MIR129-1, a microRNA involved in gene expression regulation, is transcribed from a genomic locus that includes several underexpressed miRNAs in SMZL [PMC8064455], [PMC8138178]. There is no direct evidence suggesting that MIR129-1 is affected by miRNA eQTL mechanisms due to the proximity of a Parkinson’s disease risk SNP to MIR132, as the original context refers to MIR132 and not MIR129-1 [PMC9645562]. MIR129-1 is implicated in various biological processes including cell proliferation and migration, and its dysregulation has been observed post-spinal cord injury [PMC6394761], [PMC6515063]. Additionally, miR-129-5p, produced by MIR129-1, has been recognized for its role in liver function improvement and anti-inflammatory effects in liver disease models [PMC8138178]. While there is no CpG island near the MIR129-1 promoter, unlike MIR129-2, both are important for transcriptional regulation and are located on different chromosomes [PMC3576298]. Experimental studies on hypoxia have utilized transfection of MIR129-1 mimic to assess its expression under such conditions using qPCR with specific TaqMan probes for validation [PMC7399878].
- C CU G uu cu c
ggau CUUUUUG GGU GGGCUU Cug c cu a
|||| ||||||| ||| |||||| ||| | ||
ucUA GAAAAAC CCA CCCGAA gac g ga a
U C UU g -u au c
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000242 |
| Description | Homo sapiens hsa-miR-129-5p mature miRNA |
| Sequence | 5 - CUUUUUGCGGUCUGGGCUUGC - 25 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004548 |
| Description | Homo sapiens hsa-miR-129-1-3p mature miRNA |
| Sequence | 49 - AAGCCCUUACCCCAAAAAGUAU - 70 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|