sort by

18 publications mentioning chi-let-7f

Open access articles that are associated with the species Capra hircus and mention the gene name let-7f. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 29
As shown in Figure 4A and B, the ten most highly expressed miRNAs in the non-pregnant library were all downregulated in the pregnant library, and of the ten most highly expressed miRNAs in the pregnant library, six miRNAs (miR-143, miR-99a, miR-125b, miR-148a, miR-10b, miR-26a) and four miRNAs (let-7a, let-7f, let-7c, let-7b) were down- and upregulated in the non-pregnant library, respectively. [score:11]
In the present study, eight members of the let-7 family (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7 g and let-7i) were expressed at high levels in both libraries, and let-7b was the most highly expressed miRNA in the ovaries of non-pregnant goats (normalized expression level of 246,928). [score:7]
Moreover, eight members of the let-7 family (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7 g and let-7i) were all identified in both libraries as show in Figure 5. These differential expression patterns of highly expressed miRNAs during pregnancy and non-pregnancy suggested that these miRNAs may be closely related to hircine ovarian development and function [17- 20]. [score:6]
Figure 5 Differential expression of the 8 members of let-7 family in the non-pregnant and pregnant goat ovary libraries. [score:3]
Recent research has indicated that specific members of the let-7 family can affect mammalian reproduction, development, cell proliferation and apoptosis [37- 40]. [score:2]
[1 to 20 of 5 sentences]
2
[+] score: 21
The 10 most highly expressed miRNAs (miR-99a, miR-148a, miR-143, miR-10b, miR-26a, miR-21, miR-125b, miR-27b, let-7f, and miR-101) identified in the present study were also highly expressed in the ovaries of goats 18, 20, pigs [22], and other animal species as reviewed by Li et al. [9]. [score:5]
The 10 most abundant miRNAs (miR-99a-5p, miR-148a-3p, miR-143-3p, miR-10b-5p, miR-26a-5p, miR-21-5p, miR-125b-5p, miR-27b-3p, let-7f-5p, and miR-101-3p) were the same in the two libraries, of which miR-21-5p was defined as differentially expressed miRNA with a higher level in the prolific library than in the non-prolific library, but the remaining nine miRNAs did not meet the criteria of differentially expressed miRNA between the breeds (Table  3). [score:5]
The members of the let-7 family play important roles in cell fate determination and are associated with regulating housekeeping genes during ovarian development [47]. [score:3]
Various miRNAs were expressed in GCs (miR-143, miR-125b, let-7 family, miR-21, miR-10b, miR-378, etc. ) [score:3]
Six of these miRNAs (miR-99a, miR-143, miR-10b, miR-26a, miR-125b, and let-7f) are specifically or predominantly expressed in bovine ovaries compared to the somatic tissue pools (e. g. hypothalamus, liver, heart, lung, kidney, etc. ) [score:2]
miR-21, miR-99a, miRNA-143, let-7f, miR-493 and miR-200b may play important roles in follicular development. [score:2]
38– 40, theca cells (mir-24, miR-222 and miR-378) 40, 41, and oocytes (miR-10a, miR-10b, miR-100, let-7 family, etc. ) [score:1]
[1 to 20 of 7 sentences]
3
[+] score: 19
Let-7b can promote angiogenesis in the corpus luteum, but estrogen and progesterone reduced will lead to expression of let-7f reduced in mice, which target gene is Timp1 (Newcomb et al.   2015). [score:5]
The top three highest differentially expressed miRNA in two libraries was let-7f, miR-21 and miR-125a. [score:3]
Let-7f, miR-125a and miR-21 were the top three differentially expressed known miRNAs between the two libraries. [score:3]
The expression of let-7f in the Fols was significantly higher than which in the Luts. [score:3]
The highest expressed known miRNA was let-7f in the two libraries, followed by the miR-21, miR-125a in the follicular and the luteal phase libraries, respectively. [score:3]
In consideration of let-7f, the function of miR-125a is not clear in follicle and corpus luteum, some further experimentation is needed. [score:1]
It was inferred that miR-21, let-7f, miR-125a may be related to Fols-Luts transition in Anhuai goats. [score:1]
[1 to 20 of 7 sentences]
4
[+] score: 11
Roush et al [53] also reported that the let-7 family is highly expressed and conserved across animal species, including mammals, flies, worms and plants. [score:3]
These data show that let-7 miRNAs are some of the most important miRNA regulators of fundamental biological processes. [score:2]
Moreover, seven of these miRNAs, let-7a, let-7b, let-7c, let-7f, miR-21, miR-29a and miR-143, were detected in both goat and sheep. [score:1]
Sequences from the let-7 family accounted for 41.11% of all clean reads in the dry period mammary gland tissue library and 25.44% of all clean reads in the peak lactation tissue library (Table S5). [score:1]
