WARNING: This summary was generated by AI. MIR124-2 is a genomic locus that is subject to methylation, a process that can regulate gene expression [PMC5338782]. In the context of human papillomavirus (HPV) DNA testing, the methylation status of MIR124-2, along with FAM19A4, is assessed using the QIAsure Methylation Test [PMC10095339]. This testing is conducted at the time of enrollment for individuals being screened for HPV [PMC10095339]. Notably, MIR124-2 has been identified as the locus with the highest frequency of methylation in follow-up specimens as well, suggesting its potential importance in monitoring HPV-related changes over time [PMC5338782].
a au ---- cC A GA uaau ucaag uag aggcucugcucu GUGUUCAC GCG CCUUGAUu g ||||| ||| |||||||||||| |||||||| ||| |||||||| u aguuc guc uccgaggcgagA CGUAAGUG CGC GGAAUuaa c a ac ggca AC G AC caua
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004591 |
| Description | Homo sapiens hsa-miR-124-5p mature miRNA |
| Sequence | 25 - CGUGUUCACAGCGGACCUUGAU - 46 |
| Evidence |
experimental
cloned [5] |
| Accession | MIMAT0000422 |
| Description | Homo sapiens hsa-miR-124-3p mature miRNA |
| Sequence | 62 - UAAGGCACGCGGUGAAUGCCAA - 83 |
| Evidence |
experimental
cloned [2,4-5] |
| Database links |
|
| Predicted targets |
|
|