WARNING: This summary was generated by AI. MIR124-1 is a gene that encodes for a microRNA, which is a small non-coding RNA molecule playing a role in gene regulation [PMC4268894]. Research has identified a positive interaction between the polymorphism rs531564 in MIR124-1 and rs10759 in the RGS4 gene, which is indicated by an interaction entropy of 0.14% [PMC5848672]. This interaction suggests that MIR124-1 may have an influential role in genetic networks and could potentially contribute to disease processes [PMC4268894]. Conversely, the same study found that rs10759 has a negative interaction with rs951436 in RGS4, with an entropy of -0.13%, highlighting the complex interplay between genetic variants within these regions [PMC5848672]. The findings underscore the importance of MIR124-1 within this genomic interval and its potential implications for disease understanding and possibly for therapeutic targeting [PMC4268894; PMC5848672]..
a uc cC A GA uaaau ggccuc ucu GUGUUCAC GCG CCUUGAUu g |||||| ||| |||||||| ||| |||||||| u ucgggg agA CGUAAGUG CGC GGAAUuaa c g ua AC G AC cauac
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004591 |
| Description | Homo sapiens hsa-miR-124-5p mature miRNA |
| Sequence | 14 - CGUGUUCACAGCGGACCUUGAU - 35 |
| Evidence |
experimental
cloned [5] |
| Accession | MIMAT0000422 |
| Description | Homo sapiens hsa-miR-124-3p mature miRNA |
| Sequence | 53 - UAAGGCACGCGGUGAAUGCCAA - 74 |
| Evidence |
experimental
cloned [2,4-5] |
| Database links |
|
| Predicted targets |
|
|