7 cells. [score:9]
In summary (Fig. 7), we describe a novel cellular pathway involved in diabetic efferocytosis, wherein diabetes -induced decrease in miR-126 expression results in upregulation of ADAM9 expression that in-turn leads proteolytic cleavage of MerTK and formation of inactive sMer. [score:8]
Image on the left shows that diabetes -induced decrease in miR-126 expression results in upregulation of ADAM9 expression that in-turn leads to proteolytic cleavage of MerTK and formation of inactive sMer. [score:8]
Image on the right depicts that overexpression of miR-126 suppresses ADAM9 expression, which in turn rescues efferocytosis in diabetic conditions. [score:7]
We propose that overexpression of miR-126 suppresses ADAM9 expression, which in turn rescues efferocytosis in diabetic conditions. [score:7]
Furthermore, we tested if miR-126 overexpression inhibits HG -induced increase in ADAM9 expression. [score:7]
Downregulation of miR-126 and corresponding increase in ADAM9 expression in diabetic human failing heart tissue. [score:6]
To examine the impact of miR-126 on ADAM9, we first overexpressed miR-126 in macrophages using mimics and observed a decrease in ADAM9 expression. [score:5]
In addition, the target validation performed using luciferase assay confirmed that ADAM9 is a direct target of miR-126 in macrophages. [score:5]
This pathway could be intervened at multiple levels for example, miR-126 mimics could be administered, ADAM9 expression could be targeted or the downstream MerTK could be addressed for therapeutic purpose. [score:5]
Interestingly, miR-126 expression was significantly down-regulated (Fig. 4A, *P < 0.05) in diabetic hearts as compared to non-diabetic heart tissue collected from patients with non-failing heart condition. [score:5]
To further understand the translational relevance of our findings, we determined the effect of diabetes on miR-126 expression in human failing heart. [score:5]
These studies confirm that miR-126 directly targets ADAM9 in macrophages. [score:4]
In addition, miR-126 has been shown to directly target ADAM9 thereby decreasing the invasiveness of bladder cancer cells 33. [score:4]
Studies have shown that in cancer cells, miR-126 regulates ADAM9 expression 7 21. [score:4]
To examine the impact of miR-126 on ADAM9 expression, we transfected macrophages with miR-126-specific or control mimics. [score:3]
With an aim to rescue the defective efferocytosis, miR-126 was overexpressed using mimics in the macrophages and efferocytosis was assessed. [score:3]
Next, to validate whether 3′UTR of ADAM9 contains a target sequence for miR-126 binding, macrophages were transfected with a Dual-Luciferase reporter vector containing the 3′-UTR of ADAM9 along with miR-126 mimic or non-specific control mimic. [score:3]
This sends “ready to eat signal” from the miR-126 overexpressed macrophages in diabetic conditions. [score:3]
The effect of miRNA mimic transfection on miR-126 expression was confirmed by RT-PCR (Supplementary Fig. S3C). [score:3]
In an effort to rescue impaired efferocytosis under diabetic conditions, we tested if miR126 overexpression in macrophages reverses impaired engulfment of apoptotic cardiomyocytes (Fig. 6). [score:3]
The miR-126 mimic, inhibitor and the respective controls were added at the final concentration of 60 nM with Lipofectamine Transfection Reagent (Invitrogen, Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. [score:3]
MiR-126 mimic, miR-126 inhibitor and their respective nonspecific control (mirVana [TM]miRNA mimic negative control, Ambion, Thermo Fisher Scientific, U. S. A) were used for transfection as described previously 44. [score:3]
ADAM9 expression increases in response to high glucose and this effect could be reversed by transfection of miR126 mimic in macrophages grown under HG conditions. [score:3]
Overexpression of miR-126 increased the percent of efferocytosis in HG conditions in macrophages. [score:3]
Macrophages (RAW 264.7 cells) were co -transfected with miR-126 mimic (60 nm/l), or miR mimic control (60 nm/l) and a reporter plasmid containing the 3′untranslated region (3′-UTR) of ADAM9 (ADAM9; MmiT077372-MT06, 100 ng, GeneCopoeia, Rockville, MD) or corresponding control empty luciferase reporter vector (CmiT000001-MT06, 100 ng, GeneCopoeia, Rockville, MD). [score:3]
miR-126 mimic transfection decreases HG -induced ADAM9 expression, when compared to control mimic treated macrophages (Supplementary Fig. S3D, *P < 0.05). [score:2]
In this study, we found that miR-126 expression is decreased in human diabetic failing heart tissues compared to non-diabetic normal heart tissues, which prompted us to further explore the role of miR-126 in diabetic efferocytosis. [score:2]
S. et al. MicroRNA-126 overexpression rescues diabetes -induced impairment in efferocytosis of apoptotic cardiomyocytes. [score:2]
miR-126 deficiency impairs efferocytosis via regulation of ADAM9. [score:2]
We observed that miR-126 mimic transfection significantly decreases ADAM9 mRNA (Fig. 2D, **P < 0.05) and protein expression (Fig. 2E,F) as compared to control mimic transfected macrophages. [score:2]
Furthermore, miR-126 expression was lower in HG treated cells as compared to NG treated macrophages (Fig. S3B). [score:2]
Interestingly, cells transfected with miR-126 mimic showed 30% decrease in luciferase activity (Fig. 2G, ***P < 0.01). [score:1]
miR-126 mimics restore high glucose -induced impairment of efferocytosis in RAW 264.7 cells. [score:1]
THP1 cells exposed to NG or HG and transfected with miR-126 mimic or control mimic were overlaid with labeled apoptotic human cardiomyocytes (SV40, green) and engulfment was assessed by microscopy. [score:1]
These data suggests that miR-126 mimics could possibly be used to rescue the defective efferocytosis in the diabetic patients with heart failure conditions. [score:1]
miR-126 mimics rescue diabetes -induced impairment of efferocytosis. [score:1]
Till date, the role of miR-126 in macrophage efferocytosis (especially in diabetic conditions) has not been explored, although endothelial miR-126 function is wi dely known. [score:1]
miR-126 mimic transfected macrophages rescue high glucose -induced impairment in efferocytosis. [score:1]
[1 to 20 of 39 sentences]
14
[+] score: 134
Comparing the inhibition of luciferase activity by the lentiviral expressed and endogenously expressed miRNAs, these results show that 1) the lentiviral expressed miR126 (both sense and antisense strands) and miR140 antisense strand exhibit potent RNAi activity; 2) the lentiviral expressed miR451 antisense strand does not have any RNAi activity; 3) the observed RNAi activity of lentiviral expressed miR21 (both sense and antisense strands) and miR140 sense strand could be due to endogenous miRNAs. [score:13]
In addition, the chicken miR126 -based expression system effectively inhibits reporter gene expression in human, monkey, dog and mouse cells. [score:7]
Although the expression cassette is based on chicken miR126, the resulting lentiviral vectors also effectively inhibit reporter gene expression in human, dog, mouse and monkey cells. [score:7]
In our development of lentiviral vectors capable of expressing multiple anti-influenza miRNAs, we have developed a novel chicken miR126 -based miRNA expression cassette. [score:6]
By testing different mouse and chicken miRNAs, different hairpins, and different numbers of miRNAs in the same lentiviral vector, we showed that the chicken miR126 -based design supports robust expression of artificial miRNAs and efficient knockdown of target genes both in transiently transfected cells and stably transduced cells (Figure 3c,d). [score:6]
Inhibition of luciferase activity by multiple anti-influenza miRNAs expressed from chicken miR126 -based lentiviral vectors. [score:5]
Inhibition of luciferase activity in non-chicken cells by miRNAs expressed from the miR126 -based lentiviral vector. [score:5]
The results showed that miR126-NP inhibited luciferase activity by 95% (Figure 3c); miR21-NP-shRNA by 70%; whereas miR21-NP and miR126-NP-shRNA exhibited only minor or no inhibition. [score:5]
Luciferase activity was inhibited by NP, PB1 and PA miRNAs by 70 to 95% (Figure 6a), suggesting that the chicken miR126 -based lentiviral vector is a general platform for expressing artificial miRNAs. [score:5]
Expression of both the sense and antisense strands of gga-miR21, gga-miR126 and gga-miR140 led to the inhibition of Renilla luciferase activity (Figure 2a). [score:5]
We have developed a novel chicken miR126 -based artificial miRNA expression system that can express one, two or three miRNAs from a single cassette in a lentiviral vector. [score:5]
These results demonstrate the versatility of the miR126 -based miRNA expression cassette for potent and effective silencing of target genes. [score:5]
Here, we show that in the miR126 -based lentiviral vector, miRNA stem-loop expression cassettes can be placed on both ends of the flanking sequences of pre-miRNA and still maintain efficient processing to produce RNAi activity. [score:3]
Based on the miR126-NP stem-loop design, we constructed miR126-PB1 and miR126-PA, encoding miRNAs targeting influenza polymerase components PB1 and PA, respectively. [score:3]
These results show that three artificial miRNAs can be expressed from a single cassette of the chicken miR126 -based lentiviral vector. [score:3]
Together, these results suggest that the miR126 -based design is novel and efficient for expression and processing of artificial miRNAs for RNAi activity. [score:3]
Based on these results, we selected gga-miR21 and gga-miR126 to construct lentiviral vectors to express NP miRNA. [score:3]
Because gga-miR21, gga-miR126, gga-miR140 and gga-miR451 are generally expressed, we assayed their activity in DF-1 cells by directly transfecting the reporter plasmids into DF-1 cells. [score:3]
All three vectors (pLB2-NP, pLB2-ScrA-NP and pLB2-ScrA-NP-ScrB) inhibited NP reporter activities to the same extent (Figure S2c), suggesting that inclusion of additional flanking sequences does not improve processing of miR126-NP. [score:3]
In addition, miR126 -based design are also efficiently expressed and processed in mammalian cells. [score:3]
The miR126 -based cassette can express one, two or three miRNAs from a single cassette in the context of a lentiviral vector. [score:3]
Based on literature reports and the miRNA database (miRBase), we chose four endogenous chicken miRNAs gga-miR21, gga-miR126, gga-miR140 and gga-miR451 that are expressed in many different tissues of adult chicken and chicken embryo [22]. [score:3]
The other design replaces the entire pre-miRNA stem-loop with one that is commonly used to express shRNA driven by Pol III promoters (miR21-NP-shRNA and miR126-NP-shRNA) (Figure 3b) [24]. [score:3]
We show that endogenous gga-miR21 is highly active in the DF-1 cells while gga-miR126 is not (Figure 2b). [score:1]
In a reverse correlation, artificial miRNA transcribed from miR126 -based design produced potent RNAi activity while that from miR21 -based design did not. [score:1]
0022437.g003 Figure 3(a) Structures and sequences of the miR21-NP and miR126-NP. [score:1]
The miR21-NP-shRNA was able to generate functional RNAi but miR126-NP-shRNA was not (Figure 3c). [score:1]
To test the RNAi activity of miR126-NP in stably integrated DF-1 cells, we transduced DF-1 cells with the miR126-NP lentivirus at an MOI of 0.1. [score:1]
Mature miR21 or miR126 sequences were replaced with anti-influenza NP sequences (blue). [score:1]
According to the miRBase, both sense and antisense strands of gga-miR21 and gga-miR126 can produce mature miRNAs. [score:1]
The miR126-PB1 cassette was cloned into Not I and Swa I sites at the 5′ end of flanking sequence of pLB2-NP lentiviral vector. [score:1]
Because the length of miR21 and miR126 sequences are different, slightly different anti-influenza NP sequences, both containing a 20 nucleotide core sequence of UUGUCUCCGAAGAAAUAAGA, were used to replace them (Figure 3a). [score:1]
Therefore, we constructed miR21-NP and miR126-NP lentiviral vectors (Figure 3a) where the anti-influenza NP sequences replaced the miR21 sense or miR126 antisense strand, respectively. [score:1]
The miR126-PB1 stem-loop was inserted at the 5′ end of the miR126 flanking sequence in pLB2-NP, producing lentiviral vector pLB2-PB1-NP (Figure 4a). [score:1]
Sequences of these anti-influenza artificial miRNA cassettes are listed in Table 2. To construct pLL3.7-NP, the termination signal (TTTTTT) was added to the 3′ end of miR126-NP and one T was added to the 5′ end of miR126-NP in order to reconstitute the U6 promoter. [score:1]
Thus, the chicken miR126 -based stem-loop hairpin can also be transcribed and processed from a Pol III promoter. [score:1]
The miR126-PA cassette was cloned into the Pme I site at the 3′ end of the flanking sequences (Figure 4a). [score:1]
Figure S2 Flanking sequences do not improve processing of miR126-NP. [score:1]
The miR126-PA stem-loop was inserted at the 3′ end of the miR126 flanking sequence in pLB2-PB1-NP, producing lentiviral vector pLB2-PB1-NP-PA. [score:1]
These results demonstrate that inclusion of flanking sequences does not enhance anti-NP activity by improving processing of miR126-NP. [score:1]
Figure S3 Complete sequences of miR21-NP, miR126-NP, miR-NP-shRNA and miR126-NP-shRNA. [score:1]
