sort by

7 publications mentioning mes-MIR398

Open access articles that are associated with the species Manihot esculenta and mention the gene name MIR398. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 8
Other repressed families were miR397, miR398 and miR408, known to be involved in copper regulation and to be differentially expressed in response to biotic stress [34, 46, 47]. [score:4]
The miR397, miR398 and miR408 families were also repressed (log [2]fold < -1.4); they are involved in copper regulation by targeting laccases, copper superoxide dismutases and plantacyanins, respectively [34]. [score:4]
[1 to 20 of 2 sentences]
2
[+] score: 6
Other miRNAs from this paper: mes-MIR159a, mes-MIR167a, mes-MIR168a, mes-MIR171a, mes-MIR172a, mes-MIR394a, mes-MIR399a, mes-MIR156a, mes-MIR156b, mes-MIR156c, mes-MIR156d, mes-MIR156e, mes-MIR156f, mes-MIR156g, mes-MIR156h, mes-MIR156i, mes-MIR156j, mes-MIR156k, mes-MIR159b, mes-MIR159c, mes-MIR159d, mes-MIR160a, mes-MIR160b, mes-MIR160c, mes-MIR160d, mes-MIR160e, mes-MIR160f, mes-MIR160g, mes-MIR160h, mes-MIR162, mes-MIR164a, mes-MIR164b, mes-MIR164c, mes-MIR164d, mes-MIR166a, mes-MIR166b, mes-MIR166c, mes-MIR166d, mes-MIR166e, mes-MIR166f, mes-MIR166g, mes-MIR166h, mes-MIR166i, mes-MIR166j, mes-MIR167b, mes-MIR167c, mes-MIR167d, mes-MIR167e, mes-MIR167f, mes-MIR167g, mes-MIR167h, mes-MIR169a, mes-MIR169b, mes-MIR169c, mes-MIR169d, mes-MIR169e, mes-MIR169f, mes-MIR169g, mes-MIR169h, mes-MIR169i, mes-MIR169j, mes-MIR169k, mes-MIR169l, mes-MIR169m, mes-MIR169n, mes-MIR169o, mes-MIR169p, mes-MIR169q, mes-MIR169r, mes-MIR169s, mes-MIR169t, mes-MIR169u, mes-MIR169v, mes-MIR169w, mes-MIR169x, mes-MIR169y, mes-MIR169z, mes-MIR169aa, mes-MIR169ab, mes-MIR169ac, mes-MIR171b, mes-MIR171c, mes-MIR171d, mes-MIR171e, mes-MIR171f, mes-MIR171g, mes-MIR171h, mes-MIR171i, mes-MIR171j, mes-MIR171k, mes-MIR172b, mes-MIR172c, mes-MIR172d, mes-MIR172e, mes-MIR172f, mes-MIR319a, mes-MIR319b, mes-MIR319c, mes-MIR319d, mes-MIR319e, mes-MIR319f, mes-MIR319g, mes-MIR319h, mes-MIR394b, mes-MIR394c, mes-MIR396a, mes-MIR396b, mes-MIR396c, mes-MIR396d, mes-MIR396e, mes-MIR396f, mes-MIR397, mes-MIR399b, mes-MIR399c, mes-MIR399d, mes-MIR399e, mes-MIR399f, mes-MIR399g, mes-MIR477h, mes-MIR477i, mes-MIR477a, mes-MIR477b, mes-MIR477c, mes-MIR477d, mes-MIR477e, mes-MIR477f, mes-MIR477g, mes-MIR535a, mes-MIR535b, mes-MIR2950, mes-MIR171l, mes-MIR399h, mes-MIR477j, mes-MIR477k, mes-MIR535c, mes-MIR535d, mes-MIR169ad
