MIRLET7E is a microRNA gene that has been identified in various studies. It is a member of the let-7 family of microRNAs and has been found to be differentially expressed in different contexts. In a study on pediatric cancers, a custom gene panel was designed to include MIRLET7E for mutation profiling [PMC7341754]. Another study identified MIRLET7E as one of the differentially expressed microRNAs [PMC4052096]. It has been shown that the promoter region of MIRLET7E can be hypermethylated, leading to decreased expression [PMC4053776]. In breast cancer cell lines, MIRLET7E was found to be epigenetically repressed by lysine-specific demethylase 5B (JARID1B) [PMC4053776]. The expression profiles of MIRLET7E were missing in an independent dataset, and its expression levels were validated along with other genes [PMC10113532]. In the context of liver disorders, it was found that MIRLET7E was down-regulated by CPV treatment, which may contribute to its therapeutic effect [PMC6957807]. Furthermore, MIRLET7E has been associated with negative regulation of the anti-inflammatory cytokine IL-10 and has been implicated in autoimmune disorders and liver fibrosis [PMC6957807]. The interaction between NEAT1 and various genes including MIRLET7E was also observed in a study [PMC9730017]. Finally, in bovine neutrophils under supplementation with quercetin during inflammation induction, an inverse relationship between MIRLET7E expression and IL6 mRNA levels was observed [PMC5422244].
c cU G U ------- a g cc ggg GAG UAGGAGGUUGUAUAGU ga gg g a || ||| ||| |||||||||||||||| || || | gg ccC UUC AUCCUCCGGCAUAUCa cu cc c c a CU G - agaggaa - a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000066 |
Description | Homo sapiens hsa-let-7e-5p mature miRNA |
Sequence | 8 - UGAGGUAGGAGGUUGUAUAGUU - 29 |
Evidence |
experimental
cloned [1-4], Northern [1], Illumina [5] |
Database links | |
Predicted targets |
Accession | MIMAT0004485 |
Description | Homo sapiens hsa-let-7e-3p mature miRNA |
Sequence | 53 - CUAUACGGCCUCCUAGCUUUCC - 74 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
|