The let-7 family miRNAs were not measured because these miRNAs are well known to be ubiquitously expressed. [score:1]
Eight members of the let-7 gene family, including let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, and let-7i, were sequenced at a high frequency in the mammary gland tissue. [score:1]
The let-7 family was not investigated because these miRNAs are well known to be ubiquitously expressed. [score:1]
In particular, the let-7f was the most abundant miRNA in the two libraries. [score:1]
[1 to 20 of 8 sentences]
5
[+] score: 10
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
[1 to 20 of 2 sentences]
6
[+] score: 8
It has been reported that the sequential stage-specific expression of the let-7 regulates developmental timing in Caenorhahditis elegans [50]. [score:5]
In two libraries, let-7, miR-143, miR-148, miR-378, miR-146 and miR-21 were detected with high abundance (Table S1). [score:1]
However, in late lactation, miR-143, let-7, miR-21, miR-148, miR-30, miR-146, miR-107 and miR-103 were the most abundant, each with more than 100,000 reads. [score:1]
Three other miRNAs, miR-148a-3p, let-7-5p and let-7b were also identified as high-count sequences with more than 1,000,000 reads in both libraries (Table 2 and Tabel S1). [score:1]
[1 to 20 of 4 sentences]
7
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Ye et al. (2012) examined miRNA expression in the duodenum of E. coli F18-sensitive and -resistant weaned piglets and identified 12 candidate miRNA (ssc-miR-143, ssc-let-7f, ssc-miR-30e, ssc-miR-148a, ssc-miR-148b, ssc-miR-181a, ssc-miR-192, ssc-miR-27b, ssc-miR-15b, ssc-miR-21, ssc-miR-215, and ssc-miR-152) disease markers. [score:5]
Additionally, a number of miRNAs including miR-148a, miR-26a, miR-21-5p, miR-27b, miR-143, bta-miR-30a-5p, let-7a-5p, let-7f, miR-10b, and miR-99a-5p are highly expressed in bovine mammary gland/mammary epithelial cells (Li et al., 2012a, 2014a; Jin et al., 2014a; Le Guillou et al., 2014) suggesting roles in the lactation process and mammary gland functions. [score:3]
[1 to 20 of 2 sentences]
8
[+] score: 7
Moreover, many studies have reported that let-7 gene family is highly expressed and conserved across animal species, including mammals, flies, worms and plants [52], [57]– [59]. [score:3]
For instance, miR-1, miR-206, let-7f, let-7a-5p, let-7b, let-7c, let-7g, miR-378 etc, indicating that miRNA was highly conserved between cattle and goat. [score:1]
In the present study, the largest miRNA family size identified was let-7 and miRNA-376, which consisted of 9 and 8 members, respectively. [score:1]
In the present study, let-7 gene family is sequenced at a high frequency in the caprine muscle tissue, these data are similar to those from other studies on miRNAs in different tissues, which indicated that the let-7 family is very important for some fundamental biological processes [58]. [score:1]
For example, mir-9, mir-34, mir-124, mir-29 and let-7 families have been found in 72, 61, 73, 56, 68 species, respectively. [score:1]
[1 to 20 of 5 sentences]
9
[+] score: 5
It inhibits the processing of microRNAs (miRNAs) into mature miRNAs by binding to the terminal loops of miRNA precursors such as let-7 family members [6]. [score:3]
The let-7 family of microRNAs. [score:1]
Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing. [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 5
For miRNA families, each of 6 families (let-7, miR-2284, miR-30, miR-143, miR-10 and miR-378) had more than 100 members, and Alsaweed also reported the members of each family with higher expression abundance [39]. [score:3]
To analyse the conservation of identified miRNAs, small RNA sequences were searched among vertebrate (51 species) using BLAST in miRBase v. 21, four miRNAs (let-7, miR-97, miR-125 and miR-133) were conserved among more than 40 species, 48 miRNAs were conserved among more than 30 species, and 201 miRNAs were conserved among more than 20 species (Supplement Files: Table  S4). [score:1]
The largest family was miR-2284 with 447 members, which was detected in 43 species, followed by let-7, miR-30, miR-143, miR-10 and miR-378; 152 families were the smallest, each containing only one member. [score:1]
[1 to 20 of 3 sentences]
11
[+] score: 5
The 10 most highly expressed miRNAs (let-7b, let-7b-5p, let-7-5p, let-7c, let-7c-5p, let-7f-5p, let-7f, let-7, miR-140, miR-320a) in the multiple library were also the highest expressed in the uniparous library, and there were no significantly different between each other. [score:5]
[1 to 20 of 1 sentences]
12
[+] score: 5
Three members (chi-let-7f-5p, chi-let-7a-5p, and chi-let-7i-5p) of the let-7 family, which is thought to be ubiquitously expressed in a variety of animal tissues, were also highly expressed across the four sampled stages. [score:5]
[1 to 20 of 1 sentences]
13
[+] score: 3