For gga-miR21, the more abundant one is the sense strand and for gga-miR126, the antisense strand. [score:1]
Thus, miR126-NP was cloned into the pLL3.7 lentiviral vector under the transcriptional control of the U6 promoter. [score:1]
The gga-miR126 based lentiviral vector design also works in other cell types. [score:1]
Furthermore, our results show that the miR126 -based design can be transcribed by either RNA Pol II or Pol III and the resulting miRNAs can be processed to exert RNAi activity. [score:1]
To exclude the possibility that the anti-viral activity is due to a non-specific effect of flanking sequences that improve processing of miR126-NP, we constructed pLB2-ScrA-NP lentiviral vector where a scrambled sequence replaced PB1, and pLB2-ScrA-NP-ScrB lentiviral vector where two scrambled sequences replaced PB1 and PA (Figure S2a and S2b). [score:1]
We also tested whether the miR126-NP stem-loop can be properly processed when transcribed from a RNA polymerase III promoter. [score:1]
DF-1 cells were infected with miR126-NP lentivirus (MOI = 0.1) and were selected with puromycin until GFP -positive cells reached >95%. [score:1]
miR126-PB and miR126-PA cassettes were replaced with miR126-ScrA and miR126-ScrB (b), respectively. [score:1]
Since RNAi processing machinery is highly conserved among different species, we tested whether the chicken miR126 -based lentiviral vector also works in other cell types including human epithelial cell 293T, Madin-Darby Canine Kidney (MDCK) cells, mouse embryonic fibroblast (MEF) cells, and African green monkey kidney (Vero) cells. [score:1]
[1 to 20 of 50 sentences]
15
[+] score: 125
In a mouse mo del, we have previously shown that miRNAs are potentially important therapeutic targets in allergic asthma, because inhibition of miR-126, one of a small subset of miRNAs upregulated in the airway wall, effectively suppressed Th2 -driven airway inflammation and other features of asthma. [score:10]
In this report, we describe the time course of altered expression of miRNAs in the airway wall in our mo del of chronic asthma and assess the potential of using an antagomir to inhibit miR-126 (the most highly -upregulated miRNA) as a therapeutic intervention. [score:8]
Moreover, inhibition of miR-126 by administration of an antagomir suppressed eosinophil recruitment into the airways but had no effect on chronic inflammation in the airway wall, or on changes of remo delling, suggesting that multiple miRNAs are likely to regulate the development of these lesions. [score:7]
To verify that delivery of ant-miR-126 was effective, we assessed the expression of TOM1 (target of Myb1) which is a negative regulator of IL-1β and TNF-α -induced signalling pathways. [score:6]
TOM1 has been defined as a target of miR-126 and is downregulated by it [17]. [score:6]
Notably, levels of expression of miR-126 were increased to a much greater extent than those of any other upregulated miRNA, and this was confirmed by qRT-PCR (Figure 1). [score:6]
In our previous study in an HDM -induced mo del of asthmatic airway inflammation, we showed that selective inhibition of miR-126 using a specific antagomir inhibited eosinophil recruitment and AHR [7]. [score:5]
While there was no change in the expression of TOM1 in animals treated with ant-scrambled when compared to naïve mice, TOM1 was markedly and significantly upregulated in animals treated with ant-miR-126 (Figure 3). [score:5]
Furthermore, we showed that inhibition of microRNA-126 (miR-126) by delivery of an antagomir (a cholesterol-linked single-stranded anti-sense RNA that selectively binds to this miRNA) effectively suppressed Th2 -driven airway inflammation, mucus hypersecretion and airway hyper-responsiveness [7]. [score:5]
Inhibition of miR-126 by long-term administration of an antagomir suppressed eosinophil recruitment into the airways. [score:5]
In the control group of animals that were not sensitised but were challenged for 6 weeks with aerosolised OVA, miR-126, -341 and -380-3p were found to be upregulated by 2-fold or greater. [score:4]
There was clear evidence of regulation of changes in miRNA expression over time: the relative increase was maximal after 2 weeks of inhalational challenge and subsequently declined, so that except for miR-126 all had returned to baseline levels by 6 weeks (Table 1). [score:4]
qRT-PCR confirmation of upregulation of miR-126 in airway wall tissue of animals following chronic challenge. [score:4]
In that previous study, which was based on a short-term mo del of HDM -induced asthmatic airway inflammation, miR-126 was the most highly upregulated miRNA in the airway wall. [score:4]
Because samples from the antagomir -treated animals were processed for assessment of expression of mRNA, not miRNA, we were unable to directly confirm the effects of treatment with antagomirs on the levels of miR-126. [score:4]
In the present study, we have confirmed that miR-126 is potentially a very important miRNA in asthmatic inflammation, because it was also the most highly upregulated miRNA in the chronic OVA challenge mo del. [score:4]
qRT-PCR confirmation of upregulation of TOM1 in airway wall tissue of animals that received 6 weeks of chronic challenge and treatment with ant-miR-126. [score:4]
Of these, miR-126 was again the most highly upregulated, with a 5-fold increase compared to naïve mice. [score:3]
Figure 1 Relative expression of miR-126. [score:3]
The evidence that treatment with ant-miR-126 was also effective in suppressing eosinophil recruitment into the airways in the mo del of chronic asthma is encouraging in terms of the potential of antagomir therapy. [score:3]
Unfortunately, we found that treatment with ant-miR-126 did not inhibit the progression of these lesions. [score:3]
Compared to naïve mice, there was selective upregulation of a modest number of miRNAs, notably miR-126, in the airway wall tissue of chronically challenged animals. [score:3]
In this mo del of chronic asthma, inhalational challenge with OVA initially increased the expression of a small number of miRNAs in the airway wall, notably miR-126. [score:3]
In this mo del of chronic asthma, there was an initial increase in expression of a small number of miRNAs in the airway wall, notably miR-126. [score:3]
However, in the short-term HDM mo del it was not possible to assess the effects of ant-miR-126 on chronic inflammation in the airway wall, or on the development of airway remo delling. [score:2]
However, treatment with ant-miR-126 had no effect on the chronic inflammatory response (Figure 2B). [score:1]
Mice received either the antagomir to miR-126 (ant-miR-126) or the control antagomir based on the scrambled sequence (ant-scrambled) once per week intranasally. [score:1]
Only 11 miRNAs exhibited a 2-fold or greater increase: these were miR-126, -197, -341, -145, -30c, -23b, -199a, -29a, -129-3p, -16 and -495 (Table 1). [score:1]
On the basis of the results obtained, animals were subsequently treated with either an antagomir to miR-126 (ant-miR-126) or a scrambled control antagomir once weekly during the 6 weeks of chronic challenge, and the effects on airway inflammation and remo delling were assessed using established morphometric techniques. [score:1]
The sequence of ant-miR-126 was: 5' mG. [score:1]
Thus our data suggest that ant-miR-126 alone has limited therapeutic potential in asthma. [score:1]
Long-term administration of ant-miR-126 significantly reduced the numbers of intraepithelial eosinophils in the conducting airways (Figure 2A). [score:1]
There was a reduction in animals treated with ant-miR-126 (median grade 1.0, range 0-2), although this difference was not statistically significant. [score:1]
Whether ant-miR-126 had any other cell-specific effects in this mo del is unknown. [score:1]
Effects of treatment with antagomir to miR-126 on changes of chronic asthma. [score:1]
Whether TOM1 has any function in this mo del is unknown; however, this finding confirmed that ant-miR-126 was biologically active in the airway wall of these animals. [score:1]
[1 to 20 of 36 sentences]
16
[+] score: 113
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-499
In this study, we have described for the first time the original expression pattern of egfl7 during retinal vascular development and shown that egfl7 and its intronic microRNA miR126 have separate expression patterns in this vascular network, unlike previously observed in other vascular beds. [score:6]
These results demonstrate for the first time a different expression pattern for egfl7 depending on blood vessel types and dissociate the regulation of egfl7 expression from that of miR126. [score:6]
During the development of the retina vasculature, the expression of miR126 strongly diverged from that of egfl7, as the venous-specific expression of egfl7 was not observed for miR126. [score:6]
While these cells preferentially express venous (COUP-TFII, EphB4) and arterial (EphrinB2, Dll4) markers respectively (Figure 5A, B), egfl7 and miR126 are similarly expressed in both cell types, regardless of their vascular origin (Figure 5C). [score:5]
The divergence between miR126 and egfl7 expression patterns is quite surprising as miR126 and egfl7 are both co-expressed in the non-CNS vasculature [10], [11], [14], [16]. [score:5]
miR126 is located within the intron 7 of the egfl7 gene and during embryonic vascular development, its expression was reported to depend on the same promoter region and to correlate with that of egfl7 in endothelial cells [14], [16]. [score:4]
0090455.g008 Figure 8 A: miR126 expression detected by in situ hybridization in P9 whole mount retina from pups injected with vehicle or with the blocking antibody directed against PDGFRβ (αPDGFRβ). [score:4]
In contrast, at the vascular front, the expression pattern of miR126 is similar to that of egfl7, as miR126 is also faintly detected or absent from the tip-cells when compared to its high expression in the stalk-cells (Figure 3C). [score:4]
This dissociated expression between miR126 and egfl7 suggests that they may share separate roles during retinal vascular development while functioning synergistically in other vascular bed. [score:4]
Here, we analysed the expression pattern of egfl7 and miR126 during retinal vascular development. [score:4]
B: higher magnification of miR126 expression detected by in situ hybridization in P9 whole mount retina from pups injected with vehicle or with the blocking antibody directed against the PDGFRβ (αPDGFRβ). [score:4]
A: miR126 expression detected by in situ hybridization in P9 whole mount retina from pups injected with vehicle or with the blocking antibody directed against PDGFRβ (αPDGFRβ). [score:4]
miR126 expression in mural cell deficient retinal vasculature. [score:3]
0090455.g005 Figure 5 Egfl7 and miR126 expression in HUVEC and HUAEC primary endothelial cells. [score:3]
In addition, miR126 is also expressed in capillary endothelial cells. [score:3]
The expression patterns of egfl7 and that of its intronic microRNA miR126 (also known as miR126-3p) during CNS vascularisation have not been described. [score:3]
miR126 expression in adult retina. [score:3]
In contrast, miR126 is homogenously expressed in all endothelial cells in the developing retinal vasculature, regardless of their venous or arterial origin. [score:3]
miR126 expression in the retinal vasculature. [score:3]
Right panel: higher magnification of the left panel; miR126 expression detected by in situ hybridization (upper panel); collagen IV immunostaining of the same retina area (lower panel). [score:3]
The homogenous vascular expression of miR126 was not affected either by the mural cells deficiency along the retinal vasculature as miR126 was still detected in veins, arteries and capillaries of the retina after PDGFRβ blocking antibody injection in pups (Figure 8). [score:3]
Egfl7 and miR126 expression in HUVEC and HUAEC primary endothelial cells. [score:3]
Inversely, egfl7 and miR126 display similar expression patterns at the vascular front, as they are both detected in the endothelial stalk-cells but not in the tip-cells of the vascular sprouts. [score:3]
miR126 expression decreases in the capillary endothelial cells at P14 (Figure 3B) and becomes barely detectable in the retinal vasculature of adult mice (Figure 4). [score:3]
Left panel: miR126 expression detected by in situ hybridization in flat mounted adult retina. [score:3]
miR126 has a different expression pattern than its host gene in the retinal vasculature. [score:3]
0090455.g004 Figure 4 Left panel: miR126 expression detected by in situ hybridization in flat mounted adult retina. [score:3]
The specific knockout of miR126 leads to embryonic and postnatal vascular defects in mice [14]– [16]. [score:2]
Within its intronic sequence, the egfl7 gene harbours the endothelial-specific miRNA miR126 which functions were clearly demonstrated during vascular development. [score:2]
A: egfl7 and miR126 transcripts detected by in situ hybridization on flat mounted retinas of nine day-old mouse pups (P9). [score:1]
C: Combined (Merge) collagen IV staining (middle panel) and miR126 in situ hybridization (left panel) at the leading edge of the P5 retinal developing vasculature. [score:1]
