sort by

3 publications mentioning mes-MIR477k

Open access articles that are associated with the species Manihot esculenta and mention the gene name MIR477k. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 22
Other miRNAs from this paper: mes-MIR159a, mes-MIR167a, mes-MIR171a, mes-MIR156a, mes-MIR156b, mes-MIR156c, mes-MIR156d, mes-MIR156e, mes-MIR156f, mes-MIR156g, mes-MIR156h, mes-MIR156i, mes-MIR156j, mes-MIR156k, mes-MIR160a, mes-MIR160b, mes-MIR160c, mes-MIR160d, mes-MIR160e, mes-MIR160f, mes-MIR160g, mes-MIR160h, mes-MIR166a, mes-MIR166b, mes-MIR166c, mes-MIR166d, mes-MIR166e, mes-MIR166f, mes-MIR166g, mes-MIR166h, mes-MIR166i, mes-MIR166j, mes-MIR167b, mes-MIR167c, mes-MIR167d, mes-MIR167e, mes-MIR167f, mes-MIR167g, mes-MIR167h, mes-MIR169a, mes-MIR169b, mes-MIR169c, mes-MIR169d, mes-MIR169e, mes-MIR169f, mes-MIR169g, mes-MIR169h, mes-MIR169i, mes-MIR169j, mes-MIR169k, mes-MIR169l, mes-MIR169m, mes-MIR169n, mes-MIR169o, mes-MIR169p, mes-MIR169q, mes-MIR169r, mes-MIR169s, mes-MIR169t, mes-MIR169u, mes-MIR169v, mes-MIR169w, mes-MIR169x, mes-MIR169y, mes-MIR169z, mes-MIR169aa, mes-MIR169ab, mes-MIR169ac, mes-MIR171b, mes-MIR171c, mes-MIR171d, mes-MIR171e, mes-MIR171f, mes-MIR171g, mes-MIR171h, mes-MIR171i, mes-MIR171j, mes-MIR171k, mes-MIR319f, mes-MIR390, mes-MIR393a, mes-MIR393b, mes-MIR393c, mes-MIR393d, mes-MIR395a, mes-MIR395b, mes-MIR395c, mes-MIR395d, mes-MIR395e, mes-MIR477h, mes-MIR477i, mes-MIR477a, mes-MIR477b, mes-MIR477c, mes-MIR477d, mes-MIR477e, mes-MIR477f, mes-MIR477g, mes-MIR482, mes-MIR530b, mes-MIR535a, mes-MIR535b, mes-MIR828a, mes-MIR828b, mes-MIR171l, mes-MIR390b, mes-MIR397b, mes-MIR398, mes-MIR399h, mes-MIR477j, mes-MIR2118, mes-MIR482b, mes-MIR482d, mes-MIR535c, mes-MIR535d, mes-MIR1446b, mes-MIR6445, mes-MIR9386, mes-MIR169ad, mes-MIR11891, mes-MIR11892
For example, results of both procedures showed very low expression levels in flower tissues even though mes-miR477k was observed to show high expression levels in flower tissues. [score:5]
Seven transcription factor families of genes were predicted to be targeted by seven different miRNA families, encoding the following types of proteins: GRAS (targeted by mes-miR171a), basic-leucine zipper (bZIP) (mes-miR166j), MYB1 (mes-miR319f), squamosa promoter -binding protein-like (mes-miR156k), transcription-repair coupling factor (mes-miR169a), sequence-specific DNA binding transcription factor (miR477), and TEOSINTE BRANCHED 1 CYCLOIDEA and PCF transcription factor (mes-miR319f) (Additional file 4: Table S2). [score:5]
To corroborate qRT-PCR detection and validate the expression levels, we carried out Northern blot analysis using locked nucleic acid (LNA) probes four known miRNAs (mes-miR171a, mes-miR477k, mes-miR2118, mes-miR535c) and two novel miRNAs (mes-miR169ad and mes-miR11892). [score:3]
Correspondingly, very low levels of miR482, miR477, and miR535 families were observed in callus tissues while mes-miR530b, mes-miR535c, mes-miR169ad, and mes-miR399h appeared not to be expressed in leaves. [score:3]
