miRBase entry: mmu-mir-129-1

Stem-loop mmu-mir-129-1


Accession
MI0000222
Symbol
MGI: Mir129-1
Description
Mus musculus mmu-mir-129-1 precursor miRNA

Literature search
52 open access papers mention mmu-mir-129-1
(521 sentences)

Sequence

161182 reads, 439 reads per million, 100 experiments
uggauCUUUUUGCGGUCUGGGCUUGCuguucucucgacaguagucaggAAGCCCUUACCCCAAAAAGUAUcua
((((((((((((.(((..((((((.(((..((((....)).)).))).))))))..))).))))))).)))))

Structure
     -       C   CU      G   uu  -  c 
uggau CUUUUUG GGU  GGGCUU Cug  cu cu g
||||| ||||||| |||  |||||| |||  || ||  
aucUA GAAAAAC CCA  CCCGAA gac  ga ga a
     U       C   UU      g   -u  u  c 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chr6: 29022619-29022691 [+]

Database links

Mature mmu-miR-129-5p

Accession MIMAT0000209
Description Mus musculus mmu-miR-129-5p mature miRNA
Sequence 6 - CUUUUUGCGGUCUGGGCUUGC - 26
Evidence experimental
cloned [1,3-4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-129-1-3p

Accession MIMAT0016994
Description Mus musculus mmu-miR-129-1-3p mature miRNA
Sequence 49 - AAGCCCUUACCCCAAAAAGUAU - 70
Evidence experimental
Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12554859
    New microRNAs from mouse and human
    "Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T"
    "RNA (2003) 9:175-179

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  5. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  6. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009