At all stages analysed (P2, P5, P9 and P14) miR126 was detected in both veins and arteries, as revealed by combined type IV collagen staining and miR126 in situ hybridization (Figure 3B). [score:1]
B: Combined collagen IV (Coll IV) immunostaining and miR126 in situ hybridization in flat mounted retinas of two- (P2), five- (P5), nine- (P9) and fourteen- (P14) day old mouse pups. [score:1]
0090455.g003 Figure 3 A: egfl7 and miR126 transcripts detected by in situ hybridization on flat mounted retinas of nine day-old mouse pups (P9). [score:1]
Indeed, miR126 was homogenously detected in the whole retinal vascular network, as illustrated at P9 in Figure 3A. [score:1]
Levels were normalized to those of HUVEC arbitrarily set to 1. C: Relative quantification by RT-qPCR of egfl7 and miR126 in HUVEC and HUAEC primary endothelial cells. [score:1]
After pre-hybridation, retina were either hybridized overnight in 50% formamide, 5X SSC, 0.1% Triton-X100, 9.2 mM citric acid, 500 µg/mL yeast RNA and 50 µg/mL heparin (hybridization buffer) containing 25 nM of miR126-3p 5′ and 3′ digoxigenin -labelled probe (Exiqon) at 51°C or in 50% formamide, 5X SSC, 0.1% Triton-X100, 2% Blocking powder (Roche), 0.5% CHAPS, 5 mM EDTA, 500 µg/mL yeast RNA and 50 µg/mL heparin (hybridization buffer) containing 1 µg/ml of digoxigenin -labelled egfl7 probe at 60°C. [score:1]
[1 to 20 of 37 sentences]
17
[+] score: 62
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-185, mmu-mir-483
While miR-126 has been shown previously to directly regulate IRS-1 translation in hepatocytes [42] and in HEK293 and MCF7 breast cancer cells [41], we have shown for the first time that IRS-1 is a potential target of miR-126 in adipose tissue. [score:7]
Whilst IRS-1 levels in adipose tissue are dramatically reduced in the Mat-Ob group, miR-126 expression is elevated in parallel, suggesting that miR-126 can regulate IRS-1 protein expression in adipose tissue. [score:6]
To confirm that miR-126 mediates the repression of IRS1 translation, the 3'-UTR of IRS1 encompassing the miR-126 target site (Figure 4B) was cloned in a luciferase -based reporter plasmid. [score:5]
In contrast, regulation of IRS-1 synthesis can occur through miRNA -mediated reductions in translation [41,42] and our findings support a role for such a mechanism through binding of miR-126. [score:4]
Although some studies show miR-126 to be co-regulated with its host gene Egfl7, miR-126 expression did not parallel that of Egfl7 in adipose tissue in the current study. [score:4]
Luciferase reporter constructs were generated by cloning the 3'-UTR portion of rat IRS-1 mRNA containing the seed target sequence of miR-126. [score:3]
IRS-1 reduction and miR-126 overexpression is retained in isolated Mat-Ob primary preadipocytes differentiated in-vitro. [score:3]
2.9 Luciferase reporter constructs were generated by cloning the 3'-UTR portion of rat IRS-1 mRNA containing the seed target sequence of miR-126. [score:3]
HeLa cells were used for miR-126 over expression studies, and HEK293 cells for miR-126 antagonism studies. [score:3]
In the current study, we describe a novel observation that maternal diet -induced obesity leads to an increased expression of miR-126 in adipose tissue. [score:3]
A programmed increase in miR-126 in response to maternal diet -induced obesity therefore provides one mechanism by which IRS-1 may be silenced at the translational level. [score:3]
Of these five miRNAs, only miR-126 was differentially expressed in adipose tissue of the Mat-Ob group (Figure 4A). [score:3]
0.94±0.15 in the Mat-Ob group), which suggests that miR-126 is differentially regulated from its host gene. [score:2]
This data therefore suggests a direct interaction between miR-126 and its binding site in the 3'-UTR of IRS1. [score:2]
In parallel the increased expression of miR-126 was also maintained in preadipocytes and differentiated adipocytes isolated from the Mat-Ob group compared to those isolated from control offspring (Figure 6B). [score:2]
This suggests that the loss of IRS-1 is not driven by proteosomal degradation, and that it results from decreased protein synthesis, consistent with the observed increase in miR-126. [score:1]
The construct was co -transfected in HeLa cells with increasing concentration of miR-126 mimic. [score:1]
The 2'-O-Methyl rno-miR-126 antagonist sequence used was CGCAUUAUUACUCACGGUACGA, where every base contained a 2'-O-Methyl modification. [score:1]
Cells were transfected with 100 ng of Firefly-luciferase reporter construct with 10 ng of Renilla-luciferase pRL-SV40 (Clontech, Basingstoke, UK) as a transfection control and increasing concentrations of hsa-miR-126 mimic (Life Technologies, CA, USA) (0, 10, 50 and 100 nM in HeLa) or miR-126 2'-O-Methyl antagonist (Sigma-Aldrich, Dorset, England) (0, 10, 50 and 100 nM in HEK293) using RNAi Max transfection agent (Invitrogen, Paisley, UK). [score:1]
The miR-126 primary sequence is located within an intron of Egfl7. [score:1]
The maintenance of the programmed phenotype (i. e. decreased IRS-1 and increased miR-126 in isolated preadipocytes differentiated in vitro) strongly suggests that the mechanism is cell autonomous and is retained following multiple rounds of cell division. [score:1]
To determine if Eglf7 mRNA was elevated concomitantly with miR-126, we measured Egfl7 mRNA expression. [score:1]
Conversely, introduction of a miR-126 antagonist in Hek293 cells resulted in increased luciferase output of a reporter construct under the control of the IRS1 3'-UTR (Figure 5B). [score:1]
Crucially, we showed that the programmed loss of IRS-1 protein and increase in miR-126 in adipose tissue resulting from maternal diet -induced obesity is maintained in primary adipocyte precursors isolated from epididymal fat from 8-week-old offspring, which were then expanded in culture and then differentiated into adipocytes. [score:1]
[1 to 20 of 24 sentences]
18
[+] score: 60
We observed in our tumor samples a downregulation of miR-125a-5p, miR-125b, miR-126, miR-145 and let-7g genes, which have been shown to be related to hormonal settings and ErbB2 status of the tumor: miR-125a-5p and miR-125b downregulate ErbB2 and ErbB3 expression [31], miR-126 and let-7g are upregulated in ErbB2 -negative tumors, whereas miR-145 is upregulated in ErbB2 -negative tumors and upregulated in estrogen-receptor -positive and progesterone-receptor -positive tumors [13]. [score:18]
Given the downregulation of miR-126 in male breast cancers, we tested VEGF IHC expression in our series of male breast cancers/gynecomastia. [score:6]
In fact, miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed whereas miR-26b, miR-607 and miR-135b were overexpressed in cancer samples examined, in comparison with the gynecomastia samples. [score:5]
miR-125b, miR-126, miR-10b, miR-10a and miR-191 were underexpressed in cancer samples, whereas miR-26b, miR-607 and miR-135b were overexpressed. [score:5]
Figure 3miR-10b and miR126 genes are downregulated in male breast cancers versus gynecomastia. [score:4]
On the other hand, miR-145 [10, 20], miR-10b [10], let-7g [19], miR-125a-5p [10, 31], miR-125b [31] and miR-126 [40] have been described as downregulated. [score:4]
Other miRNAs similarly altered after the enrichment, such as miR-191, miR-454, miR-10a, miR-374a, miR-10b, miR-218, miR-140-3p and miR-126, were downregulated in cancer. [score:4]
In addition, miR-335, miR-206 and miR-126 have been identified as suppressors of breast cancer metastasis [33]. [score:3]
VEGF is also a target protein of miR-126 [39]. [score:3]
Our IHC study supports previous reports on the relationship of miR-10b and miR-126 and their respective gene targets [14, 39]. [score:3]
Previous studies have demonstrated that there is a large number of deregulated miRNAs in human breast cancer (in particular, miR-10b, miR-17-5p, miR-21, miR-27a, miR-27b, miR-125a, miR-125b, miR-126, miR-145, miR-155, miR-200c, miR-206, miR-336 and the let-7 family) [9- 31]. [score:2]
To confirm the results of microarray analysis, we performed quantitative real-time PCR analysis on a limited number of samples (19 cancer samples, five gynecomastia samples) using probes corresponding to miR-125b, miR-126, miR-10b, miR-10a, miR-191, miR-26b, miR-607 and miR-135b (Figure 2). [score:1]
According to previous reports in female breast carcinogenesis, the most interesting and promising miRNAs of this male breast cancer signature are miR-10b, miR-126, miR-125a-5p and miR-125b [14, 31, 40]. [score:1]
analysisTo confirm the results of microarray analysis, we performed quantitative real-time PCR analysis on a limited number of samples (19 cancer samples, five gynecomastia samples) using probes corresponding to miR-125b, miR-126, miR-10b, miR-10a, miR-191, miR-26b, miR-607 and miR-135b (Figure 2). [score:1]
[1 to 20 of 14 sentences]
19
[+] score: 58
Other miRNAs from this paper: hsa-mir-17, mmu-mir-126a, hsa-mir-126, mmu-mir-17
Since miR-126 and miR-126* are associated with CNS vasculature abnormalities and regulation of CAM expression [17] in addition to downregulation of EGFL7 [18], we assessed the course of EAE in miR-126/miR-126*- KO. [score:7]
Mattes J Collison A Plank M Phipps S Foster PS Antagonism of microRNA-126 suppresses the effector function of TH2 cells and the development of allergic airways diseaseProc. [score:6]
Expression of miR-126 and miR-126* by ECs has been implicated in CNS vessel development [16], and expression by leukocytes in autoimmune conditions 32– 36. [score:6]
Finally, our EAE data in a new inducible EGFL7- KO restricted to the endothelium that spares miR-126/miR-126* demonstrate that EAE worsening in the absence of EGFL7 is independent of its expression in non-endothelial cells, of developmental abnormalities, and of the expression of miR-126/miR-126*. [score:6]
Zhao S MicroRNA-126 regulates DNA methylation in CD4+ T cells and contributes to systemic lupus erythematosus by targeting DNA methyltransferase 1Arthritis Rheum. [score:3]
The Egfl7fl/fl;Cdh5(PAC)-CreERT2 is a tamoxifen-inducible KO of egfl7 restricted to blood vessels, which preserves expression of miR-126/miR-126* [19]. [score:3]
miR-126/miR-126*- KO is not associated with more severe EAEThe egfl7 gene harbors the microRNAs miR-126 and miR-126*, encoded by its intron 7, and the KO of egfl7 can result in altered miR-126 and miR-126* expression [16]. [score:3]
Before drawing conclusions from our findings in EGFL7- KO mice, however, we excluded an underlying role of the miRNA miR-126 and miR-126*, expressed in the non-coding intron 7 of the EGFL7 gene, as the impact of this miR on the course of EAE has never been reported. [score:3]
The egfl7 gene harbors the microRNAs miR-126 and miR-126*, encoded by its intron 7, and the KO of egfl7 can result in altered miR-126 and miR-126* expression [16]. [score:3]
In fact, a trend towards a milder EAE was observed in miR-126/miR-126*- KO, the opposite of our observations in EGFL7- KO, therefore suggesting a direct beneficial effect of EGFL7 on EAE. [score:2]
Asgeirsdottir SA MicroRNA-126 contributes to renal microvascular heterogeneity of VCAM-1 protein expression in acute inflammationAm. [score:2]
Our data therefore outlines a beneficial role of EGFL7 at the level of the endothelium in EAE, which is not dependent on miR-126/miR-126*- KO or developmental abnormalities. [score:2]
Moreover, active EAE in Rag2 [−/−] cgn [−/−] mice reconstituted with CD4 T lymphocytes isolated from miR-126/miR-126*- KO mice versus CD4 T lymphocytes from WT or heterozygous (Het) littermates was not associated with an earlier onset (d14-18 versus d13-17 post-immunization respectively) or a more severe course of EAE. [score:1]
Wang S The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesisDev. [score:1]
To test whether the observed effect of EGFL7- KO in EAE is mediated by the loss of EGFL7 or miR-126/miR-126* in immune cells, we performed active EAE in Rag2 [−/−] cgn [−/−] mice 4 weeks after reconstitution with 4 million CD4+ T lymphocytes from either EGFL7- KO or miR-126/miR-126*- KO versus their respective WT or Het littermates. [score:1]
Constitutive miR-126/miR-126 * [−/−] (miR-126/miR-126*- KO) mice were provided by Marc Tjwa (Goethe University, School of Medicine, Frankfurt am Main, Germany). [score:1]
No significant difference was observed in either onset or severity of EAE between miR-126/miR-126*- KO and WT littermates (Supplementary Fig.   1m, n), and a trend towards a reduced EAE severity was present, suggesting that there was no major contribution of miR-126/miR-126*- KO to the EAE worsening observed in EGFL7- KO. [score:1]
The KO was achieved by removal of intron 7 of the egfl7 gene that harbors miR-126 and miR-126* genes as previously described [46]. [score:1]
Nikolic I Plate KH Schmidt MH EGFL7 meets miRNA-126: an angiogenesis allianceJ. [score:1]
To confirm that BBB-derived EGFL7 plays a beneficial role in neuroinflammation in vivo, we took advantage of a new tamoxifen-inducible conditional KO of EGFL7 restricted to vascular ECs (Egfl7fl/fl;Cdh5(PAC)-CreERT2) that spares miR-126/miR-126* [19]. [score:1]
Indeed, recent data supports the hypothesis that EGFL7 mediates its vascular effects beyond the functions of miR-126/miR-126* [37]. [score:1]
However, our data revealed neither changes in onset nor severity of EAE between miR-126/miR-126*- KO and WT littermates that could account for the observed effects in EGFL7- KO. [score:1]
