miRBase entry: hsa-mir-124-1

Stem-loop hsa-mir-124-1


Accession
MI0000443
Symbol
HGNC: MIR124-1
Description
Homo sapiens hsa-mir-124-1 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR124-1 is a gene that encodes for a microRNA, which is a small non-coding RNA molecule playing a role in gene regulation [PMC4268894]. Research has identified a positive interaction between the polymorphism rs531564 in MIR124-1 and rs10759 in the RGS4 gene, which is indicated by an interaction entropy of 0.14% [PMC5848672]. This interaction suggests that MIR124-1 may have an influential role in genetic networks and could potentially contribute to disease processes [PMC4268894]. Conversely, the same study found that rs10759 has a negative interaction with rs951436 in RGS4, with an entropy of -0.13%, highlighting the complex interplay between genetic variants within these regions [PMC5848672]. The findings underscore the importance of MIR124-1 within this genomic interval and its potential implications for disease understanding and possibly for therapeutic targeting [PMC4268894; PMC5848672]..

Literature search
456 open access papers mention hsa-mir-124-1
(3834 sentences)

Sequence

113156 reads, 433.0 reads per million, 78 experiments
aggccucucucucCGUGUUCACAGCGGACCUUGAUuuaaauguccauacaauUAAGGCACGCGGUGAAUGCCAAgaauggggcug
.((((((..(((..((((((((.(((..((((((((.............))))))))..))).))))))))..)))..)))))).

Structure
a      uc   cC        A   GA        uaaau 
 ggccuc  ucu  GUGUUCAC GCG  CCUUGAUu     g
 ||||||  |||  |||||||| |||  ||||||||     u
 ucgggg  agA  CGUAAGUG CGC  GGAAUuaa     c
g      ua   AC        G   AC        cauac 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr8: 9903388-9903472 [-]

Disease association
hsa-mir-124-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-124-5p

Accession MIMAT0004591
Description Homo sapiens hsa-miR-124-5p mature miRNA
Sequence 14 - CGUGUUCACAGCGGACCUUGAU - 35
Evidence experimental
cloned [5]

Mature hsa-miR-124-3p

Accession MIMAT0000422
Description Homo sapiens hsa-miR-124-3p mature miRNA
Sequence 53 - UAAGGCACGCGGUGAAUGCCAA - 74
Evidence experimental
cloned [2,4-5]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739