Accession
MI0000445
Symbol
HGNC:
MIR124-3
Description
Homo sapiens
hsa-mir-124-3 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR124-3 is a member of a conserved class of microRNA, with its gene located at a distinct genomic position and is one of three genes encoding the mature miR-124 [PMC6346295], [PMC4861808]. This microRNA has been implicated in the inhibition of invasion and migration in various cancers, including ovarian and hepatocellular cancers [PMC6712160]. In ovarian cancer, MIR124-3 is significantly hypermethylated, with a 16-fold methylation difference observed in tumor samples compared to controls, suggesting its potential role in tumor pathogenesis [PMC8656781]. Moreover, hypermethylation of MIR124-3 has been associated with shorter overall survival in ovarian cancer patients [PMC8835734]. The methylation status of MIR124-3 has also been linked to the onset of ovarian cancer pathogenesis and is significantly altered in patients with borderline personality disorder (BPD), indicating its relevance to both cancer biology and mental health disorders [PMC8835734], [PMC6252387]. Additionally, MIR124-3 targets genes such as NR3C1 that are implicated in stress responses and BPD pathology [PMC6252387]. The methylation patterns observed at the promoter region of MIR124-3 suggest that epigenetic modifications could influence its expression and function across different diseases [PMC6974433].
Literature search
423 open access papers mention hsa-mir-124-3
(3672 sentences)
(3672 sentences)
Sequence
97714
reads,
919
reads per million, 64 experiments
ugagggccccucugCGUGUUCACAGCGGACCUUGAUuuaaugucuauacaauUAAGGCACGCGGUGAAUGCCAAgagaggcgccucc
.(((((((.((((..((((((((.(((..((((((((............))))))))..))).))))))))..)))).))).)))).
.(((((((.((((..((((((((.(((..((((((((............))))))))..))).))))))))..)))).))).)))).
Structure
u - c gC A GA uaaug gagg gcc cucu GUGUUCAC GCG CCUUGAUu u |||| ||| |||| |||||||| ||| |||||||| cucc cgg gagA CGUAAGUG CGC GGAAUuaa c c g a AC G AC cauau
Annotation confidence
High
Do you think this miRNA is real?
Comments
miR-124 was first identified by cloning studies in mouse [1]. Its expression was later verified in human embryonic stem cells [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.
Genome context
chr20: 63178500-63178586 [+]
Disease association
hsa-mir-124-3 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-124-5p
| Accession | MIMAT0004591 |
| Description | Homo sapiens hsa-miR-124-5p mature miRNA |
| Sequence | 15 - CGUGUUCACAGCGGACCUUGAU - 36 |
| Evidence |
experimental
cloned [5] |
Mature hsa-miR-124-3p
| Accession | MIMAT0000422 |
| Description | Homo sapiens hsa-miR-124-3p mature miRNA |
| Sequence | 53 - UAAGGCACGCGGUGAAUGCCAA - 74 |
| Evidence |
experimental
cloned [2,4-5] |
| Database links |
|
| Predicted targets |
|
References
|