miR-126/miR-126*- KO is not associated with more severe EAE. [score:1]
For active EAE, typically 8 to 12-week-old C57Bl/6 mice, EGFL7- KO mice, microRNA miR-126/miR-126*- KO, Egfl7fl/fl;Cdh5(PAC)-CreERT2 and respective WT or heterozygous (Het) littermates, and Rag2 [−/−] cgn [−/−] mice were immunized subcutaneously with 200 µg of myelin oligodendrocyte glycoprotein (MOG [35–55]) peptide, emulsified in complete Freund’s adjuvant, and supplemented with heat-inactivated M. tuberculosis (Hooke kit) according to the manufacturer’s instructions. [score:1]
[1 to 20 of 24 sentences]
20
[+] score: 52
For example, miR-122, 24, 106b, 696 and 15b were up-regulated, but miR-126, 145 and 103 were down-regulated (Figure 4). [score:7]
More important, overexpression of miR-126 or inhibition of miR-24 markedly improved fat accumulation in AML-12 cells expose to FFA (Figure 5). [score:5]
Overexpression of miR-126 or inhibition of miR-24 antagonizes FFAs -induced lipid accumulation in AML12 hepatocytes. [score:5]
On the other hand, miR-126 is known as an endothelium-specific miRNA, and has been reported to promote angiogenesis by targeting SPRED1 to inhibit VEGF signaling [24]. [score:5]
To determine whether the disordered miR-126 or miR-24 levels induced by free fat acid (FFA) affect cellular triglyceride (TG) accumulation, we examined the TG levels in AML-12 cells transfected with mimic (Negative control) NC, miR-126 mimic or inhibitor NC, miR-24 inhibitor using Nile red staining. [score:5]
Whether up-regulation of reduced hepatic miR-126 using miR-126 mimic (or down-regulation of elevated hepatic miR-24 using antagomiR-24) approaches would alleviate liver steatosis in high fat diet-fed mice is currently under investigation in our laboratory. [score:5]
Our results validated that miR-126 was down-regulated in ob/ob mouse liver. [score:4]
In conclusion, the present study demonstrated that various miRNAs were differentially expressed in ob/ob mouse liver (especially for miR-126 and miR-24), suggesting that they were tightly linked to obesity and other metabolic disorders. [score:3]
0080774.g005 Figure 5 AML12 cells were transfected with either miR-126 mimic, miR-24 inhibitor or their corresponding negative controls. [score:3]
AML12 cells were transfected with either miR-126 mimic, miR-24 inhibitor or their corresponding negative controls. [score:3]
To test the biological roles of miR-126 and miR-24, miR-126 mimic, miR-24 inhibitor or their corresponding negative controls were transfected into AML12 cells using lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocol. [score:3]
miR-126 or miR-24 Regulates Lipid Accumulation in AML12 Hepatocytes Exposed to FFAs. [score:2]
The functional analysis in AML-12 liver cells showed that dysregulation of miR-126 and miR-24 is correlated with fat accumulation (Figure 5). [score:2]
[1 to 20 of 13 sentences]
21
[+] score: 52
Other miRNAs from this paper: mmu-mir-126a
Kuhnert et al. went as far as stating that the observed phenotype in the prior studies was due to miR126 deregulation since in their study, targeted disruption of miR126 (but not EGFL7) led to phenotypic changes seen in the prior non-specific EGFL7-knockdown animals. [score:5]
When Kuhnert et al. [22] generated an EGFL7 knockout that preserved miR126 expression, they did not observe vascular abnormalities, casting doubt on the role of EGFL7 in vascular development. [score:5]
When Kuhnert et al. [22] generated an Egfl7 knockout that preserved miR126 expression, they did not observe vascular abnormalities, calling into question the role of EGFL7 in vascular development. [score:5]
They asserted that the observed phenotype in the prior studies was due to miR126 deregulation since targeted disruption of miR126, but not EGFL7, led to phenotypic changes seen in the prior nonspecific EGFL7-knockdown animals. [score:5]
This result indicates that EGFL7 knockdown by siRNA can inhibit angiogenesis independently of mir-126 levels. [score:4]
Our study, using siRNA technology that targets the messenger RNA, bypasses interference with the intronic miR126 (see Fig. S3) and supports the notion that egfl7 has direct angiogenic effects. [score:4]
Figure S3 To identify mir-126 expression in mouse endothelial cells after the treatment of EGFL7 siRNA, total RNA with mir-126 was extracted from mouse endothelial cells in the matrigel using QuantiGene Sample Processing Kit (Affymetrix, Santa Clara, CA) according to manufacture’s protocol. [score:3]
Thus, knockout studies of EGFL7 may alter the epigenetic regulation of angiogenesis by miR126. [score:3]
As seen in Figure 1, siRNA knockdown of EGFL7 but not control scrambled siRNA resulted in significant decrease in tube formation both on day 3 and day 5. Since it is well known and mir-126 is localized within intron 7 of EGFL7 [24] and that some prior studies have shown that some of the angiogenic functions of EGFL7 maybe mediated via interference of its intronic miR126 we investigate whether EGFL7 knockdown by siRNA had any effects on the expression of mir-126 or not. [score:3]
As seen in Fig. S3, we could not observe a significant difference of miR-126 expression between control and EGFL7 siRNA treatment. [score:3]
To identify mir-126 expression in mouse endothelial cells after the treatment of EGFL7 siRNA, total RNA with mir-126 was extracted from mouse endothelial cells in the matrigel using QuantiGene Sample Processing Kit (Affymetrix, Santa Clara, CA) according to manufacture’s protocol. [score:3]
In addition the EGFL7 intronic miR126 [32], [33] was shown to promote angiogenesis by inhibiting protein production of endogenous VEGF repressors within endothelial. [score:3]
However, the presence of miR126 within the Egfl7 gene complicates investigations into its role in vascular development, because knockout studies of EGFL7 may alter epigenetic regulation by miR126 as well. [score:2]
However, the role of Egfl7 in vascular development has been complicated by the presence of the microRNA miR126 within its gene. [score:2]
The probe for miR126 sequence (ucguaccgugaguaauaaugcg) was purchased from Affymetrix. [score:1]
To capture mir-126 from samples, the capture plates containing samples and working probe set (capture extender (CE), label extender (LE), blocking probe (BL)) were incubated overnight at 55°C±1°C for hybridization. [score:1]
[1 to 20 of 16 sentences]
22
[+] score: 52
Whereas, no difference is observed between MAECs transfected with a specific antisense inhibitor for miR-126 (miR-126 inhibitor) and MAECs transfected with a non -targeting antisense inhibitor (control inhibitor) (Figure 2b). [score:11]
miR-126 levels were modulated by transfecting MAECs with 0.5, 5 and 50 nmol/L miR-126 -mimic (mmu-miR-126 miRIDIAN Mimic) or miR-126 -inhibitor (mmu-miR-126 miRIDIAN Harpin Inhibitor). [score:5]
Zhang J. Du Y. Y. Lin Y. F. Chen Y. T. Yang L. Wang H. J. Ma D. The cell growth suppressor, miR-126, targets IRS-1Biochem. [score:5]
PHLPP2 is a high confidence predicted target of both miR-214 and miR-126, based on our search using 10 different miRNA target prediction programs to retrieve information on any interaction between PHLPP2 and these specific miRNAs. [score:5]
While very little is known about miR-450a to support its selection as a candidate for further investigation on its potential role in MGO -treated MAECs, it has been shown that miR-126 is able to downregulate IRS-1, suppressing Akt activation [36, 37]. [score:4]
Chistiakov D. A. Orekhov A. N. Bobryshev Y. V. The role of miR-126 in embryonic angiogenesis, adult vascular homeostasis, and vascular repair and its alterations in atherosclerotic diseaseJ. [score:3]
This search has allowed the identification of candidate genes involved in insulin signal transduction as potential targets of miR-214 and miR-126. [score:3]
Employing an integrated approach using public bioinformatics tools, we have identified several phosphatases as potential targets of both miR-214 and miR-126. [score:3]
Taken together, these results suggest an inverse correlation between PHLPP2 and miR-214, but not with miR-126, supporting the bioinformatic target prediction only for miR-214. [score:3]
By contrast, no effect is obtained in MAECs transfected with a RNA oligonucleotide specific for miR-126 in comparison with cells transfected with a non -targeting control oligonucleotide (control mimic) (Figure 2c). [score:3]
Taken together, these results show that miR-214, but not miR-126, is able to modulate the protein levels of PHLPP2. [score:1]
15.18 26111035 9. Zampetaki A. Kiechl S. Drozdov I. Willeit P. Mayr U. Prokopi M. Mayr A. Weger S. Oberhollenzer F. Bonora E. Plasma microRNA profiling reveals loss of endothelial miR-126 and other microRNAs in type 2 diabetesCirc. [score:1]
We obtained positive information from 8 and 7 programs for miR-214 and miR-126, respectively. [score:1]
We confirmed that 4 out of these 84 miRNAs were significantly altered in MGO -treated MAECs: miR-126, miR-190a, miR-214 and miR-450a [21]. [score:1]
By our previous investigations, we have also found that the expression of other three miRNAs is related to diabetes: miR-214, miR-450a, and miR-126 are reduced by 32%, 22%, and 30%, respectively, in MAECs exposed to MGO [21]. [score:1]
On the contrary, by modulating the miR-126 levels in MAECs, no alterations in the PHLPP2 protein levels are observed. [score:1]
For the present study, both miR-214 and miR-126 appear to be attractive candidates, since they control endothelial cell function and angiogenesis [30, 31, 32, 33, 34, 35]. [score:1]
[1 to 20 of 17 sentences]
23
[+] score: 46
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The lower expression of miR-126* is in agreement with reports that this miRNA is down-regulated in prostate cancer metastasis [34] and that ectopic expression of miR-126* inhibited the migration and invasiveness of prostate cancer cells [34]. [score:10]
In a number of single studies, miRNAs such as let-7d [26], let-7i [26] and miR-210 [23] were also found to be up-regulated in prostate cancer, in contrast to let-7g [23], miR-27b [28], miR-99a [23], miR-126 [54], miR-128 [26], miR-152 [28], miR-200a [58] and miR-449a [59] which were down-regulated in prostate cancer samples. [score:7]
Interestingly, miR-126, a miRNA reported as down-regulated in prostate cancer relative to normal prostate tissue [54], was up-regulated in the metastatic xenograft line. [score:7]
The down-regulation of miR-16 [25], miR-34a [33], miR-126* [34], miR-145 [35] and miR-205 [36] correlated with the development of prostate cancer metastasis. [score:5]
Thus miR-144* was substantially more expressed than miR-144 in both metastatic and non-metastatic libraries; similarly miR-126* was more expressed than miR-126, but only in the non-metastatic library. [score:5]
Thus some of the miRNAs have already been linked to this phenomenon, in particular down-regulated miRNAs such as miR-16, miR-34a, miR-126*, miR-145 and miR-205, supporting the validity of our analytical approach. [score:4]
A number of these miRNAs (21/104) have previously been reported to show similar down- or up-regulation in prostate cancers relative to normal prostate tissue, and some of them (e. g., miR-16, miR-34a, miR-126*, miR-145, miR-205) have been linked to prostate cancer metastasis, supporting the validity of the analytical approach. [score:4]
In this context it is of interest that whereas in LNCaP cells, the antagomir of miR-126 did not affect cell migration, the antagomir of miR-126* induced cell migration with up-regulation of prostein [34], suggesting that miR-126* affects cell migration more than miR-126. [score:4]
[1 to 20 of 8 sentences]
24
[+] score: 43
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-142a, mmu-mir-142b
Expression of miR-142 specifically suppressed protein production from NP segments carrying the corresponding target site (142T and DblT) but had no effect on ScrbT or 126T; similarly, expression of miR-126 suppressed NP protein production from 126T and DblT (Fig 1B) [32]. [score:11]
HEK-293T cells were co -transfected with plasmids expressing specific miRNAs (vector, miR142, miR126) and NP with miRNA target sites, and NP expression was analyzed by western blot. [score:7]
We also engineered an NP segment carrying two miR-142-3p and two miR-126-3p target sites (DblT) as well as a control NP segment carrying a scrambled target sequence (ScrbT, Fig 1A). [score:5]
Specifically, we generated H5N1 viruses containing endothelial cell specific miR-126 target sites (H5N1-126T) or hematopoietic cell specific miR-142 target sites (H5N1-142T), such that viral replication was abrogated in endothelial cells or hematopoietic cells, respectively. [score:5]
DblT refers to the NP segment carrying two miR-142-3p and two miR-126-3p target sites. [score:3]
To generate H5N1 viruses incapable of replicating exclusively in hematopoietic or endothelial cells, we incorporated four copies of miRNA target sites (complementary sequence of a miRNA) for miR-142-3p (142T) or miR-126-3p (126T), respectively, into the 3’ UTR of the viral NP segment (Fig 1A). [score:3]
The Complementary sequences of miR-126-3p (126T; CGCATTATTACTCACGGTACGA), miR-142-3p (142T; TCCATAAAGTAGGAAACACTACA), and scrambled target sequence (ScrbT; GAGAATCTAAACGACTCAATACA) were incorporated into the NP segment. [score:3]