LIN28 and LIN28b are related RNA -binding proteins, they bind to the terminal loops of let-7 miRNA family, inhibiting the processing of let-7 family members into mature miRNA [18]. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 3
Interestingly, let-7i-5p, let-7f-5p, and miR-21-5p are highly expressed in the porcine ovary and testis, suggesting that they are associated with secretory function (Li et al., 2011). [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 3
For example, in the hypothalamus Lin28/let-7 expression patterns are associated with the onset of puberty [11]. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
PPRV infection in spleen and lung triggered the expression of many immune-related miRNAs, including, miR-21, miR-150, miR-146b, and let-7 family as reported in Japanese encephalitis virus infection (Cai et al., 2015). [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
In the whole hair cycle, the abundance of expression of let-7a-5p, let-7f, let-7b, let-7c, let-7g, miR-199a-3p, miR-143, miR-1, and miR-320a reached their highest levels in the present study (Table  2). [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-32, hsa-mir-33a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-99a, mmu-mir-126a, mmu-mir-128-1, mmu-mir-130a, mmu-mir-140, mmu-mir-154, mmu-mir-204, mmu-mir-143, hsa-mir-204, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-222, hsa-mir-223, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-128-1, hsa-mir-130a, hsa-mir-140, hsa-mir-143, hsa-mir-126, hsa-mir-129-2, hsa-mir-154, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-340, mmu-mir-107, mmu-mir-32, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-223, mmu-mir-26a-2, mmu-mir-211, mmu-mir-222, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, hsa-mir-340, mmu-mir-409, hsa-mir-409, hsa-mir-499a, hsa-mir-455, hsa-mir-670, mmu-mir-1249, mmu-mir-670, mmu-mir-499, mmu-mir-455, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-16b, bta-mir-222, bta-mir-26b, bta-mir-27a, bta-mir-499, bta-mir-99a, bta-mir-126, bta-mir-128-1, bta-mir-34b, bta-mir-107, bta-mir-140, bta-mir-15b, bta-mir-218-2, bta-let-7d, bta-mir-29c, bta-mir-455, bta-let-7g, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-34c, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-204, hsa-mir-1249, hsa-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-129-2, bta-mir-130a, bta-mir-143, bta-mir-154a, bta-mir-211, bta-mir-218-1, bta-mir-223, bta-mir-26a-1, bta-mir-301a, bta-mir-32, bta-mir-33a, bta-mir-340, bta-mir-379, bta-mir-409a, bta-mir-670, mmu-mir-1306, bta-mir-1306, bta-mir-1249, bta-mir-2284i, bta-mir-2285a, bta-mir-2284s, bta-mir-2285d, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2285b-1, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2285c, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-2284e, hsa-mir-1260b, bta-mir-2284w, bta-mir-2284x, bta-mir-409b, hsa-mir-499b, bta-mir-1260b, bta-mir-2284y-1, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-6119, mmu-let-7j, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2284y-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2284y-3, bta-mir-154c, bta-mir-154b, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2284y-7, bta-mir-2285n-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2285k-2, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2284z-4, bta-mir-2285k-5, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2284z-2, mmu-let-7k, mmu-mir-126b, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2284ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2284ac, bta-mir-2285ae, chi-let-7a, chi-let-7b, chi-let-7c, chi-let-7d, chi-let-7e, chi-let-7g, chi-let-7i, chi-mir-103, chi-mir-107, chi-mir-1249, chi-mir-126, chi-mir-1306, chi-mir-130a, chi-mir-140, chi-mir-143, chi-mir-154a, chi-mir-154b, chi-mir-15b, chi-mir-16b, chi-mir-204, chi-mir-211, chi-mir-222, chi-mir-223, chi-mir-2284a, chi-mir-2284b, chi-mir-2284c, chi-mir-2284d, chi-mir-2284e, chi-mir-26a, chi-mir-26b, chi-mir-27a, chi-mir-29a, chi-mir-29c, chi-mir-301a, chi-mir-33a, chi-mir-340, chi-mir-34b, chi-mir-34c, chi-mir-379, chi-mir-409, chi-mir-455, chi-mir-499, chi-mir-99a, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
Among these, 16 precursors were found amongst the 43 conserved between human, mouse, cow and goat in our analysis (let-7 g, mir-101-2, mir-103, mir-107, mir-128-1, mir-1306, mir-140, mir-15b, mir-16b, mir-211, mir-218-1, mir-26a-1, mir-32, mir-33a, mir-455, let-7-2), so the location of these precursors appears to be highly conserved in all vertebrates. [score:1]
In the present case, several members of the same family (such as the let-7 family) were identified as being clustered, as well as the largest miRNA gene cluster localized on CHI 21 which contained 16 members of the mir-154 family. [score:1]
[1 to 20 of 2 sentences]