miR398 targeted the mRNA of a disease resistance-responsive family protein (cassava4.1_024493, Dir-like) in cassava, but the cleavage sites of the miR398: Dir-like pair were not positioned within the CR: ten cleavage sites were all at the 8th nucleotide upstream of the CR. [score:5]
The cleavage sites of miR398: Dir-like and miR477: CLB were at the +8th and +37th nucleotides upstream of the CR, respectively. [score:1]
[1 to 20 of 2 sentences]
3
[+] score: 3
Other miRNAs from this paper: mes-MIR159a, mes-MIR167a, mes-MIR171a, mes-MIR156a, mes-MIR156b, mes-MIR156c, mes-MIR156d, mes-MIR156e, mes-MIR156f, mes-MIR156g, mes-MIR156h, mes-MIR156i, mes-MIR156j, mes-MIR156k, mes-MIR160a, mes-MIR160b, mes-MIR160c, mes-MIR160d, mes-MIR160e, mes-MIR160f, mes-MIR160g, mes-MIR160h, mes-MIR166a, mes-MIR166b, mes-MIR166c, mes-MIR166d, mes-MIR166e, mes-MIR166f, mes-MIR166g, mes-MIR166h, mes-MIR166i, mes-MIR166j, mes-MIR167b, mes-MIR167c, mes-MIR167d, mes-MIR167e, mes-MIR167f, mes-MIR167g, mes-MIR167h, mes-MIR169a, mes-MIR169b, mes-MIR169c, mes-MIR169d, mes-MIR169e, mes-MIR169f, mes-MIR169g, mes-MIR169h, mes-MIR169i, mes-MIR169j, mes-MIR169k, mes-MIR169l, mes-MIR169m, mes-MIR169n, mes-MIR169o, mes-MIR169p, mes-MIR169q, mes-MIR169r, mes-MIR169s, mes-MIR169t, mes-MIR169u, mes-MIR169v, mes-MIR169w, mes-MIR169x, mes-MIR169y, mes-MIR169z, mes-MIR169aa, mes-MIR169ab, mes-MIR169ac, mes-MIR171b, mes-MIR171c, mes-MIR171d, mes-MIR171e, mes-MIR171f, mes-MIR171g, mes-MIR171h, mes-MIR171i, mes-MIR171j, mes-MIR171k, mes-MIR319f, mes-MIR390, mes-MIR393a, mes-MIR393b, mes-MIR393c, mes-MIR393d, mes-MIR395a, mes-MIR395b, mes-MIR395c, mes-MIR395d, mes-MIR395e, mes-MIR477h, mes-MIR477i, mes-MIR477a, mes-MIR477b, mes-MIR477c, mes-MIR477d, mes-MIR477e, mes-MIR477f, mes-MIR477g, mes-MIR482, mes-MIR530b, mes-MIR535a, mes-MIR535b, mes-MIR828a, mes-MIR828b, mes-MIR171l, mes-MIR390b, mes-MIR397b, mes-MIR399h, mes-MIR477j, mes-MIR477k, mes-MIR2118, mes-MIR482b, mes-MIR482d, mes-MIR535c, mes-MIR535d, mes-MIR1446b, mes-MIR6445, mes-MIR9386, mes-MIR169ad, mes-MIR11891, mes-MIR11892
In addition, mes-miR398, a regulator of host response to oxidative stress [28] also showed unequal distribution with leaf tissues, recording 47,642 unique reads while only 2,646 and 1,014 reads were found in male and female flowers, respectively. [score:2]
As for miR398, reports of its role in host defense to biotic and abiotic stresses are conflicting. [score:1]
[1 to 20 of 2 sentences]
4
[+] score: 1