Prior miRNA profiling studies have shown that miR-142 and miR-126 are specifically expressed in hematopoietic or endothelial cells, respectively [27, 28, 30, 31]. [score:3]
Restriction of H5N1 replication via endothelial cell specific miR-126 ameliorated disease symptoms, limited mortality, and prevented systemic viral spread as compared to a control virus in both mouse and ferret mo dels. [score:2]
Conservation of miR-126-3p and miR-142-3p among different species. [score:1]
[1 to 20 of 10 sentences]
25
[+] score: 41
Similarly, at E17.5 in Pkd1 [-/- ]animals, the up-regulation of Fgfr3 and Fgf10 (components of MAPK signaling) and down-regulation of their target miRNAs- miR-488 and miR-126-5p respectively, may stimulate MAPK signaling and cell proliferation in Pkd1 [-/- ]samples. [score:9]
Similarly, down-regulation of miR-10a, miR-126-5p, miR-204, and miR-488 at E17.5 were inversely correlated with up-regulation of Ltbp1, Edil3, P2rx7, and Fgfr3 respectively (Additional file 21). [score:7]
miR-204 and miR-488 (A) were down-regulated in Pkd1 [-/- ]kidneys whereas miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429 (B) were up-regulated in Pkd1 [-/- ]kidneys. [score:7]
Expression of 9 miRNAs (miR-204, miR-488, miR10a, miR-30a, miR-96, miR-126-5p, miR-182, miR-200a and miR-429), predicted to target significantly regulated genes at E14.5 was assayed using miRNA-qPCR. [score:5]
For example, miR-126 promotes angiogenesis and vascular integrity [68] by inhibiting the production of natural repressor (SPRED1 and PIK3R2) of VEGF signaling, suggesting that it may serve as an effective target for anti-angiogenic therapies. [score:5]
Expression of 9 miRNAs (miR-10a, miR-126-5p, miR-200a, miR-204, miR-429, miR-488, miR-96, miR-182 and miR-30a-5p), predicted to target significantly regulated genes at E17.5 was evaluated using miRNA-qPCR assays. [score:3]
We tested this hypothesis by determining the differential expression of 9 miRNAs (mmu-miR-10a, mmu-miR-30a-5p, mmu-miR-96, mmu-miR-126-5p, mmu-miR-182, mmu-miR-200a, mmu-miR-204, mmu-miR-429, and mmu-miR-488) between WT and Pkd1 [-/- ]genotypes at E14.5 and E17.5 (Figures 7 and 8). [score:3]
We observed that miRNAs: miRs-10a, -30a-5p, -96, -126-5p, -182, -200a, -204, -429, and -488; and the such as miR-126-5p-Fgf10, miR-488-Fgfr3, miR-182-Hdac9, miR-204-P2rx7 and miR-96-Sox6 (as shown in Table 6) have not been previously reported in ADPKD. [score:1]
We found that miR-126-5p may be involved in calcium, EGF, MAPK signaling, and neuroactive ligand-receptor interaction (Figure 9; Additional file 21). [score:1]
[1 to 20 of 9 sentences]
26
[+] score: 39
miRNA -based therapeutics is showing promise in animal mo dels and elevation or inhibition of miR-126 has been proposed as a possible therapeutic strategy in ischemic heart disease, cancer, retinopathy and stroke [9]. [score:5]
miR-126, miR-24 and miR-23a are selectively expressed in microvascular endothelial cells in vivo, whereas miR-145 is expressed in pericytes. [score:5]
miR-126 controls VCAM-1 (vascular cell adhesion molecule-1) expression in human umbilical vein endothelial cells (HUVECs) [8] and was recently shown to regulate vascular integrity and angiogenesis in vivo [9- 11]. [score:4]
By screening for mature miRNAs with vascular expression patterns we found that miR-145, miR-126, miR-23a, and miR-24 were enriched in the microvasculature in vivo. [score:3]
miR-145, miR-126, miR-24, and miR-23a were selectively expressed in microvascular fragments isolated from a range of tissues. [score:3]
Differential expression of miR-126, miR-145, miR-24, and miR-23a in the mature microvasculature. [score:3]
We identified miR-145, miR-126, miR-24 and miR-23a as enriched in microvessels, and showed that microvascular expression of miR-145 is due to its presence in pericytes. [score:3]
qRT-PCR analysis showed that miR-126 was highly differentially expressed in CD31+ fragments in all adult organs assayed, with fragment-to-surrounding tissue ratios ranging from 90 to 250. [score:2]
miR-145, miR-126, miR-24 and miR-23a were consistently enriched in adult microvessels. [score:1]
Based on the above described in silico analyses, we chose to further characterize the expression of miR-126-3p (the predominant mature form of this miRNA, hereafter referred to as miR-126), miR-145, miR-30d, miR-23b, miR-24 and miR-23a; the latter being co-transcribed with miR-24 [1]. [score:1]
miR-126 showed strong enrichment in CD31+ fractions from both tissues (Figure 3). [score:1]
Among those with favorable scores in this analysis, miR-126-3p and miR-126-5p (the two mature forms of miR-126) stood out as strongly enriched in both glomerulus and lung (Figure 1b). [score:1]
As expected, miR-145 stained smooth muscle cells in larger vessels whereas miR-126 stained ECs (staining patterns in kidney arteries are shown in Figure 4c, d). [score:1]
In situ hybridization was performed using a 3' DIG-labeled miRCURY LNA probe to mouse miR-145 and miR-126 (Exiqon, Vedbaek, Denmark) as previously described [26]. [score:1]
Many of the miRNAs we identified scored favorably in one or more of these screens, including miR-23a [6- 8, 12], miR-23b [7, 8, 12], miR-24 [7, 8, 12] and miR-126 [6, 8, 12]. [score:1]
Next, we performed in situ hybridization on tissue sections using probes specific to miR-145 and miR-126. [score:1]
miR-126, for which an important functional role in the endothelium has already been firmly established [8- 11], stood out as strongly enriched in microvascular fragments from mature mouse tissues as well as in tissues undergoing active angiogenesis. [score:1]
In situ hybridization and immunohistochemistry In situ hybridization was performed using a 3' DIG-labeled miRCURY LNA probe to mouse miR-145 and miR-126 (Exiqon, Vedbaek, Denmark) as previously described [26]. [score:1]
In contrast, the endothelial marker Cd31 and miR-126 were highly enriched in the CD31+ fraction. [score:1]
[1 to 20 of 19 sentences]
27
[+] score: 34
These data suggest that down-regulation of let7c, miR29a and miR29c, and miR126 may be a major event during cataract formation in the SCR, as changes in miRNA expression levels were increased in cataractous lenses. [score:6]
Of the latter, miR126, miR136, miR206, miR451 and miR551b showed significant, gradual down-regulation (>2 times) after birth or during development (ED16>4W>4W). [score:5]
Relative expression of miRNAs let7b, let7c, miR-29a, miR29c and miR126, which are significantly up- or down-regulated during the progression of lens development, were measured following RNA extraction using RT-PCR. [score:5]
In contrast, miR126 and miR-451 were significantly down-regulated (Fig. 2). [score:4]
Interestingly, RT-PCR assessment of level of miRNAs in cataractous lenses showed that four miRNAs–let7c, miR29a and 29c, and miR-126–were significantly down-regulated, suggesting a plausible contribution by these miRNAs to cataractogenesis (Fig. 3). [score:4]
Relative expression levels of miRNAs, let-7b, let-7c, miR-29a, miR-29c, miR-204, miR-126, miR-451 in ED16, 4W and 14W lenses are represented as histograms with normalized averages ± SD. [score:3]
However, expression of these miRNAs and miR126 was decreased in SCRs with cataract. [score:3]
However, let7c, miR-29a, miR29c and miR126 were significantly down-regulated in SCR with cataract lenses compared with SCR without cataract lenses at both ages 7 and 21 weeks. [score:3]
The seven miRNAs (let7b, 7c, miR29a, miR-29c, miR204, miR126, miR51) listed in Table 3 were used for validation experiments. [score:1]
[1 to 20 of 9 sentences]
28
[+] score: 34
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-203
Our previous study implicated MMSET overexpression in the regulation of MYC through downregulation of a microRNA, miR-126* [43]. [score:7]
Upon treatment with EZH2 inhibitors, MMSET -overexpressing cells increase expression of miR-126* (Figure 4G). [score:7]
Accordingly, we found that EZH2i stimulates expression of miR126*, which can then directly repress c-MYC protein expression (Figures 4G and 4H). [score:6]
In MMSET -overexpressing cells expression of miR-126* levels is decreased through recruitment of transcriptional repressors such as KAP1. [score:5]
In accordance with our previous study, increased miR-126* levels were associated with a dramatic downregulation of MYC (Figure 4H). [score:4]
Our ChIP-seq analysis shows that MMSET overexpression leads to EZH2 and H3K27me3 accumulation upstream of the miR-126* locus (Supplemental Figure S6B). [score:3]
We previously showed that MMSET increased c-MYC levels by repression of miR126* [43]. [score:1]
Here we show that in MMSET high cells, EZH2 and H3K27me3 accumulate at the miR126 locus. [score:1]
[1 to 20 of 8 sentences]
29
[+] score: 32
Confirming the results of the gene profiling, mmu-miR-15b-5p and mmu-miR-223-3p were significantly upregulated during pneumonia, and mmu-miR-34b-5p and mmu-miR-126-3p were significantly downregulated. [score:7]
The consensus DE miRs whose expression is anti-correlated with their DE predicted targets (mmu-miR-125a-5p/mmu-miR-125b-5p, mmu-let-7b-5p/mmu-let-7c-5p/mmu-let-7d-5p/mmu-let-7e-5p/mmu-let-7f-5p, mmu-miR-126-3p, mmu-miR-335-5p and mmu-miR-23b-3p) are designated as candidate key regulatory miRs (miRhubs), which may represent major control points in the network-level neutrophil response to S. pneumoniae. [score:6]
A complementary approach using miRHub analysis 37, 38 identified candidate key regulatory miRs based on conserved target sites in DE mRNAs, of which 10 individual miRs are differentially expressed (mmu-miR-125a-5p/mmu-miR-125b-5p, mmu-let-7a-5p/ mmu-let-7c-5p/mmu-let-7d-5p/mmu-let-7e-5p/mmu-let-7f-5p, mmu-miR-126-3p, mmu-miR-335-5p and mmu-miR-23b-3p; see Fig.   6 and Supplementary Tables  8 and 9). [score:6]
Fourteen individual miRs belonging to six miR families (miR-125a-5p/125b-5p/351/670/4319, let-7, miR-126-3p, miR-205/205ab, miR-335/335-5p and miR-23abc/23b-3p) were downregulated during pneumonia (Supplementary Table  11). [score:4]
Ten individual miRs out of the 14 miRs belonging to five of the six miR families (miR-125a-5p/125b-5p/351/670/4319, let-7, miR-126-3p, miR-335/335-5p and miR-23abc/23b-3p) were consensus DE miRs, i. e., they were significantly downregulated at least 2-fold during S. pneumoniae pneumonia using both LVS and RMA normalization (Fig.   6 and Supplementary Table  11). [score:4]
Mmu-miR-126-3p which is a consensus DE miR predicted to target 8 DE mRNAs is depicted as a gray oblong. [score:3]
Others have been previously identified as prominent regulators of inflammatory pathways, including miR-34 [31],miR-3960 and miR-2861 [48], miR-126 49– 51 and let-7f [52]. [score:2]
[1 to 20 of 7 sentences]
30
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
31
[+] score: 28
Other miRNAs from this paper: mmu-mir-126a, hsa-mir-126
Adrenomedullin expression was highly increased in the cervical cancer stroma, and its increased expression correlated with miR-126 downregulation in the tri-culture system. [score:8]
Zhu N. Zhang D. Xie H. Zhou Z. Chen H. Hu T. Bai Y. Shen Y. Yuan W. Jing Q. Endothelial-specific intron-derived miR-126 is down-regulated in human breast cancer and targets both VEGFA and PIK3R2Mol. [score:6]
Interestingly, miR-126 was previously identified as a miRNA downregulated in HPV16 -positive cervical epithelial cells compared to normal epithelial cells [78], perhaps suggesting that this miRNA is specifically targeted by HPVs. [score:5]
The pro-angiogenic gene for adrenomedullin (ADM) and several other pro-angiogenic genes are targets of miR-126 [79]. [score:3]
More recently, an intriguing mechanism was reported in which HPV16 -positive CaSki cells were found to reduce expression of a micro -RNA (miRNA), miR-126, in endothelial cells [77]. [score:3]
The reduction of miR-126 in endothelial cells required the presence of both epithelial cells and fibroblasts in the tri-culture, suggesting that a complex network of paracrine interactions is involved in miR-126 regulation. [score:2]
Increased microvasculature density and tube formation was observed in xenografts composed of CaSki cells and CAFs, and this effect was associated with a decrease in miR-126 in host-derived endothelial cells recruited to the tumor. [score:1]
[1 to 20 of 7 sentences]
32
[+] score: 27
Since folic acid regulated ADAM9 significantly in the present study, and ADAM9 has been demonstrated functioning as a direct target of miR-126 [37], we determined miR-126-3p expression by real-time PCR and found miR-126-3p was repressed by folic acid treatment. [score:7]
In our study, miR-126-3p was up-regulated in the deficiency group and was down-regulated in both the 120 μg/kg and 600 μg/kg groups compared to the control group (F[3,20] = 84.41, p < 0.05; Figure 5A). [score:6]
miR-126-3p has already been identified as a miRNA which targets ADAM9 and can be regulated by DNA methyltransferases (DNMTs). [score:4]
Wang C. Z. Yuan P. Li Y. MiR-126 regulated breast cancer cell invasion by targeting ADAM9 Int. [score:3]
For examples, ADAM9 is the target of miR-126 [9, 10]. [score:3]
However, miR-339-5p expression showed a reverse trend compared to miR-126-3p. [score:2]
