miRBase entry: mmu-mir-292a

Stem-loop mmu-mir-292a


Accession
MI0000390
Description
Mus musculus mmu-mir-292a precursor miRNA mir-290
Gene
family?
RF00665; mir-290

Literature search
16 open access papers mention mmu-mir-292a
(149 sentences)

Sequence

50469 reads, 556 reads per million, 49 experiments
cagccugugauACUCAAACUGGGGGCUCUUUUGgauuuucaucggaagaAAAGUGCCGCCAGGUUUUGAGUGUcaccgguug
(((((.((((((((((((((((.(((.((((....(((((....))))))))).))).))))..)))))))))))).)))))

Structure
     u            --    G   U    UGga     a 
cagcc gugauACUCAAA  CUGG GGC CUUU    uuuuc u
||||| ||||||||||||  |||| ||| ||||    |||||  
guugg cacUGUGAGUUU  GACC CCG GAAA    agaag c
     c            UG    G   U    ----     g 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr7: 3219189-3219270 [+]
Clustered miRNAs
8 other miRNAs are < 10 kb from mmu-mir-292a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-292a-5p

Accession MIMAT0000369
Description Mus musculus mmu-miR-292a-5p mature miRNA
Sequence 12 - ACUCAAACUGGGGGCUCUUUUG - 33
Evidence experimental
cloned [1-2], Northern [1], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-292a-3p

Accession MIMAT0000370
Description Mus musculus mmu-miR-292a-3p mature miRNA
Sequence 50 - AAAGUGCCGCCAGGUUUUGAGUGU - 73
Evidence experimental
cloned [1-2], Northern [1], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  4. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009