sort by

8 publications mentioning chi-mir-10b

Open access articles that are associated with the species Capra hircus and mention the gene name mir-10b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 55
MiR-10b takes part in carcinogenesis: miR-10b can suppress the translation of the HOXD10 gene leading to increased RHOC expression and AKT phosphorylation [27, 28]. [score:7]
MiRNA name Target gene in MAPK signaling pathway MiR-10b BDNF MiR-211 SOS1 MiR-143 CACNA1E, FGF1, MAPK7, MAP3K7, PDGFRA, KRAS MiR-30a RAP1B, RASA1, RAPGEF2, TAOK1, CACNB2, CASP3, CACNA1C, IL1A, MAP2K4, MAP3K1, MAP3K12, MAP3K2, MAP3K5, NF1, PPP3CA, PPP3CB, RPS6KA2, CRKL MiR-146a TRAF6 To gain an insight into the molecular functions of genes in biological processes, we annotated the genes targeted by differentially expressed miRNAs using GO categories (Table S5). [score:7]
MiRNA name Target gene in MAPK signaling pathway MiR-10b BDNF MiR-211 SOS1 MiR-143 CACNA1E, FGF1, MAPK7, MAP3K7, PDGFRA, KRAS MiR-30a RAP1B, RASA1, RAPGEF2, TAOK1, CACNB2, CASP3, CACNA1C, IL1A, MAP2K4, MAP3K1, MAP3K12, MAP3K2, MAP3K5, NF1, PPP3CA, PPP3CB, RPS6KA2, CRKL MiR-146a TRAF6 To gain an insight into the molecular functions of genes in biological processes, we annotated the genes targeted by differentially expressed miRNAs using GO categories (Table S5). [score:7]
In our study, the MAPK signaling pathway was the major pathway involving 27 genes, and targeted by five differentially expressed miRNAs including miR10b. [score:5]
MiR-211 had a similar expression pattern to miR-10b. [score:3]
MiR-10b was one of the most abundant and differentially expressed miRNA in black hair follicles, with approximately 64,534.56 reads. [score:3]
Figure 5The expression of miR-211 and miR-10b in two tissues. [score:3]
The expression levels of miR-10b and miR-211 were significantly higher in black follicles than in white follicles. [score:3]
Two differentially expressed miRNAs, miR-10b and miR-211, were verified by qPCR. [score:3]
The expressions of two miRNAs, miR-10b and miR-211, were confirmed (Figure 5). [score:3]
Our results showed that miR-10b regulates the DVL3 gene in the Notch pathway. [score:2]
Liu Y. Li M. Zhang G. Pang Z. MicroRNA-10b overexpression promotes non-small cell lung cancer cell proliferation and invasion Eur. [score:2]
Taken together, miR-10b could be an important regulator in goat coat color formation. [score:2]
MiRNA Primer sequences Goat-miR-211 Forward: TCGGCAGGTCCCTTTGTCATCC Reverse: TGCAGGTCAACTGGTGTCGT Loop prime: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTGGGCAAA Goat-miR-10b Forward: TCGGCAGGACCCTGTAGAACCG Reverse: TGCAGGTCAACTGGTGTCGT Loop prime: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCACAAATT U6 Forward: CTCGCTTCGGCAGCACA Reverse: AACGCTTCACGAATTTGCGT The TargetScan website (http://www. [score:2]
Liu Z. Zhu J. Cao H. Ren H. Fang X. MiR-10b promotes cell invasion through RhoC-AKT signaling pathway by targeting HOXD10 in gastric cancer Int. [score:2]
MiR-10b is highly expressed in black hair follicles (BF) in compared with the white hair follicles (WF). [score:1]
[1 to 20 of 16 sentences]
2
[+] score: 16
The 10 most highly expressed miRNAs (miR-99a, miR-148a, miR-143, miR-10b, miR-26a, miR-21, miR-125b, miR-27b, let-7f, and miR-101) identified in the present study were also highly expressed in the ovaries of goats 18, 20, pigs [22], and other animal species as reviewed by Li et al. [9]. [score:5]
The 10 most abundant miRNAs (miR-99a-5p, miR-148a-3p, miR-143-3p, miR-10b-5p, miR-26a-5p, miR-21-5p, miR-125b-5p, miR-27b-3p, let-7f-5p, and miR-101-3p) were the same in the two libraries, of which miR-21-5p was defined as differentially expressed miRNA with a higher level in the prolific library than in the non-prolific library, but the remaining nine miRNAs did not meet the criteria of differentially expressed miRNA between the breeds (Table  3). [score:5]
Various miRNAs were expressed in GCs (miR-143, miR-125b, let-7 family, miR-21, miR-10b, miR-378, etc. ) [score:3]
Six of these miRNAs (miR-99a, miR-143, miR-10b, miR-26a, miR-125b, and let-7f) are specifically or predominantly expressed in bovine ovaries compared to the somatic tissue pools (e. g. hypothalamus, liver, heart, lung, kidney, etc. ) [score:2]
38– 40, theca cells (mir-24, miR-222 and miR-378) 40, 41, and oocytes (miR-10a, miR-10b, miR-100, let-7 family, etc. ) [score:1]
[1 to 20 of 5 sentences]
3
[+] score: 11
As shown in Figure 4A and B, the ten most highly expressed miRNAs in the non-pregnant library were all downregulated in the pregnant library, and of the ten most highly expressed miRNAs in the pregnant library, six miRNAs (miR-143, miR-99a, miR-125b, miR-148a, miR-10b, miR-26a) and four miRNAs (let-7a, let-7f, let-7c, let-7b) were down- and upregulated in the non-pregnant library, respectively. [score:11]
[1 to 20 of 1 sentences]
4
[+] score: 7
Of the 29, miR-10b, miR-125b, and miR-145 were down-regulated, while miR-21 and miR-155 were up-regulated [6]. [score:7]
[1 to 20 of 1 sentences]
5
[+] score: 7
For miRNA families, each of 6 families (let-7, miR-2284, miR-30, miR-143, miR-10 and miR-378) had more than 100 members, and Alsaweed also reported the members of each family with higher expression abundance [39]. [score:3]
High-abundance expressed miRNAs identified in the present study, including miR-375, miR-10, miR-26, miR-29, and miR-126, were also identified in other mammalian mammary gland tissues, even in the milk and body fluids 40– 42. [score:3]
The largest family was miR-2284 with 447 members, which was detected in 43 species, followed by let-7, miR-30, miR-143, miR-10 and miR-378; 152 families were the smallest, each containing only one member. [score:1]
[1 to 20 of 3 sentences]
6
[+] score: 5
Two highly expressed differential miRNAs (miR-10b and miR-99a) identified in the present study are also highly expressed in the ovaries of goats, pigs and other animal species as reviewed by Li et al. [46]. [score:5]
[1 to 20 of 1 sentences]
7
[+] score: 3
In the present study high levels of expression of miR-10b, miR-125b, miR-143, miR145, miR199b, miR21 and miR-99a were recorded in the ovary. [score:3]
[1 to 20 of 1 sentences]
8
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Additionally, a number of miRNAs including miR-148a, miR-26a, miR-21-5p, miR-27b, miR-143, bta-miR-30a-5p, let-7a-5p, let-7f, miR-10b, and miR-99a-5p are highly expressed in bovine mammary gland/mammary epithelial cells (Li et al., 2012a, 2014a; Jin et al., 2014a; Le Guillou et al., 2014) suggesting roles in the lactation process and mammary gland functions. [score:3]
[1 to 20 of 1 sentences]