Andersen M. Trapani D. Ravn J. Sørensen J. B. Andersen C. B. Grauslund M. Santoni-Rugiu E. Methylation -associated Silencing of microRNA-126 and its Host Gene EGFL7 in Malignant Pleural Mesothelioma Anticancer Res. [score:1]
Epigenetic modulation of the miR-126-3p has been recently demonstrated [9, 37]. [score:1]
[1 to 20 of 8 sentences]
33
[+] score: 25
PJ up-regulates genes involved in cell adhesion such as E-cadherin, intercellular adhesion molecule 1 (ICAM1) and myristoylated alanine-rich protein kinase C (MARCKS) and down-regulates genes involved in cell migration such as type I collagen, tenascin C and chimerin 1. In addition, anti-invasive microRNAs such as miR-335 (predicted targets include COL1A1, TNC, SOX4), miR-205 (predicted targets include CHN1, PRKCE), miR-200 (predicted targets include ZEB1, ZEB2), and miR-126 (predicted targets include SLC45A3), are up-regulated, whereas pro-invasive microRNA such as miR-21 (predicted targets include MARCKS, PDCD4, TPM1) and miR-373 (predicted targets include CD44), are down-regulated. [score:25]
[1 to 20 of 1 sentences]
34
[+] score: 24
Overexpression of miR-126 in primary CD4 [+] T cells from SLE patients contributed to T cell autoreactivity by targeting DNMT1, while inhibition in SLE patients resulted in T and B cell inactivation. [score:7]
Overexpression of miR-126 in primary CD4 [+] T cells from healthy donors resulted in the demethylation and upregulation of autoimmunity -associated genes including CD11a and CD70, inducing T cell and B cell hyperactivity. [score:6]
miR-126, miR-142-3p, and miR-142-5p are predicted to target genes associated with SLE, which implicates their aberrant expression in CD4 [+] T cells in LN pathogenesis. [score:5]
Another posttranscriptional modifier of DNMT1, miR-126, was found to be overexpressed in CD4 [+] T cells from SLE patients [72]. [score:3]
These results demonstrate that overexpression of miR-126 can aberrantly induce splenocyte activity towards that of an autoimmune phenotype [72]. [score:3]
[1 to 20 of 5 sentences]
35
[+] score: 23
Antagonism of microRNA-126 suppresses the effector function of TH2 cells and the development of allergic airways disease. [score:6]
Altered expression of microRNA in the airway wall in chronic asthma: miR-126 as a potential therapeutic target. [score:5]
Localised inhibition of miR-126 in the lung with an antagomir (antisense miRNA inhibitor) significantly reduced hallmark features of AAD [16]. [score:5]
Our group identified upregulation of miR-126 in a house dust mite (HDM) -induced AAD mo del [16, 20]. [score:4]
In mouse mo dels of AAD, important functions for let-7, miR-21, miR-126, miR-145 and miR-155 have been demonstrated in disease pathogenesis [12– 19]. [score:3]
[1 to 20 of 5 sentences]
36
[+] score: 20
In this study we have used an siRNA knock-down approach, enabling us to target regions of the Egfl7 gene other than intron 7. This has allowed us to specifically investigate the role of Egfl7 during vascular development, without affecting miR-126 expression. [score:5]
The three siRNA target sequences are shown as red bars, and the location of the microRNA miR-126 is shown within intron 7. (LTR, long terminal repeat; Flap, DNA flap; H1, human H1 RNA pol III promoter; UbiC, human ubiquitin c promoter; eGFP, enhanced green fluorescent protein; WRE, woodchuck response element). [score:3]
Thus, using an siRNA knock-down approach which did not affect miR-126 levels, we show here for the first time that Egfl7 has a role during endothelial cell differentiation and vascular development in mammalian cells. [score:3]
Importantly, quantitative PCR showed that Egfl7 knock-down did not affect levels of the microRNAs miR-126-3p (3 prime end) or miR-126-5p (5 prime end) (Figure 1d), which are generated as a stem loop encoded by intron 7 within the Egfl7 gene (Figure 1a). [score:2]
In contrast, Kuhnert et al [7] found no phenotype in Egfl7 knockout mice, and instead proposed that the observed vascular defects could be attributed to deletion of miR-126, an endothelial microRNA located within intron 7 of Egfl7. [score:2]
We were therefore able to study the specific effect of Egfl7 knock-down, without any possible effects on altered miR-126 levels. [score:2]
Recent work by Kuhnert et al [7] suggests that Egfl7 -null mice are phenotypically normal, and that deletion of miR-126 causes embryonic lethality, edema, and hemorrhage, and postnatal defects in retinal and cranial angiogenesis. [score:1]
Real-time PCR analysis of Egfl7 and miR-126 levels. [score:1]
Real-time PCR analysis of Egfl7 and miR-126 levelsFor real-time PCR analysis, total RNA was isolated from ESCs using the RNAqueous-Micro Kit (Ambion) as per manufacturer's instructions. [score:1]
[1 to 20 of 9 sentences]
37
[+] score: 20
Although it is not the focus of this review, microRNAs have also been identified that directly target key leukocyte adhesion molecules in activated ECs [e. g., miR-126 targets VCAM1 (Harris et al., 2008), miR-31 targets SELE and miR-17-3p targets ICAM1 (Suarez et al., 2010)]. [score:10]
MicroRNA-126 regulates endothelial expression of vascular cell adhesion molecule 1. Proc. [score:3]
Regulation of vascular smooth muscle cell turnover by endothelial cell-secreted microRNA-126: role of shear stress. [score:2]
This atheroprotective effect is lost when mice are treated with endothelial ABs isolated from miR-126 [-/-] mice (Zernecke et al., 2009), suggesting that this effect is mediated by the delivery of miR-126 to vascular cells. [score:1]
The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis. [score:1]
In another study, Zernecke et al. (2009) demonstrated that endothelial derived-ABs increase the production of an anti-apoptotic survival factor, the chemokine CXCL12, via the transfer of miR-126 to ECs. [score:1]
Systemic injection of miR-126-enriched ABs reduces atherosclerotic plaque size in mouse mo dels of atherosclerosis. [score:1]
Delivery of microRNA-126 by apoptotic bodies induces CXCL12 -dependent vascular protection. [score:1]
[1 to 20 of 8 sentences]
38
[+] score: 20
To our surprise, miR-15a and miR-126, two candidates miRNAs for targeting c-Myb 3′ UTR in differentiating cells, are also downregulated in a more metastatic alveolar form (ARMS) of rhabdomyosarcoma, tumors with myogenic features [25]. [score:6]
In [24] there is described that some quoted miRNAs were continuously upregulated during differentiation of C2C12 cells from D24 to D72 compared to GM values: miR-15a (from 0.92 times to 2.7 times), miR-126 (from 1.95 times to 2.75 times) and miR-200b (from 1.75 times to 2.73 times), these miRNAs could therefore play a role in extinguishing c-Myb expression. [score:5]
c-Myb activity is tightly regulated at different levels, including downregulation by several miRNAs: miR-150 [8], miR-15a [9], miR-34a [10], miR-126 [11], miR-200b, miR-200c and miR-429 [12] binding to its 3′ UTR. [score:5]
We therefore searched in the literature if some of miRNAs that have already been described to downregulate c-Myb via interacting with 3′ UTR, (miR-150, miR-15a, miR-34a, miR-126, miR-200b, miR-200c and miR-429), were activated during muscle differentiation. [score:4]
[1 to 20 of 4 sentences]
39
[+] score: 18
Of these 15 miRNAs, we selected six miRNAs, miR-451, miR-126, miR-145, miR-146b-5p, miR-491-5p, and miR-107, which were previously reported to have a tumor suppressor role because our previous studies revealed that some tumor suppressor miRNAs in plasma were significantly down-regulated in cancer patients compared with healthy volunteers 30, 32, 33, and the down-regulation of tumor suppressor miRNAs in the blood stream might be related to tumor progression and poor prognostic outcomes [32]. [score:12]
We selected six down-regulated tumor suppressor miRNAs (miR-451, miR-126, miR-145, miR-146b-5p, miR-491-5p, and miR-107) in plasma through a comprehensive miRNA array -based approach. [score:6]
[1 to 20 of 2 sentences]
40
[+] score: 17
miR-126 inhibits PI3K p85β, responsible for AKT upregulation, and in so doing, augments Foxp3 and iTreg differentiation. [score:6]
Conversely, miRNA-126 silencing reduced iTreg generation and Foxp3 expression via enhanced p85β, pAKT, and mTOR, consistent with a critical effect of PI3K/Akt pathway on Treg Foxp3 expression (33, 34). [score:5]
Together, these data identify miRNA agonist targets (miR-99a, miR-150, iR-15b-16, miR-100, miR-126, and miR-155) that can be exploited to increase iTreg generation. [score:3]
mTor and the PI3K–AKT pathways were identified as miR-126 targets in both mouse and human Treg (32). [score:3]
[1 to 20 of 4 sentences]
41
[+] score: 16
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-466c-3
For example, miR-127 has been shown to participate in cancer development [85], miR-145 has been shown to control c-Myc expression through p53 [86], miR-199a regulates MET protooncogene and affects NF-KB expression [54], miR-379 affects brain neuronal development [87], [88], miR-451 affects erythroid differentiation [89], miR-126 affects angiogenic signaling and controls blood vessel development [90], miR-143 regulates ERK5 signaling and targets KRAS gene [91], miR-298 regulates CYPA3 expression [92] and miR-486 regulates kinase activity and tumor progression [93]. [score:16]
[1 to 20 of 1 sentences]
42
[+] score: 15
Other miRNAs from this paper: mmu-mir-126a, hsa-mir-126
Functional enrichment analyses using GO biological terms suggested a role for miRNA-126-3p and-5p in the regulation of genes associated with lymphocyte differentiation, positive regulation of cell adhesion, and regulation of cell motility, including for the negative regulator of cell motility plexin-B2 (33). [score:5]
Furthermore, consistent with current findings, miR-126 has previously been shown to have roles in the mobilization of hematopoietic progenitor cells by reducing the expression of VCAM-1 (55). [score:3]
EC -associated miRNA-126-3p and miRNA-126-5p (31, 32) were highly regulated in EVs following AMI (Table 2). [score:2]
After myocardial infarction, miRNA-126 may have additional roles in the regulation of vascular integrity and neovascularization (31). [score:2]
EC -associated precursor miRNA-126 gives rise to the mature miR-126-5p and miR-126-3p, which are among the most abundant miRNA in ECs (53, 54), adding weight to the interpretation that the surge in EVs in AMI is derived from ECs. [score:1]
The principal findings of this study were that (a) total EV number increases after AMI in mice and in humans, where the increase was proportional to the extent of ischemic injury; (b) the increase in plasma EVs is largely accounted for by EC-EVs that bear VCAM-1 and which are enriched for several miRNA, including the EC -associated miR-126-3p and miR-126-5p; and (c) injected EVs localize to the spleen and mobilize splenic monocytes. [score:1]
Genetic depletion of miRNA-126-5p promotes EC proliferation and limits atherosclerosis in apolipoprotein E–deficient mice (54). [score:1]
[1 to 20 of 7 sentences]
43
[+] score: 15
Moreover, the expression of miR-126 was not affected either. [score:3]
First, the expression of miR-346, as well as miR-146a and miR-126, was monitored in U937-derived macrophages infected with L. (L. ) infantum MHOM/TN/80/IPT1 as described in methods. [score:3]
strainsFirst, the expression of miR-346, as well as miR-146a and miR-126, was monitored in U937-derived macrophages infected with L. (L. ) infantum MHOM/TN/80/IPT1 as described in methods. [score:3]
MiR-146a has been shown to be dysregulated in L. (L. ) major infection (Lemaire et al., 2013; Geraci et al., 2015), while miR-126 (mainly involved in angiogenesis and in the modulation of dendritic cell function) (Ferretti and La Cava, 2014) was not expected to have a role in macrophages infected with Leishmania. [score:2]
It is also noteworthy that miR-346 was poorly expressed (C [t] > 32) in monocytic cell lines compared to miR-146a and miR-126. [score:2]
miR-126, a new modulator of innate immunity. [score:1]
The cDNA synthesis for three microRNAs (miR-126, miR-146a, and miR-346) was performed by TaqMan [TM] MicroRNA Reverse Transcription Kit (Applied Biosystems) using 12.5 ng of total RNA. [score:1]
[1 to 20 of 7 sentences]
44
[+] score: 14
Based on this observation, we combined the analysis from the TF gene coexpression network of TF genes and miRNAs and hypothesized that the functions related to cardiac hypertrophy were induced by the up-regulated TF genes in Module 1 at days 3 and 5 but suppressed by some miRNAs after day 7. Runt related transcription factor 1 (Runx1), for example, in Module 1 is a key regulator of heart post-myocardial infarction [24] and was up-regulated from day 3 to day 14 and likely suppressed by some known cardiac miRNAs, such as miR-126–5p, miR-195, miR-208b, and miR-21 at day 28 (Suppl. [score:14]
[1 to 20 of 1 sentences]
45
[+] score: 13
Specifically, we chose to look into the expression of miR126, 132 and 210, which promote angiogenesis by targeting negative regulators in angiogenic pathways. [score:6]
After 6, 24 and 72 hours of angiogenic induction, miR126 and 132 did not significantly change the expression level, as the anti-angiogenic miR221 and 222 were detectable in a quite stable trend. [score:3]
In particular, miR126, 132 and 210 are key positive regulators of angiogenesis and endothelial cell survival, whereas miR221 and 222 prevent endothelial cell migration [29]. [score:2]
