miRBase entry: hsa-mir-124-3

Stem-loop hsa-mir-124-3


Accession
MI0000445
Symbol
HGNC: MIR124-3
Description
Homo sapiens hsa-mir-124-3 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR124-3 is a member of a conserved class of microRNA, with its gene located at a distinct genomic position and is one of three genes encoding the mature miR-124 [PMC6346295], [PMC4861808]. This microRNA has been implicated in the inhibition of invasion and migration in various cancers, including ovarian and hepatocellular cancers [PMC6712160]. In ovarian cancer, MIR124-3 is significantly hypermethylated, with a 16-fold methylation difference observed in tumor samples compared to controls, suggesting its potential role in tumor pathogenesis [PMC8656781]. Moreover, hypermethylation of MIR124-3 has been associated with shorter overall survival in ovarian cancer patients [PMC8835734]. The methylation status of MIR124-3 has also been linked to the onset of ovarian cancer pathogenesis and is significantly altered in patients with borderline personality disorder (BPD), indicating its relevance to both cancer biology and mental health disorders [PMC8835734], [PMC6252387]. Additionally, MIR124-3 targets genes such as NR3C1 that are implicated in stress responses and BPD pathology [PMC6252387]. The methylation patterns observed at the promoter region of MIR124-3 suggest that epigenetic modifications could influence its expression and function across different diseases [PMC6974433].

Literature search
423 open access papers mention hsa-mir-124-3
(3672 sentences)

Sequence

97714 reads, 919 reads per million, 64 experiments
ugagggccccucugCGUGUUCACAGCGGACCUUGAUuuaaugucuauacaauUAAGGCACGCGGUGAAUGCCAAgagaggcgccucc
.(((((((.((((..((((((((.(((..((((((((............))))))))..))).))))))))..)))).))).)))).

Structure
u    -   c    gC        A   GA        uaaug 
 gagg gcc cucu  GUGUUCAC GCG  CCUUGAUu     u
 |||| ||| ||||  |||||||| |||  ||||||||      
 cucc cgg gagA  CGUAAGUG CGC  GGAAUuaa     c
c    g   a    AC        G   AC        cauau 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr20: 63178500-63178586 [+]

Disease association
hsa-mir-124-3 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-124-5p

Accession MIMAT0004591
Description Homo sapiens hsa-miR-124-5p mature miRNA
Sequence 15 - CGUGUUCACAGCGGACCUUGAU - 36
Evidence experimental
cloned [5]

Mature hsa-miR-124-3p

Accession MIMAT0000422
Description Homo sapiens hsa-miR-124-3p mature miRNA
Sequence 53 - UAAGGCACGCGGUGAAUGCCAA - 74
Evidence experimental
cloned [2,4-5]
Database links
Predicted targets

References

  1. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  2. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  3. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  4. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  5. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739