miRBase entry: hsa-mir-124-2

Stem-loop hsa-mir-124-2


Accession
MI0000444
Symbol
HGNC: MIR124-2
Description
Homo sapiens hsa-mir-124-2 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR124-2 is a genomic locus that is subject to methylation, a process that can regulate gene expression [PMC5338782]. In the context of human papillomavirus (HPV) DNA testing, the methylation status of MIR124-2, along with FAM19A4, is assessed using the QIAsure Methylation Test [PMC10095339]. This testing is conducted at the time of enrollment for individuals being screened for HPV [PMC10095339]. Notably, MIR124-2 has been identified as the locus with the highest frequency of methylation in follow-up specimens as well, suggesting its potential importance in monitoring HPV-related changes over time [PMC5338782].

Literature search
428 open access papers mention hsa-mir-124-2
(3661 sentences)

Sequence

97953 reads, 375 reads per million, 63 experiments
aucaagauuagaggcucugcucucCGUGUUCACAGCGGACCUUGAUuuaaugucauacaauUAAGGCACGCGGUGAAUGCCAAgagcggagccuacggcugcacuugaa
.(((((..(((((((((((((((..((((((((.(((..((((((((...........))))))))..))).))))))))..))))))))))))....)))..))))).

Structure
a     au   ----            cC        A   GA        uaau 
 ucaag  uag    aggcucugcucu  GUGUUCAC GCG  CCUUGAUu    g
 |||||  |||    ||||||||||||  |||||||| |||  ||||||||    u
 aguuc  guc    uccgaggcgagA  CGUAAGUG CGC  GGAAUuaa    c
a     ac   ggca            AC        G   AC        caua 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr8: 64379149-64379257 [+]

Disease association
hsa-mir-124-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-124-5p

Accession MIMAT0004591
Description Homo sapiens hsa-miR-124-5p mature miRNA
Sequence 25 - CGUGUUCACAGCGGACCUUGAU - 46
Evidence experimental
cloned [5]

Mature hsa-miR-124-3p

Accession MIMAT0000422
Description Homo sapiens hsa-miR-124-3p mature miRNA
Sequence 62 - UAAGGCACGCGGUGAAUGCCAA - 83
Evidence experimental
cloned [2,4-5]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739