miR126, 132, 221 and 222 were detectable in AFS cells at the basal state, whereas miR210, which was absent before angiogenic induction (Fig.   4e), was present already after 6 hours of endothelial differentiation and decreased 72 hours after endothelial stimulation in all the analyzed conditions. [score:1]
Endothelial cell-specific miR126 plays an essential role in neoangiogenesis following ischemia [35] and was detected in AFS cells before endothelial induction and maintained during differentiation. [score:1]
[1 to 20 of 5 sentences]
46
[+] score: 13
Of the multiple miRNAs which had terminal uridines that required Zcchc11 in our deep sequencing datasets and were predicted to target the 3′ UTR of IGF-1 (Figure 3B), we examined the ability of 4 (miR-126-5p, miR-194-2-3p, miR-379 and Let-7d) to suppress IGF-1 expression. [score:7]
control by one-way ANOVA, N = 4. (E) Unlike terminal uridylation, mutation of two bases in the seed sequence of miR-126-5p completely reversed silencing of the IGF-1 3′-UTR. [score:2]
The uridylation of miR-126-5p or miR-379 significantly diminished IGF-1 silencing by these miRNAs, while uridylation of miR-194-2-3p had no effect (Figure 5B). [score:1]
MiR-126-5p, miR-194-2-3p, and miR-379, but not Let-7d, significantly silenced the IGF-1 reporter (Figure 5A). [score:1]
Interestingly, varying the length of the terminal uridine tail, to reflect the different forms observed for each of these miRNAs in our deep sequencing datasets, had minimal impact for both miR-126-5p and miR-379 (Figure 5C–5D), demonstrating that even a single uridine is sufficient to mitigate silencing by these miRNAs. [score:1]
mature by two-way ANOVA by student's t-test, N = 4. (C–D) miR-126-5p or miR-379 mimetics bearing 0, 1, 2, or 4 terminal uridines show a maximal effect on miRNA silencing by a single uridine addition. [score:1]
[1 to 20 of 6 sentences]
47
[+] score: 13
MiR-126 has also been found to be upregulated in the airway of an asthma mouse mo del, and its suppression reduces inflammation, expression of Th2 cytokines (e. g., IL-5 and IL-13), and airway hyperreactivity [29]. [score:7]
Antagonism of microRNA-126 suppresses the effector function of TH2 cells and the development of allergic airways disease. [score:6]
[1 to 20 of 2 sentences]
48
[+] score: 12
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-145a, hsa-mir-145, hsa-mir-126, mmu-mir-145b
At the post-transcriptional level, two microRNAs, miR-126 and miR-145, have been identified that target and suppress protein expression [120- 122]. [score:7]
Both miR-126 and miR-145 inhibit cell growth and their expression is frequently decreased in many cancer types [120, 121, 123, 124]. [score:5]
[1 to 20 of 2 sentences]
49
[+] score: 12
In addition to miR-320a, we found a group miRNAs which are differentially expressed in CAD patients, among which miRNAs, miR-21, miR-30a, miR-126, and miR-133a were reported to be up-regulated and miR-208a and miR-320a to be downregulated in infarcted myocardium 35, 36. [score:9]
Seven miRNAs (miR-21, miR-30a, miR-126, miR-133a, miR-195, miR-208a and miR-320a) were confirmed to be differentially expressed between CAD and control samples (Fig. 1B). [score:3]
[1 to 20 of 2 sentences]
50
[+] score: 12
This confirmed differential abundance of 13/28 of these miRNAs; 11 were up-regulated (mmu-miR-126-3p, 135b-3p, 143-3p, 133b-3p, 136-5p, 126-5p, 141-5p, 145a-5p, 337-3p, 30a-5p, and 376a-3p) and 2 were down-regulated (mmu-miR-184-3p, and 1961) (Fig 1, S2 Table). [score:7]
Specifically microRNA-126-3p (increased in sperm from HFD fathers) binds the 3′-untranslated region of DNMT1 mRNA, reducing its expression and leading to hypomethylation [59]. [score:5]
[1 to 20 of 2 sentences]
51
[+] score: 12
The increase observed in CCNE1 and CD31 proteins is likely due to a post-transcriptional mechanism upon reduction in their targeting miRNAs, including miR-103a (targets CCNE1; [44]) and miR-126 (targets CD31; [56]), both of which decreased in shDICER relative to shControl GSCs. [score:7]
Similar to our in vitro data, no change was detected in the level of CCNE1 and CD31 mRNAs, suggesting that increased expression of these genes at the protein level may be due to reduced level of specific miRNAs that target their 3′ UTR, such as miR-103a for CCNE1 and miR-126 for CD31 [56]. [score:5]
[1 to 20 of 2 sentences]
52
[+] score: 12
miRNAs can act as tumor suppressors (e. g. miR-15a and miR-16-1 [4]), oncogenes (e. g. miR-155 [5], [6] and miR-21 [7], [8], [9], [10]) and as promoters (e. g. miR-10b, miR-182 and miR-29a [11], [12], [13]) or suppressors (e. g. miR-335 and miR-126 [14]) of metastasis. [score:5]
On the other hand, miR-335 and miR-126 inhibited metastatic development [14]. [score:4]
In our study, some of these miRNAs (miR-10b, miR-373, miR-520c and miR-29a) were not probed in our microarrays and others (miR-21, miR-126 and miR-335) showed no significant differences in expression amongst the 4 isogenic cell lines. [score:3]
[1 to 20 of 3 sentences]
53
[+] score: 12
Specifically, miR-155 has demonstrated a critical role in the development of antibody responses and germinal center function [27], miR-326 has been shown to regulate Th17 differentiation, exhibiting critical involvement in multiple sclerosis pathogenesis [28], and in vivo miR-126 inhibition reduces a house dust mite -induced asthmatic phenotype, demonstrating the importance of this miRNA in the regulation of Th2 responses and allergic asthma [24]. [score:6]
Mattes J. Collison A. Plank M. Phipps S. Foster P. S. Antagonism of microRNA-126 suppresses the effector function of Th2 cells and the development of allergic airways disease Proc. [score:6]
[1 to 20 of 2 sentences]
54
[+] score: 11
We found that the expression of miR-126, known to be involved in the regulation of angiogenesis and specifically expressed in endothelial cells [29], as well as the expression of miR-33, regulator of cholesterol efflux in macrophages [30], was not significantly altered in wound tissue when compared with healthy skin (Fig. 1A, miR-126, P < 0.12 miR-33, P < 0.20). [score:8]
The trend towards an increased expression of miR-126 and miR-33 could be a consequence of an angiogenic process taking place in the wounds or to an increased macrophage infiltrate, respectively. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 11
Other miRNAs from this paper: mmu-mir-126a
A briefly described analysis showed that miR-126 expression is dependent on the presence of two regions containing ETS binding sites, one of which responds to the over -expression of Ets-1 [64]. [score:5]
It was recently observed that the microRNA miR-126 located in the seventh intron of the VE-statin/egfl7 gene is specifically expressed in endothelial cells [64]. [score:3]
However, since tissue-specific co-regulation of a microRNA and of its host gene are not strictly linked [65], whether the expression of VE-statin/egfl7 and that of miR-126 are regulated by similar mechanisms in endothelial cells remains to be investigated. [score:3]
[1 to 20 of 3 sentences]
56
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
Out of the 26 miRNA/host gene pairs with coordinated expression, 11 have been found to be coordinately expressed in both, human and mouse [19], [27], [59], [61]– [64], [67]– [69], [71], [73]– [79]: mir-103/ PANK3, mir-107/ PANK1, mir-126/ EGFL7, mir-128-1/ R3HDM1, mir-140/ WWP2, mir-211/ TRPM1, mir-218-1/ SLIT2, mir-218-2/ SLIT3, mir-27b/ C9orf3, mir-33/ SREBF2, and mir-499/ MYH7B. [score:5]
Previous studies revealed that five miRNA genes as well as their host genes (hsa-mir-10a/ HOXB4, hsa-mir-126/ EGFL7, hsa-mir-152/ COPZ2, hsa-mir-191/ DALRD3, and hsa-mir-342/ EVL) were found to be epigenetically downregulated, either by histone modification and/or CpG island hypermethylation in the promoter region in cancer cells [27], [86]– [89] (Table 2 ). [score:4]
Significantly for this discussion, inadvertent deletion of mmu-mir-126 has led to the misattribution of phenotype - angiogenesis defects previously reported in a knockout of the Egfl7 locus were subsequently shown to have arisen due to deletion of the mmu-mir-126 [99]. [score:2]
[1 to 20 of 3 sentences]
57
[+] score: 11
The miRNA expression profile in ECs exposed to disturbed blood flow at arterial bifurcations differs substantially from that in ECs at unbranched arterial segments 42 and is characterized by downregulation of atheroprotective (such as miR-126-5p) 52 and upregulation of pro-atherogenic miRNAs (such as miR-92a) 41. [score:7]
In human aortic ECs (HAECs), silencing of Dicer using GapmeRs diminished the expression levels of miR-103, -301b, -652 and -433, but not that of miR-126-3p, after 24 h (Fig. 1f and Supplementary Fig. 3). [score:3]
After silencing of Dicer in ECs, let-7 family miRNAs, miR-103, miR-221 and miR-27b have a higher turnover rate than miR-126-3p, miR-21, miR-23a and miR-26a 39. [score:1]
[1 to 20 of 3 sentences]
58
[+] score: 11
The quantity of target genes predicted for each differentially expressed miRNA varied from 2 (miR-126-3p) to 477 (miR-328a*), with an average of 138 for up-regulated miRNAs and 34 for down-regulated miRNAs (Figure 3A,B). [score:11]
[1 to 20 of 1 sentences]
59
[+] score: 10
For example, evolutionarily conserved sequences such as miR-451 and miR-150 are highly expressed in bone marrow [15], regulating hematopoiesis, and miR-126 and let-7 family members show high expression in lung [16, 17]. [score:6]
2013; 8. 16 Jusufović E, Rijavec M, Keser D, Korošec P, Sodja E, Iljazović E, et al Let-7b and miR-126 Are Down-Regulated in Tumor Tissue and Correlate with Microvessel Density and Survival Outcomes in Non-Small-Cell Lung Cancer. [score:4]
[1 to 20 of 2 sentences]
60
[+] score: 10
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-150, mmu-mir-206, mmu-mir-192, mmu-mir-19a
In addition, Feng et al. [13] reported that miR-126 overexpression enhanced UC inflammatory activity by downregulating the expression of Iκ-Bα, a key inhibitor of the NF-κB signalling pathways. [score:10]
[1 to 20 of 1 sentences]
61
[+] score: 10
In contrast, another seven miRNAs (miR-126-3p, miR-23b, miR-27a, miR-29a, miR-29c, miR-451, and miR-690) were significantly up-regulated in the liver but down-regulated in the brain. [score:7]
Fifteen miRNAs were highly expressed in both liver and brain: miR-709, let-7a, let-7f, let-7c, let-7d, miR-26a, let-7b, let-7g, miR-26b, miR-29a, miR-126-3p, miR-23b, miR-30c, miR-16, and miR-23a. [score:3]
[1 to 20 of 2 sentences]
62
[+] score: 10
A previous study found that miR-18a, miR-126, let-7e, miR-155, and miR-224 were down-regulated while miR-498, miR-187, miR-874, miR-143, and miR-886-3p were up-regulated in asthmatic patients compared to controls [27]. [score:6]
MiR-126 has been shown to positively regulate mast cell proliferation by targeting the negative regulator of mast cell proliferation Spred1 [13]. [score:4]
[1 to 20 of 2 sentences]
63
[+] score: 10
miR-126 decreases the expression of G-protein signaling 16 (RGS16) in ECs, thereby up -regulating the chemokine (C-X-C motif) ligand 12 (CXCL12) receptor. [score:4]
One of the most intriguing miRs as regards vascular inflammation is miR-126, an EC-enriched miR, which negatively regulates VCAM-1 expression [90, 91]. [score:4]
Apoptotic bodies are released from ECs during atherosclerotic progression, and have been shown to contain miR-126. [score:1]
6.1. miR-126. [score:1]
[1 to 20 of 4 sentences]
64
[+] score: 9
In accordance with the results of peripheral blood T cells in Hosokawa's study [15], miR126 was observed to be down-regulated in our microarray analysis, however, its expression was at great variance and the difference between the 41 AA patients and 20 healthy controls was not significant, as analyzed by RT-PCR. [score:6]
Hosokawa et al. reported that expression of four miRNAs (miR126-3p, miR145-5p, miR199a-5p, and miR223-3p) were decreased in peripheral blood T cells of AA patients [15]. [score:3]
[1 to 20 of 2 sentences]
65
[+] score: 9
MiR-126 upregulates the expression levels of the gene POU domain class 2 associating factor 1. This gives rise to high expression levels of the transcription factor PU. [score:7]
Among them, only miR-21 (21), miR-126 (23) and miR-155 (34– 37) were demonstrated to play a regulatory role in balancing the Thl/Th2 immune response. [score:2]
[1 to 20 of 2 sentences]
66
[+] score: 9
While the role of miRs (miR-214, miR-126) is known to contribute to endothelial diseases [36], the multifactorial etiology of hemophilic arthropathy is likely to involve other miRs) that further regulate the target molecules involved in arthropathy (VEGF-α, HIF-2α and MMP 3 and MMP 9). [score:6]
Heishima K. Mori T. Ichikawa Y. Sakai H. Kuranaga Y. Nakagawa T. Tanaka Y. Okamura Y. Masuzawa M. Sugito N. MicroRNA-214 and microRNA-126 are potential biomarkers for malignant endothelial proliferative diseases Int. [score:3]
[1 to 20 of 2 sentences]
67
[+] score: 9
To further determine whether our finding as described above can be translated into a clinical application, three upregulated (miR-193a, miR-126 and miR-148a) and one downregulated miRNA (miR-196b) found in the exosomes isolated from metastatic liver in a mouse colon cancer were analysed in samples from colon cancer patients by qPCR. [score:9]
