Hsa-mir-33a is a microRNA that has been found to play a role in various types of cancer, including glioblastoma, hepatocellular carcinoma (HCC), prostate cancer, lung adenocarcinoma, and endometrial cancer [26][27][45][46][PMC9200351][PMC8843861][PMC8615810][PMC9789638][PMC8257864]. It has been shown to regulate the expression of neuropilin-2, inhibiting glioblastoma cell migration [26]. Depletion of hsa-mir-33a is associated with tumorigenesis and poor prognosis in HCC patients [27]. However, there is no evidence in the provided context to support the claim that hsa-mir-33a can interfere with the cisplatin resistance of HCC cells [28]. In liver cancer, miRNAs related to hsa-mir-33a are enriched in fatty acid synthesis and metabolism pathways [PMC8843861]. Hsa-mir-33a has also been found to be dysregulated in HIV patients and may be involved in lipid metabolism [PMC8615810]. In a study on endometrial cancer progression, hsa-mir-33a was identified as a hub gene in ceRNA networks [PMC9200351]. The gene body of SREBF2, including the hsa-mir-33a locus, was found to be hypomethylated and may contribute to the down-regulation of SREBF2 expression [PMC9789638]. Hsa-mir-33a is also involved in the regulation of MAP4K3 expression in gestational diabetes mellitus (GDM) [PMC8257864]. Overall, hsa-mir-33a has been implicated in various biological processes and diseases through its regulation of target genes.
A UU uucu g cugugGUGCAUUGU G GCAUUGCAug ggu |||||||||||||| | |||||||||| ||| g gaCACUACGUGACA C UGUAACguac cca C UU ---- u
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000091 |
Description | Homo sapiens hsa-miR-33a-5p mature miRNA |
Sequence | 6 - GUGCAUUGUAGUUGCAUUGCA - 26 |
Evidence |
experimental
cloned [1-2], Northern [1] |
Database links | |
Predicted targets |
Accession | MIMAT0004506 |
Description | Homo sapiens hsa-miR-33a-3p mature miRNA |
Sequence | 46 - CAAUGUUUCCACAGUGCAUCAC - 67 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|