Accession
MI0000437
Symbol
HGNC:
MIR1-2
Description
Homo sapiens
hsa-mir-1-2 precursor miRNA
Gene family
MIPF0000038;
mir-1
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR1-2, a microRNA, was found to induce differentiation of bone marrow-derived mesenchymal stem cells (BMSCs) into cardiomyocytes by activating the Wnt/β-catenin signaling pathways [PMC5424345]. This study demonstrated that the over-expression of MIR1-2 in BMSCs effectively promoted cardiomyocyte differentiation with less cytotoxicity compared to the use of 5-aza, a commonly used differentiation inducer [PMC5424345]. Copy number assays were used to measure the expression levels of various genes, including MIR1-2 and other genes involved in cell cycle regulation and proliferation [PMC7083839]. The specific copy number assays used were as follows: MIR1-2 (Hs06506989_cn), CCND1 (Hs00377865_cn), CCND2 (Hs00394283_cn), CCND3 (Hs02982157_cn), CDKN1B (Hs02136152_cn), CDKN2A (Hs03714372_cn), CDK4 (Hs01071103_cn), and CDK6 (Hs00389416_cn) [PMC7083839]. These assays were purchased from Thermofisher, a well-known supplier of molecular biology reagents [PMC7083839]. Overall, this study provides evidence that MIR1-2 can effectively induce BMSC differentiation into cardiomyocytes through Wnt/β-catenin signaling pathways and suggests its potential as a therapeutic approach for cardiac regeneration [PMC5424345].
Literature search
520 open access papers mention hsa-mir-1-2
(2664 sentences)
(2664 sentences)
Sequence
6897451
reads,
5211
reads per million, 153 experiments
accuacucagaguacauacuucuuuauguacccauaugaacauacaaugcuaUGGAAUGUAAAGAAGUAUGUAUuuuugguaggc
.((((((.(((((((((((((((((((((..(((((..(........)..))))).))))))))))))))))))))).)))))).
.((((((.(((((((((((((((((((((..(((((..(........)..))))).))))))))))))))))))))).)))))).
Structure
a c ac ug aca ccuacu agaguacauacuucuuuaugu ccaua a u |||||| ||||||||||||||||||||| ||||| | ggaugg uuuUAUGUAUGAAGAAAUGUA GGUau u a c u -A cg aac
Annotation confidence
High
Do you think this miRNA is real?
Comments
Lagos-Quintana et al. [1] reported the cloning of miR-1b, miR-1c and miR-1d. The mature processed miR sequences are identical apart from the 3' residues (A in mir-1b, C in mir-1c and UU in mir-1d). The 3' residues of both miR-1b and miR-1c conflict with the predicted stem-loop precursor sequence shown here and these sequences are not found in current assemblies of human and mouse genomes. It is suggested that polyA polymerase may add 1-3 nts to the 3' end of the mature transcript (Tom Tuschl, pers. comm.). The common 21 nts of the 3 reported miR sequences have been rationalised here and named miR-1. There are 2 pairs of orthologous putative hairpin precursor structures named mir-1-1 (human MIR:MI0000651, mouse MIR:MI0000139), and mir-1-2 (human MIR:MI0000437, mouse MIR:MI0000652). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].
Genome context
chr18: 21829004-21829088 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-1-2
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
Disease association
hsa-mir-1-2 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-1-3p
| Accession | MIMAT0000416 |
| Description | Homo sapiens hsa-miR-1-3p mature miRNA |
| Sequence | 53 - UGGAAUGUAAAGAAGUAUGUAU - 74 |
| Evidence |
experimental
cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
References
|