Other families of genes targeted included kinases (mes-miR166j, mes-miR156k, mes-miR390b, mes-miR169ac, mes-miR535d, mes-miR482b, and mes-miR1446b), pentatricopeptide repeat proteins (mes-miR477k, mes-miR319f, mes-miR2118), auxin response factor proteins (mes-miR160f, mes-miR156k, mes-miR393a, mes-miR167b), zinc finger proteins (mes-miR530b, mes-miR6445, and mes-miR393a), and laccases (mes-miR397b) (Additional file 4: Table S2). [score:3]
Some of the miRNAs showed very high abundance in male flower tissues, notably miR482 and miR477 families, mes-miR2118, and mes-miR1446b. [score:1]
Several miRNAs were also found to be low in callus tissues, amongst which were mes-miR477k, mes-miR319f and mes-miR169ac. [score:1]
The LNA-oligonucleotide probes, complementary to the mature microRNAs were, mes-miR171a: 5′- GGAGATATTGACGCGGCTCAA -3′; mes-miR477k: 5′-CC GGAAGCCCTT GAGGGAGAGT-3′; mes-miR2118: 5′-GGTA TGG GAGGTCTTGGGAAAA-3′; mes-miR535c: 5′-TGTGCT CTCTCTCGTCGTCAA-3′; U6:5′-TGTATC GTTCCAATTTTATCG −3′ (locked nucleotides were underlined). [score:1]
[1 to 20 of 8 sentences]
2
[+] score: 6
Other miRNAs from this paper: mes-MIR159a, mes-MIR167a, mes-MIR168a, mes-MIR171a, mes-MIR172a, mes-MIR394a, mes-MIR399a, mes-MIR156a, mes-MIR156b, mes-MIR156c, mes-MIR156d, mes-MIR156e, mes-MIR156f, mes-MIR156g, mes-MIR156h, mes-MIR156i, mes-MIR156j, mes-MIR156k, mes-MIR159b, mes-MIR159c, mes-MIR159d, mes-MIR160a, mes-MIR160b, mes-MIR160c, mes-MIR160d, mes-MIR160e, mes-MIR160f, mes-MIR160g, mes-MIR160h, mes-MIR162, mes-MIR164a, mes-MIR164b, mes-MIR164c, mes-MIR164d, mes-MIR166a, mes-MIR166b, mes-MIR166c, mes-MIR166d, mes-MIR166e, mes-MIR166f, mes-MIR166g, mes-MIR166h, mes-MIR166i, mes-MIR166j, mes-MIR167b, mes-MIR167c, mes-MIR167d, mes-MIR167e, mes-MIR167f, mes-MIR167g, mes-MIR167h, mes-MIR169a, mes-MIR169b, mes-MIR169c, mes-MIR169d, mes-MIR169e, mes-MIR169f, mes-MIR169g, mes-MIR169h, mes-MIR169i, mes-MIR169j, mes-MIR169k, mes-MIR169l, mes-MIR169m, mes-MIR169n, mes-MIR169o, mes-MIR169p, mes-MIR169q, mes-MIR169r, mes-MIR169s, mes-MIR169t, mes-MIR169u, mes-MIR169v, mes-MIR169w, mes-MIR169x, mes-MIR169y, mes-MIR169z, mes-MIR169aa, mes-MIR169ab, mes-MIR169ac, mes-MIR171b, mes-MIR171c, mes-MIR171d, mes-MIR171e, mes-MIR171f, mes-MIR171g, mes-MIR171h, mes-MIR171i, mes-MIR171j, mes-MIR171k, mes-MIR172b, mes-MIR172c, mes-MIR172d, mes-MIR172e, mes-MIR172f, mes-MIR319a, mes-MIR319b, mes-MIR319c, mes-MIR319d, mes-MIR319e, mes-MIR319f, mes-MIR319g, mes-MIR319h, mes-MIR394b, mes-MIR394c, mes-MIR396a, mes-MIR396b, mes-MIR396c, mes-MIR396d, mes-MIR396e, mes-MIR396f, mes-MIR397, mes-MIR399b, mes-MIR399c, mes-MIR399d, mes-MIR399e, mes-MIR399f, mes-MIR399g, mes-MIR477h, mes-MIR477i, mes-MIR477a, mes-MIR477b, mes-MIR477c, mes-MIR477d, mes-MIR477e, mes-MIR477f, mes-MIR477g, mes-MIR535a, mes-MIR535b, mes-MIR2950, mes-MIR171l, mes-MIR398, mes-MIR399h, mes-MIR477j, mes-MIR535c, mes-MIR535d, mes-MIR169ad
Many of these targets encode transcription factors; for example, they include the SPL (target of miR156 and miR535), MYB (miR159, miR319 and new-18), HAM3 (miR171), NAC (miR164), ARF (miR160, miR167 and miR169), TCP (miR319), GRF (miR396 and miR477) and SIGMA (new-11) genes. [score:5]
