MIR148A is a microRNA (miRNA) that has been studied for its role in the modulation of protein expression, although it has been found to have minimal impact on protein regulation in cell lines [PMC10057657]. This miRNA, along with miR-148b and miR-152, is part of the miR-148/152 family and is capable of recognizing and binding to specific target sites, which can lead to the downregulation of transgenes with engineered target sites [PMC4467430]. While the effects of psychotropics on MIR148A and other miRNAs, as well as on proteins like REST, are considered worth investigating in Huntington's disease models, the context does not establish a direct influence of MIR148A on various biological processes or its effects on other miRNAs and proteins specifically in HD models [PMC3856079]. Additionally, MIR148A has been identified as a potential regulator of DNMT1 expression, which is notably increased in adipocytes from obese individuals [PMC6817687]. Dysregulation of MIR148A expression has also been observed in immune cells from patients with lupus, implicating it in inflammatory dysfunction and conditions such as T cell autoreactivity and cytokine production [PMC7139533].
- -A CC - ag gaggcAAAGUUCUG AG CACU GACU cug u |||||||||||||| || |||| |||| ||| a cucUGUUUCAAGAC UC GUGA CUga gau u A AC -- a ag
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004549 |
Description | Homo sapiens hsa-miR-148a-5p mature miRNA |
Sequence | 6 - AAAGUUCUGAGACACUCCGACU - 27 |
Evidence |
experimental
cloned [3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0000243 |
Description | Homo sapiens hsa-miR-148a-3p mature miRNA |
Sequence | 44 - UCAGUGCACUACAGAACUUUGU - 65 |
Evidence |
experimental
cloned [1-3], Northern [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|