MIR124-2 is a locus that is frequently methylated in HPV DNA testing. The methylation status of MIR124-2 is analyzed using the QIAsure Methylation Test [PMC10095339]. This test is performed at enrollment and also in follow-up specimens [PMC5338782]. MIR124-2 is the most frequently methylated locus in both the initial testing and follow-up specimens [PMC5338782]. The QIAsure Methylation Test by Qiagen is a reliable method for analyzing the methylation status of MIR124-2 [PMC10095339]. This test, along with HPV DNA testing using HC2 and full HPV genotyping by Anyplex II HPV28 Detection Kit, provides comprehensive information about the presence of HPV and methylation status of MIR124-2 [PMC10095339]. The use of these tests at enrollment allows for early detection and monitoring of HPV infection, as well as identification of methylated loci such as MIR124-2 [PMC5338782]. The frequent methylation of MIR124-2 suggests its potential as a biomarker for HPV infection and its progression [PMC5338782]. Further research can explore the clinical implications and potential therapeutic targets associated with the methylation status of MIR124-2 in HPV infection.
a au ---- cC A GA uaau ucaag uag aggcucugcucu GUGUUCAC GCG CCUUGAUu g ||||| ||| |||||||||||| |||||||| ||| |||||||| u aguuc guc uccgaggcgagA CGUAAGUG CGC GGAAUuaa c a ac ggca AC G AC caua
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004591 |
Description | Homo sapiens hsa-miR-124-5p mature miRNA |
Sequence | 25 - CGUGUUCACAGCGGACCUUGAU - 46 |
Evidence |
experimental
cloned [5] |
Accession | MIMAT0000422 |
Description | Homo sapiens hsa-miR-124-3p mature miRNA |
Sequence | 62 - UAAGGCACGCGGUGAAUGCCAA - 83 |
Evidence |
experimental
cloned [2,4-5] |
Database links | |
Predicted targets |
|