Other miRNAs from this paper: mes-MIR159a, mes-MIR167a, mes-MIR168a, mes-MIR171a, mes-MIR172a, mes-MIR399a, mes-MIR408, mes-MIR156a, mes-MIR156b, mes-MIR156c, mes-MIR156d, mes-MIR156e, mes-MIR156f, mes-MIR156g, mes-MIR156h, mes-MIR156i, mes-MIR156j, mes-MIR156k, mes-MIR159b, mes-MIR159c, mes-MIR159d, mes-MIR160a, mes-MIR160b, mes-MIR160c, mes-MIR160d, mes-MIR160e, mes-MIR160f, mes-MIR160g, mes-MIR160h, mes-MIR162, mes-MIR164a, mes-MIR164b, mes-MIR164c, mes-MIR164d, mes-MIR166a, mes-MIR166b, mes-MIR166c, mes-MIR166d, mes-MIR166e, mes-MIR166f, mes-MIR166g, mes-MIR166h, mes-MIR166i, mes-MIR166j, mes-MIR167b, mes-MIR167c, mes-MIR167d, mes-MIR167e, mes-MIR167f, mes-MIR167g, mes-MIR167h, mes-MIR169a, mes-MIR169b, mes-MIR169c, mes-MIR169d, mes-MIR169e, mes-MIR169f, mes-MIR169g, mes-MIR169h, mes-MIR169i, mes-MIR169j, mes-MIR169k, mes-MIR169l, mes-MIR169m, mes-MIR169n, mes-MIR169o, mes-MIR169p, mes-MIR169q, mes-MIR169r, mes-MIR169s, mes-MIR169t, mes-MIR169u, mes-MIR169v, mes-MIR169w, mes-MIR169x, mes-MIR169y, mes-MIR169z, mes-MIR169aa, mes-MIR169ab, mes-MIR169ac, mes-MIR171b, mes-MIR171c, mes-MIR171d, mes-MIR171e, mes-MIR171f, mes-MIR171g, mes-MIR171h, mes-MIR171i, mes-MIR171j, mes-MIR171k, mes-MIR172b, mes-MIR172c, mes-MIR172d, mes-MIR172e, mes-MIR172f, mes-MIR319a, mes-MIR319b, mes-MIR319c, mes-MIR319d, mes-MIR319e, mes-MIR319f, mes-MIR319g, mes-MIR319h, mes-MIR390, mes-MIR393a, mes-MIR393b, mes-MIR393c, mes-MIR393d, mes-MIR395a, mes-MIR395b, mes-MIR395c, mes-MIR395d, mes-MIR395e, mes-MIR396a, mes-MIR396b, mes-MIR396c, mes-MIR396d, mes-MIR396e, mes-MIR396f, mes-MIR397, mes-MIR399b, mes-MIR399c, mes-MIR399d, mes-MIR399e, mes-MIR399f, mes-MIR399g, mes-MIR482, mes-MIR535a, mes-MIR535b, mes-MIR827, mes-MIR2275, mes-MIR171l, mes-MIR399h, mes-MIR2118, mes-MIR535c, mes-MIR535d, mes-MIR169ad
The miR397 and miR398 families were acquired in the common ancestor of all spermatophytes (seed plants). [score:1]
[1 to 20 of 1 sentences]
5
[+] score: 1
As expected, many of these anti-correlated miRNAs and mRNAs were related to stress responses, such as novel16-POS, where POS is associated with scavenging hydrogen peroxide, and miR398-EC, where EC is supposed to maintain the membrane potential via electron carrier. [score:1]
[1 to 20 of 1 sentences]
6
[+] score: 1
Other miRNAs from this paper: rco-MIR156a, rco-MIR156b, rco-MIR156c, rco-MIR156d, rco-MIR156e, rco-MIR156f, rco-MIR156g, rco-MIR156h, rco-MIR159, rco-MIR160a, rco-MIR160b, rco-MIR162, rco-MIR164a, rco-MIR164b, rco-MIR164c, rco-MIR164d, rco-MIR166a, rco-MIR166b, rco-MIR166c, rco-MIR166d, rco-MIR166e, rco-MIR167a, rco-MIR167b, rco-MIR167c, rco-MIR168, rco-MIR169a, rco-MIR169b, rco-MIR169c, rco-MIR171a, rco-MIR171b, rco-MIR171c, rco-MIR171d, rco-MIR171e, rco-MIR171f, rco-MIR171g, rco-MIR172, rco-MIR319a, rco-MIR319b, rco-MIR319c, rco-MIR319d, rco-MIR390a, rco-MIR390b, rco-MIR393, rco-MIR395a, rco-MIR395b, rco-MIR395c, rco-MIR395d, rco-MIR395e, rco-MIR396, rco-MIR398a, rco-MIR398b, rco-MIR399a, rco-MIR399b, rco-MIR399c, rco-MIR399d, rco-MIR399e, rco-MIR399f, rco-MIR408, rco-MIR160c, mes-MIR159a, mes-MIR167a, mes-MIR168a, mes-MIR171a, mes-MIR172a, mes-MIR399a, mes-MIR408, mes-MIR156a, mes-MIR156b, mes-MIR156c, mes-MIR156d, mes-MIR156e, mes-MIR156f, mes-MIR156g, mes-MIR156h, mes-MIR156i, mes-MIR156j, mes-MIR156k, mes-MIR159b, mes-MIR159c, mes-MIR159d, mes-MIR160a, mes-MIR160b, mes-MIR160c, mes-MIR160d, mes-MIR160e, mes-MIR160f, mes-MIR160g, mes-MIR160h, mes-MIR162, mes-MIR164a, mes-MIR164b, mes-MIR164c, mes-MIR164d, mes-MIR166a, mes-MIR166b, mes-MIR166c, mes-MIR166d, mes-MIR166e, mes-MIR166f, mes-MIR166g, mes-MIR166h, mes-MIR166i, mes-MIR166j, mes-MIR167b, mes-MIR167c, mes-MIR167d, mes-MIR167e, mes-MIR167f, mes-MIR167g, mes-MIR167h, mes-MIR169a, mes-MIR169b, mes-MIR169c, mes-MIR169d, mes-MIR169e, mes-MIR169f, mes-MIR169g, mes-MIR169h, mes-MIR169i, mes-MIR169j, mes-MIR169k, mes-MIR169l, mes-MIR169m, mes-MIR169n, mes-MIR169o, mes-MIR169p, mes-MIR169q, mes-MIR169r, mes-MIR169s, mes-MIR169t, mes-MIR169u, mes-MIR169v, mes-MIR169w, mes-MIR169x, mes-MIR169y, mes-MIR169z, mes-MIR169aa, mes-MIR169ab, mes-MIR169ac, mes-MIR171b, mes-MIR171c, mes-MIR171d, mes-MIR171e, mes-MIR171f, mes-MIR171g, mes-MIR171h, mes-MIR171i, mes-MIR171j, mes-MIR171k, mes-MIR172b, mes-MIR172c, mes-MIR172d, mes-MIR172e, mes-MIR172f, mes-MIR319a, mes-MIR319b, mes-MIR319c, mes-MIR319d, mes-MIR319e, mes-MIR319f, mes-MIR319g, mes-MIR319h, mes-MIR390, mes-MIR393a, mes-MIR393b, mes-MIR393c, mes-MIR393d, mes-MIR395a, mes-MIR395b, mes-MIR395c, mes-MIR395d, mes-MIR395e, mes-MIR396a, mes-MIR396b, mes-MIR396c, mes-MIR396d, mes-MIR396e, mes-MIR396f, mes-MIR399b, mes-MIR399c, mes-MIR399d, mes-MIR399e, mes-MIR399f, mes-MIR399g, mes-MIR477h, mes-MIR477i, mes-MIR477a, mes-MIR477b, mes-MIR477c, mes-MIR477d, mes-MIR477e, mes-MIR477f, mes-MIR477g, mes-MIR482, mes-MIR828a, mes-MIR828b, mes-MIR171l, mes-MIR399h, mes-MIR477j, mes-MIR477k, mes-MIR2118, mes-MIR3627, mes-MIR169ad
Another 10 annotated miRNA families – miR159, miR162, miR164, miR167, miR168, miR169, miR172, miR393, miR396, and miR398 – were also conserved in at least eight species (Table  2). [score:1]
[1 to 20 of 1 sentences]
7
[+] score: 1
2 AAGGGTTTCTTACAGAGTTTA AAGGGTTTCTTACAGAGTTTA √ Known miR398 TGTGTTCTCAGGTCGCCCCTG CAGGGGCGACCTGAGAACACA √ “√”, “∽” and “×” means that the sequence of PCR products is as same as, nearly as same and not as same as the sequence determined by RNA-seq, respectively. [score:1]
[1 to 20 of 1 sentences]