Stem-loop hsa-mir-30b

Accession

MI0000441

Symbol

HGNC: MIR30B

Description

Homo sapiens hsa-mir-30b precursor miRNA

Gene family

MIPF0000005; mir-30

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR30B is a microRNA that has been studied in relation to its effect on autophagy. To determine if this effect is specific to H. pylori, researchers conducted a study where they detected MAP1LC3B-II conversion under starvation conditions [PMC3429542]. In normal conditions, transfection with either MIR30B or miR-26a mimic resulted in a significant increase in the expression of the pro-apoptotic CASP3 and APAF1 genes in BT474 wt and BT474r cells, but not in HCC1954 cells [PMC5264595]. The study found that MIR30B and miR-26a mimic increased CASP3 expression with p-values of 0.026 and 0.032 respectively for BT474 wt cells, and p-values of 0.034 and 0.019 respectively for BT474r cells [PMC5264595]. Similarly, MIR30B and miR-26a mimic increased APAF1 expression with p-values of 0.035 and 0.042 respectively for BT474 wt cells, and p-values of 0.041 and 0.034 respectively for BT474r cells [PMC5264595]. However, there was no significant increase in CASP3 or APAF1 expression observed in HCC1954 cells when transfected with either MIR30B or miR-26a mimic [PMC5264595]. These findings suggest that the effect of MIR30B on autophagy may be specific to certain cell types or conditions [PMC3429542] [PMC5264595].

Literature search

398 open access papers mention hsa-mir-30b
(1810 sentences)

Sequence

147792 reads, 938 reads per million, 136 experiments

accaaguuucaguucaUGUAAACAUCCUACACUCAGCUguaauacauggauuggCUGGGAGGUGGAUGUUUACUUCagcugacuugga
.(((((..((((((...((((((((((.((.((((((((............))))))))..))))))))))))...))))))))))).

Structure

a     uu      caU          U  -A        uaaua 
 ccaag  ucaguu   GUAAACAUCC AC  CUCAGCUg     c
 |||||  ||||||   |||||||||| ||  ||||||||      
 gguuc  agucga   CAUUUGUAGG UG  GGGUCggu     a
a     --      CUU          -  GA        uaggu 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1], later verified in human [2].

Genome context

chr8: 134800520-134800607 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-30b

Mature hsa-miR-30b-5p

• Accession: MIMAT0000420
• Description: Homo sapiens hsa-miR-30b-5p mature miRNA
• Sequence: 17 - UGUAAACAUCCUACACUCAGCU - 38
• Evidence: experimental ; cloned [2-3]

Mature hsa-miR-30b-3p

• Accession: MIMAT0004589
• Description: Homo sapiens hsa-miR-30b-3p mature miRNA
• Sequence: 55 - CUGGGAGGUGGAUGUUUACUUC - 76
• Evidence: experimental ; cloned [2]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739