[1 to 20 of 1 sentences]
68
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
The observation that miR-22, miR-26b, miR-126, miR-29c and miR-30c are ubiquitously expressed in 14 different tissues of pig is interesting. [score:3]
Additionally, many other miRNAs, such as let-7, miR-98, miR-16, miR22, miR-26b, miR-29c, miR-30c and miR126, were also expressed abundantly in thymus (Figure 3). [score:3]
miR-22, miR-26b, miR-29c, miR-30c and miR-126 exhibited almost similar expression patterns in all tissues examined (Figure 3B). [score:3]
[1 to 20 of 3 sentences]
69
[+] score: 8
Further analysis of expression of vascular miRNAs showed that miR-126, miR-143 and miR-145 are not upregulated in the ECs nor released into the endothelial MPs following overexpression of p75 [NTR] (Supplementary Fig. 6C,D). [score:8]
[1 to 20 of 1 sentences]
70
[+] score: 8
Overexpression and knockout of miR-126 both promote leukemogenesis through targeting distinct gene signaling. [score:6]
The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis. [score:1]
The miR-126-VEGFR2 axis controls the innate response to pathogen -associated nucleic acids. [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 8
Using a similar approach, we identified that the most upregulated circulating miRNAs in the mouse cMPs fraction following CS (heat map in Fig. 2B) were miR-142, miR-126, and miR-706 (Supplementary Table 3). [score:4]
Although we did not interrogate the role of this miR signature in the inhibition of macrophage efferocytosis by, it is conceivable that miRNAs could modulate this function, given the known roles of let-7d in reducing cell motility 40 41, and that of mir-126 in the cytokine secretion of activated macrophages 42. [score:3]
For example, let-7d induces cellular apoptosis 43; mir-126 modulates the repair of damaged endothelium 44; and circulating mir-191 is increased in smokers 26 and individuals with pulmonary hypertension 45. [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 8
For example, the expression levels of miRNA-181a, miR-155, miR-150, miRNA-221, miR-106a, miRNA-221, miR-146a and miR-146b were increased in OVA -induced mouse mo del of asthma [15– 18]; the miR-126, miR-145 and miR-106a expression levels were increased in house dust mite (HDM) -induced experimental asthma mo del [19– 21]; and miR-21 was up-regulated in lung-specific interleukin (IL)-13 -induced asthma mo del [22]. [score:8]
[1 to 20 of 1 sentences]
73
[+] score: 7
Other miRNAs from this paper: mmu-mir-125a, mmu-mir-126a, mmu-mir-362
Interestingly, specific Akt2-repressed LPS -induced miRNAs, miR-126-5p and miR-362-5p, are predicted to target and suppress Ccr2 in mice, and this could contribute to the observed loss in CCR2 expression in Akt2 -deficient macrophages. [score:7]
[1 to 20 of 1 sentences]
74
[+] score: 7
A previous report by Watanabe K et al. demonstrates that miR-126 expression may be regulated by the methylation status of an upstream CpG island, located within an intron of its host gene EGFL7 [18]. [score:4]
The promoter of the genes encoding seven of them (miR-29a-3p, miR-34a, miR-126, miR-141, miR-181c-5p, miR-202 and miR-517a-3p) contained CpG islands, whose methylation significantly decreased after treatment with 5′-AZA (see later). [score:1]
We focused our analysis on 12 miRNAs (miR-22, miR-29a-3p, miR-34a, miR-126, miR-140-3p, miR-141, miR-181c-5p, miR-202, miR-455-5p, miR-508-3p, miR-517a-3p and miR-576-3p). [score:1]
Apart from intronic miR-126, all other miRNAs are intergenic. [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 7
In particular, miR-126 has been reported to be up-regulated by flow in a KLF2 -dependent manner in zebrafish embryos [20]. [score:4]
Additionally, KLF2 also mediates the expression of miR-126 in endothelial and glioma cells [20, 29]. [score:3]
[1 to 20 of 2 sentences]
76
[+] score: 7
Figure 6 shows that miR-126 is 5 fold and 2 fold upregulated in WT and MAL KO macrophages respectively. [score:4]
Figure 6 miR126 is induced following LPS stimulation. [score:1]
Cells were differentiated for 10 days and stimulated with 100 ng/ml LPS for 2 h. RNA was extracted and miR126 levels were tested by quantitative. [score:1]
From this table miR-155 and miR-126 were selected for experimental confirmation of their induction by LPS using quantitative. [score:1]
[1 to 20 of 4 sentences]
77
[+] score: 7
Increased miR-21, miR-148a, and miR-126 in lupus CD4 [+] T cells reduced the expression of DNMT1 directly or indirectly, leading to DNA hypomethylation and overexpression of autoimmune -associated methylation-sensitive genes such as CD70, lymphocyte function -associated antigen 1 (LFA-1), and CD11a [24– 26]. [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
Other miRNAs from this paper: mmu-mir-126a, hsa-mir-223, hsa-mir-126, mmu-mir-223
In these mice, Tie2 expression can be conditionally silenced specifically in mature hematopoietic cells by suppressing expression of the rtTA in HS/PCs through endogenous miR-126 activity. [score:7]
[1 to 20 of 1 sentences]
79
[+] score: 7
Other miRNAs from this paper: mmu-mir-126a, hsa-mir-126
Moreover, miR-126 was described as an inhibitor of osteosarcoma proliferation, migration and invasion by suppressing SOX2 expression[27]. [score:7]
[1 to 20 of 1 sentences]
80
[+] score: 7
74, 75, 76 The tumour suppressive miR-708 and miR-126 on the other hand are upregulated during reprogramming in p53 wt cells and reduced in p53R172H cells. [score:6]
A high number of the detected miRNAs are known to play a role in stemness and differentiation, that is, let7 family, miR-125b, miR-126, miR-136, miR-143, miR-145, miR-152, suggesting that we indeed identified miRNAs that are important in reprogramming using our experimental set up. [score:1]
[1 to 20 of 2 sentences]
81
[+] score: 7
For example, up-regulation of miR-127/125b/154/323/368/370/381 is associated with leukemia cells with t(15;17), and up-regulation of miR-126* is associated with those with t(8;21). [score:7]
[1 to 20 of 1 sentences]
82
[+] score: 7
Three miRNAs (miR-126-3p, miR-221 and miR-200c) were exclusively up-regulated in thymocytes of DBA-1/J strain, and three others (miR-let-7e, miR-100 and miR-19a*) were exclusively up-regulated in the DBA-2/J strain. [score:7]
[1 to 20 of 1 sentences]
83
[+] score: 7
The most significantly downregulated miRNAs were miR-181b and miR-126-3p (KO/WT ratio 0.4 and 0.46 respectively) while most upregulated miRNAs included miR-762 and miR-3960 (KO/WT ratio 4.43 and 4.2 respectively). [score:7]
[1 to 20 of 1 sentences]
84
[+] score: 7
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-142a, mmu-mir-142b
Interestingly, using a CD11b myeloid cell-specific promoter and a target sequence for miR-126, which is highly expressed in endothelial and pDCs, resulted in the prevention of inhibitory antibodies to FVIII. [score:7]
[1 to 20 of 1 sentences]
85
[+] score: 7
While miRNA155 is not involved in T cell suppression after alcohol and burn injury, additional studies should be carried out to explore the role of other miRNAs (e. g. miRNA126, miRNA181a and miRNA182), implicated in T cell development and differentiation, in suppressed T cell IFN-γ after alcohol and burn injury. [score:6]
Several miRNAs (e. g. miR126, miR155, mir181a, miR182 etc. ) [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 7
The clinical relevance of high glucose conditions on miR expression has already been demonstrated by Zampetaki et al., who found that diabetic patients and apoptotic bodies derived under hyperglycaemic conditions show reduced miR-126 expression compared to healthy controls 35. [score:4]
Another study revealed that apoptotic bodies derived from apoptotic ECs can transfer miR-126 to target cells, inducing CXCL12 -dependent vascular protection in vitro and in vivo 22. [score:3]
[1 to 20 of 2 sentences]
87
[+] score: 7
22, 31, 32 Using a mouse xenograft mo del, miR-126 and miR-126* have been identified as suppressor of sequential recruitment of mesenchymal stem cells and inflammatory monocytes to the tumor stroma to inhibit metastasis of breast cancer by targeting SDF1 α in CACs. [score:7]
[1 to 20 of 1 sentences]
88
[+] score: 6
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-17
On the other hand, miRs-126 and 145 displayed a more restrictive expression pattern, confined to the smooth muscle arteries, glomerular vasculature, and blood vessels (for miR-126). [score:3]
On the other hand, miRs-126 and 145 displayed a more restrictive expression pattern, confined to the smooth muscle arteries, glomerular vasculature, and blood vessels (for miR-126) (Fig. 7C). [score:3]
[1 to 20 of 2 sentences]
89
[+] score: 6
Using the Patrocles database, we found polymorphic miRNA target sites for bta-miR-199b, -miR-199a-5p, and -miR-361 in the IL1B gene and for –miR-126 in the CYP11B1 gene. [score:3]
Interestingly, the expression of -miR-199b, -miR-199a-5p and –miR-126 in the bovine mammary gland has already been experimentally confirmed. [score:3]
[1 to 20 of 2 sentences]
90
[+] score: 6
In addition, the nonmonogamous relationships between SDF-1α and miRNAs, which also include miR-126 and miR-886-3p (as predicted by other bioinformatics algorithms), regulate the expression of SDF-1α [19], [22], further complicating the interplay between these miRNAs and its target gene. [score:6]
[1 to 20 of 1 sentences]
91
[+] score: 6
For instance, miR-150 has been shown to be down-regulated in HSCs isolated from rat fibrotic livers 12, while expression of miR-126 and miR-126* were reduced during in vitro and in vivo activation of rat HSCs 31. [score:6]
[1 to 20 of 1 sentences]
92
[+] score: 6
In this study, five miRNAs (miR-29a, miR-29b, miR-126*, miR-127-3p, miR324-3p) were found upregulated and four (miR-188-5p, miR-25, miR-320a, miR-346) downregulated in both quiescent and active UC compared to healthy controls (Fasseu et al., 2010). [score:6]
[1 to 20 of 1 sentences]
93
[+] score: 6
Esser et al. [33] demonstrated that miR-494 is downregulated in ECs treated with the pro-angiogenic factor BMP4, in opposition to an increase in the pro-angiogenic miR-126. [score:4]
Esser JS Bone morphogenetic protein 4 regulates microRNAs miR-494 and miR-126-5p in control of endothelial cell function in angiogenesisThromb. [score:2]
[1 to 20 of 2 sentences]
94
[+] score: 6
Zhu et al. also reported that miR-126 can affect tumor genesis and growth by targeting PI3KR2 and regulating the VEGF/PI3KR2/Akt pathway in human breast cancer [48]. [score:4]
Zhu et al. found that miR-126 increases the sensitivity of NSCLC cells to anticancer agents through negative regulation of a VEGF/PI3K/Akt/MRP1 pathway [47]. [score:2]
[1 to 20 of 2 sentences]
95
[+] score: 6
Other miRNAs from this paper: mmu-mir-126a, mmu-mir-200b, mmu-mir-200a, mmu-mir-22, mmu-mir-200c
The study of Tomasetti et al. [37] on mesothelioma has discussed that ACLY could be indirectly inhibited by miR-126, which also led to the tumor suppression effect, whereas they tend to focus more on the interrelated impairment of mitochondrial respiration. [score:6]
[1 to 20 of 1 sentences]
96
[+] score: 6
Analysis revealed significantly increased expression of miR-21-5p, miR-100-5p and miR-146-5p, and decreased expression miR-126-5p, in SIVE. [score:5]
Additionally, we also found two other miRNAs to increase at much lower levels of change and significance, miR-100-5p and miR-146-5p, and one miRNA to be decreased, miR-126-5p. [score:1]
[1 to 20 of 2 sentences]
97
[+] score: 6
Both Egfl7 and Mir126 are wi dely expressed in endothelial cells, and their close genomic localisation may facilitate this co -expression [50]. [score:4]
In at least one case, the knockout of the Egfl7 locus, the vascular phenotype and extensive embryonic lethality observed in the mutants has been shown to result from the concomitant disruption of miR-126 rather than inactivation of the Egfl7 gene, by selectively inactivating either miR-126 or Egfl7 [50,51]. [score:2]
[1 to 20 of 2 sentences]
98
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The overexpression of certain oncogenic miRNAs (miR-21, miR-27a, miR-155, miR-9, miR-10b, miR-373/miR-520c, miR-206, miR-18a/b, miR-221/222) and the loss of several tumor suppressor miRNAs (miR-205/200, miR-125a, miR-125b, miR-126, miR-17-5p, miR-145, miR-200c, let-7, miR-20b, miR-34a, miR-31, miR-30) lead to loss of regulation of vital cellular functions that are involved in breast cancer pathogenesis [127, 128]. [score:6]
[1 to 20 of 1 sentences]
99
[+] score: 6
miR-126-5p is an intronic miRNA identified as a tumor suppressor in many tumors [35]. [score:3]
There is very little specific information on the expression and function of miR-126-5p and miR-191 in skeletal muscle, yet these two miRNAs were identified as two of the more abundant miRNAs in our data. [score:3]
[1 to 20 of 2 sentences]
100
[+] score: 6
MiR-126 enhances the action of VEGF and FGF by repressing the expression of Spred-1, an intracellular inhibitor of angiogenic signaling [58]. [score:4]
MiR-126, miR-31, miR-150, and miR-184 are involved in ischemia -induced retinal neovascularization. [score:1]
Among these miRNAs mentioned above, miR-150 and miR-126 are circulating miRNAs present in the plasma, platelets, erythrocytes, and nucleated blood cells of blood [59, 60]. [score:1]
[1 to 20 of 3 sentences]