MIR32 is a microRNA that has been observed to be upregulated in thyroid cancer compared to benign thyroid tumors, indicating a potential role in the pathology of papillary thyroid carcinoma (PTC), although its functional implications in PTC remain unclear [PMC4315163]. Research has shown that MIR32 can directly inhibit the RNA virus, primate foamy retrovirus type 1, and degrade the coding region of influenza PB1 [PMC7833564]. MIR32, along with miR214 and miR98, has been suggested as a potential therapeutic agent for the suppression of Tmprss2, which is considered a critical drug target [PMC7833564]. It is also listed among the top 40 differential genes in a study that may be relevant to its role in disease processes or as biomarkers [PMC9730279]. Experimental studies have utilized MIR32 mimics and antagomirs to investigate its effects by transfecting them into 293 T cells [PMC6967090], and its expression has been measured using real-time PCR assays alongside other microRNAs [PMC3424561]. Changes in the abundance of MIR32 have also been observed in knockout mice studies, which may contribute to understanding its biological functions [PMC10001410].
U - uu c ggagaUAUUGCACAU ACUAAGUUGCAu g gu a ||||||||||||||| |||||||||||| | || cuUUUAUAGUGUGUG UGAUUUAACgua c cg c - a uc g
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000090 |
Description | Homo sapiens hsa-miR-32-5p mature miRNA |
Sequence | 6 - UAUUGCACAUUACUAAGUUGCA - 27 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004505 |
Description | Homo sapiens hsa-miR-32-3p mature miRNA |
Sequence | 47 - CAAUUUAGUGUGUGUGAUAUUU - 68 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|