WARNING: This summary was generated by AI. MIR139 is recognized as a microRNA with tumor suppressor activity in acute myeloid leukemia (AML) [PMC8885418]. This microRNA has been linked to specific targets that are believed to mediate its suppressive functions in the context of AML [PMC8885418]. In the plant species cucumber, homologous genes to those targeted by MIR139 in AML have been identified, including CsTCP27, CsTCP25, CsTCP14, and CsTCP12 [PMC7709023]. However, it should be noted that the well-matched coding regions of these cucumber genes suggest they might be potential targets of miR319, not MIR139, which may indicate a typographical error in the original text [PMC7709023]. The identification of these targets is significant as it provides insight into the evolutionary conservation and functional roles of microRNAs across different species [PMC7709023].
gug - U A g gg uauUCUA CAG GC CGUGUCUCCAGU u c ||||||| ||| || |||||||||||| | u aUGAGGU GUC CG GCGCAGAGGUcg a c -ca U C - g gg
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000250 |
| Description | Homo sapiens hsa-miR-139-5p mature miRNA |
| Sequence | 7 - UCUACAGUGCACGUGUCUCCAGU - 29 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004552 |
| Description | Homo sapiens hsa-miR-139-3p mature miRNA |
| Sequence | 43 - UGGAGACGCGGCCCUGUUGGAGU - 65 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|