MIR139 is a microRNA that has been identified as a tumor suppressor in acute myeloid leukemia (AML) [PMC8885418]. In AML, MIR139 targets specific genes that mediate its tumor suppressor activity [PMC8885418]. In cucumber, there are evolutionary TCPs (TEOSINTE BRANCHED1/CYCLOIDEA/PCF) that are closely related to these genes [PMC7709023]. These TCPs in cucumber, namely CsTCP27, CsTCP25, CsTCP14, and CsTCP12, have coding regions that show significant sequence similarity to MIR139 [PMC7709023]. It is suggested that these TCPs in cucumber may be the targets of another microRNA called miR319 [PMC7709023]. The presence of well-matched sequences between MIR139 and the coding regions of these TCPs suggests a potential regulatory relationship between miR319 and the identified genes in cucumber [PMC7709023]. References: - [PMC8885418]: Zhang Y et al. (2021) MicroRNA-139-5p inhibits acute myeloid leukemia cell proliferation and promotes apoptosis by targeting HDAC4. Cancer Cell Int. 21(1): 1-12. - [PMC7709023]: Zhang Y et al. (2020) Genome-wide identification of TCP family transcription factors in cucumber (Cucumis sativus L.) and their expression analysis under different treatments. BMC Genomics. 21(1): 1-14.
gug - U A g gg uauUCUA CAG GC CGUGUCUCCAGU u c ||||||| ||| || |||||||||||| | u aUGAGGU GUC CG GCGCAGAGGUcg a c -ca U C - g gg
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000250 |
Description | Homo sapiens hsa-miR-139-5p mature miRNA |
Sequence | 7 - UCUACAGUGCACGUGUCUCCAGU - 29 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0004552 |
Description | Homo sapiens hsa-miR-139-3p mature miRNA |
Sequence | 43 - UGGAGACGCGGCCCUGUUGGAGU - 65 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|