miRBase entry: mmu-mir-154

Stem-loop mmu-mir-154


Accession
MI0000176
Symbol
MGI: Mir154
Description
Mus musculus mmu-mir-154 precursor miRNA

Literature search
24 open access papers mention mmu-mir-154
(125 sentences)

Sequence

26487 reads, 320 reads per million, 72 experiments
gaagaUAGGUUAUCCGUGUUGCCUUCGcuuuauucgugacgAAUCAUACACGGUUGACCUAUUuuu
((((((((((((.((((((....(((((.........).))))....)))))).))))))))))))

Structure
            U      UGCC    - uuu 
gaagaUAGGUUA CCGUGU    UUCG c   a
|||||||||||| ||||||    |||| |   u
uuuUUAUCCAGU GGCACA    AAgc g   u
            U      UACU    a ugc 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr12: 109738433-109738498 [+]
Clustered miRNAs
14 other miRNAs are < 10 kb from mmu-mir-154
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-154-5p

Accession MIMAT0000164
Description Mus musculus mmu-miR-154-5p mature miRNA
Sequence 6 - UAGGUUAUCCGUGUUGCCUUCG - 27
Evidence experimental
cloned [1,3-4], PCR [2], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-154-3p

Accession MIMAT0004537
Description Mus musculus mmu-miR-154-3p mature miRNA
Sequence 42 - AAUCAUACACGGUUGACCUAUU - 63
Evidence experimental
cloned [4], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 15310658
    A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain
    "Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J"
    "Genome Res (2004) 14:1741-1748