miRBase entry: mmu-mir-130b

Stem-loop mmu-mir-130b


Accession
MI0000408
Symbol
MGI: Mir130b
Description
Mus musculus mmu-mir-130b precursor miRNA

Literature search
287 open access papers mention mmu-mir-130b
(961 sentences)

Sequence

98869 reads, 323.0 reads per million, 162 experiments
ggcuuguuggacACUCUUUCCCUGUUGCACUACUgugggccucugggaagCAGUGCAAUGAUGAAAGGGCAUcugucgggcc
((((((..(((..(((((((..(((((((((.((.....((...))..)).)))))))))..)))))))..)))..))))))

Structure
      uu   cA       CC         A  guggg  u 
ggcuug  gga  CUCUUUC  UGUUGCACU CU     cc  
||||||  |||  |||||||  ||||||||| ||     || c
ccgggc  ucU  GGGAAAG  GUAACGUGA ga     gg  
      ug   AC       UA         C  ---ag  u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
16: 16941925-16942006 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from mmu-mir-130b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-130b-5p

Accession MIMAT0004583
Description Mus musculus mmu-miR-130b-5p mature miRNA
Sequence 13 - ACUCUUUCCCUGUUGCACUACU - 34
Evidence experimental
cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-130b-3p

Accession MIMAT0000387
Description Mus musculus mmu-miR-130b-3p mature miRNA
Sequence 51 - CAGUGCAAUGAUGAAAGGGCAU - 72
Evidence experimental
cloned [1-3], Northern [1], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12919684
    Embryonic stem cell-specific MicroRNAs
    "Houbaviy HB, Murray MF, Sharp PA"
    "Dev Cell (2003) 5:351-358

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009