The cleavage sites of miR398: Dir-like and miR477: CLB were at the +8th and +37th nucleotides upstream of the CR, respectively. [score:1]
[1 to 20 of 2 sentences]
3
[+] score: 1
Other miRNAs from this paper: rco-MIR156a, rco-MIR156b, rco-MIR156c, rco-MIR156d, rco-MIR156e, rco-MIR156f, rco-MIR156g, rco-MIR156h, rco-MIR159, rco-MIR160a, rco-MIR160b, rco-MIR162, rco-MIR164a, rco-MIR164b, rco-MIR164c, rco-MIR164d, rco-MIR166a, rco-MIR166b, rco-MIR166c, rco-MIR166d, rco-MIR166e, rco-MIR167a, rco-MIR167b, rco-MIR167c, rco-MIR168, rco-MIR169a, rco-MIR169b, rco-MIR169c, rco-MIR171a, rco-MIR171b, rco-MIR171c, rco-MIR171d, rco-MIR171e, rco-MIR171f, rco-MIR171g, rco-MIR172, rco-MIR319a, rco-MIR319b, rco-MIR319c, rco-MIR319d, rco-MIR390a, rco-MIR390b, rco-MIR393, rco-MIR395a, rco-MIR395b, rco-MIR395c, rco-MIR395d, rco-MIR395e, rco-MIR396, rco-MIR398a, rco-MIR398b, rco-MIR399a, rco-MIR399b, rco-MIR399c, rco-MIR399d, rco-MIR399e, rco-MIR399f, rco-MIR408, rco-MIR160c, mes-MIR159a, mes-MIR167a, mes-MIR168a, mes-MIR171a, mes-MIR172a, mes-MIR399a, mes-MIR408, mes-MIR156a, mes-MIR156b, mes-MIR156c, mes-MIR156d, mes-MIR156e, mes-MIR156f, mes-MIR156g, mes-MIR156h, mes-MIR156i, mes-MIR156j, mes-MIR156k, mes-MIR159b, mes-MIR159c, mes-MIR159d, mes-MIR160a, mes-MIR160b, mes-MIR160c, mes-MIR160d, mes-MIR160e, mes-MIR160f, mes-MIR160g, mes-MIR160h, mes-MIR162, mes-MIR164a, mes-MIR164b, mes-MIR164c, mes-MIR164d, mes-MIR166a, mes-MIR166b, mes-MIR166c, mes-MIR166d, mes-MIR166e, mes-MIR166f, mes-MIR166g, mes-MIR166h, mes-MIR166i, mes-MIR166j, mes-MIR167b, mes-MIR167c, mes-MIR167d, mes-MIR167e, mes-MIR167f, mes-MIR167g, mes-MIR167h, mes-MIR169a, mes-MIR169b, mes-MIR169c, mes-MIR169d, mes-MIR169e, mes-MIR169f, mes-MIR169g, mes-MIR169h, mes-MIR169i, mes-MIR169j, mes-MIR169k, mes-MIR169l, mes-MIR169m, mes-MIR169n, mes-MIR169o, mes-MIR169p, mes-MIR169q, mes-MIR169r, mes-MIR169s, mes-MIR169t, mes-MIR169u, mes-MIR169v, mes-MIR169w, mes-MIR169x, mes-MIR169y, mes-MIR169z, mes-MIR169aa, mes-MIR169ab, mes-MIR169ac, mes-MIR171b, mes-MIR171c, mes-MIR171d, mes-MIR171e, mes-MIR171f, mes-MIR171g, mes-MIR171h, mes-MIR171i, mes-MIR171j, mes-MIR171k, mes-MIR172b, mes-MIR172c, mes-MIR172d, mes-MIR172e, mes-MIR172f, mes-MIR319a, mes-MIR319b, mes-MIR319c, mes-MIR319d, mes-MIR319e, mes-MIR319f, mes-MIR319g, mes-MIR319h, mes-MIR390, mes-MIR393a, mes-MIR393b, mes-MIR393c, mes-MIR393d, mes-MIR395a, mes-MIR395b, mes-MIR395c, mes-MIR395d, mes-MIR395e, mes-MIR396a, mes-MIR396b, mes-MIR396c, mes-MIR396d, mes-MIR396e, mes-MIR396f, mes-MIR399b, mes-MIR399c, mes-MIR399d, mes-MIR399e, mes-MIR399f, mes-MIR399g, mes-MIR477h, mes-MIR477i, mes-MIR477a, mes-MIR477b, mes-MIR477c, mes-MIR477d, mes-MIR477e, mes-MIR477f, mes-MIR477g, mes-MIR482, mes-MIR828a, mes-MIR828b, mes-MIR171l, mes-MIR398, mes-MIR399h, mes-MIR477j, mes-MIR2118, mes-MIR3627, mes-MIR169ad
Note that the miR319 and miR395 families are well conserved in plants, and miR477 is conserved in Populus, Arabidopsis, Grape vine and Moss (Table  2A), suggesting their conserved function in plant stress response. [score:1]
[1 to 20 of 1 sentences]