miRBase entry: mmu-mir-99b

Stem-loop mmu-mir-99b


Accession
MI0000147
Symbol
MGI: Mir99b
Description
Mus musculus mmu-mir-99b precursor miRNA

Literature search
54 open access papers mention mmu-mir-99b
(472 sentences)

Sequence

2837315 reads, 3161 reads per million, 107 experiments
ggcaccCACCCGUAGAACCGACCUUGCGgggccuucgccgcacaCAAGCUCGUGUCUGUGGGUCCGuguc
(((((..(((((((((..(((.((((.(.(((....))).)...)))).)))..)))))))))..)))))

Structure
     cC         AC   C    --C g   c 
ggcac  ACCCGUAGA  CGA CUUG   G ggc u
|||||  |||||||||  ||| ||||   | |||  
cuguG  UGGGUGUCU  GCU GAAC   c ccg u
     CC         GU   C    aca g   c 


Annotation confidence High
Do you think this miRNA is real?
Comments
Expression of this miRNA in mouse was independently verified in the brain [1], embryonic stem cells [2] and testes [3].

Genome context
chr17: 17830188-17830257 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from mmu-mir-99b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-99b-5p

Accession MIMAT0000132
Description Mus musculus mmu-miR-99b-5p mature miRNA
Sequence 7 - CACCCGUAGAACCGACCUUGCG - 28
Evidence experimental
cloned [1-4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-99b-3p

Accession MIMAT0004525
Description Mus musculus mmu-miR-99b-3p mature miRNA
Sequence 45 - CAAGCUCGUGUCUGUGGGUCCG - 66
Evidence experimental
cloned [4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009